Differentiation Trajectory of Limbal Stem and Progenitor Cells under Normal Homeostasis and upon Corneal Wounding
Abstract
:1. Introduction
2. Methods
2.1. Mice
2.2. Pulse-Chase Experiment and Wound-Healing Procedure
2.3. Hematoxylin and Eosin (H&E) Stain
2.4. Co-Localization Study of the Label-Retaining Cells with the K14+ and p63-Bright Cells
2.5. Cell Isolation and Fluorescence-Activated Cell Sorting (FACS) to Obtain the Label-Retaining GFP+ Cells
2.6. Single-Cell RNA Sequencing and Data Analysis
2.7. Immunohistochemistry of Putative LSC Markers
2.8. Corneal and Limbal Epithelial Isolation and Quantitative Real-Time PCR
2.9. Statistical Analysis
3. Results
3.1. Validation of the Label-Retaining Transgenic Mouse Model for the Study of LSCs
3.2. The Repetitive Wound Healing Procedure Led to a Slower Epithelial Wound Closure
3.3. Single-Cell RNA Sequencing and Data Analysis
4. Discussions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Cotsarelis, G.; Cheng, S.Z.; Dong, G.; Sun, T.T.; Lavker, R.M. Existence of slow-cycling limbal epithelial basal cells that can be preferentially stimulated to proliferate: Implications on epithelial stem cells. Cell 1989, 57, 201–209. [Google Scholar] [CrossRef]
- Schermer, A.; Galvin, S.; Sun, T.T. Differentiation-related expression of a major 64K corneal keratin in vivo and in culture suggests limbal location of corneal epithelial stem cells. J. Cell Biol. 1986, 103, 49–62. [Google Scholar] [CrossRef] [PubMed]
- Pellegrini, G.; Golisano, O.; Paterna, P.; Lambiase, A.; Bonini, S.; Rama, P.; De Luca, M. Location and clonal analysis of stem cells and their differentiated progeny in the human ocular surface. J. Cell Biol. 1999, 145, 769–782. [Google Scholar] [CrossRef] [PubMed]
- Budak, M.T.; Alpdogan, O.S.; Zhou, M.; Lavker, R.M.; Akinci, M.A.; Wolosin, J.M. Ocular surface epithelia contain ABCG2-dependent side population cells exhibiting features associated with stem cells. J. Cell Sci. 2005, 118, 1715–1724. [Google Scholar] [CrossRef] [Green Version]
- Ahmad, S. Concise review: Limbal stem cell deficiency, dysfunction, and distress. Stem Cells Transl. Med. 2012, 1, 110–115. [Google Scholar] [CrossRef]
- Hayashi, R.; Yamato, M.; Sugiyama, H.; Sumide, T.; Yang, J.; Okano, T.; Tano, Y.; Nishida, K. N-Cadherin is expressed by putative stem/progenitor cells and melanocytes in the human limbal epithelial stem cell niche. Stem Cells 2007, 25, 289–296. [Google Scholar] [CrossRef]
- Lauweryns, B.; van den Oord, J.J.; De Vos, R.; Missotten, L. A new epithelial cell type in the human cornea. Investig. Ophthalmol. Vis. Sci. 1993, 34, 1983–1990. [Google Scholar]
- Kasper, M.; Moll, R.; Stosiek, P.; Karsten, U. Patterns of cytokeratin and vimentin expression in the human eye. Histochemistry 1988, 89, 369–377. [Google Scholar] [CrossRef]
- Dua, H.S.; Shanmuganathan, V.A.; Powell-Richards, A.O.; Tighe, P.J.; Joseph, A. Limbal epithelial crypts: A novel anatomical structure and a putative limbal stem cell niche. Br. J. Ophthalmol. 2005, 89, 529–532. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mei, H.; Nakatsu, M.N.; Baclagon, E.R.; Deng, S.X. Frizzled 7 maintains the undifferentiated state of human limbal stem/progenitor cells. Stem Cells 2014, 32, 938–945. [Google Scholar] [CrossRef] [Green Version]
- Ksander, B.R.; Kolovou, P.E.; Wilson, B.J.; Saab, K.R.; Guo, Q.; Ma, J.; McGuire, S.P.; Gregory, M.S.; Vincent, W.J.; Perez, V.L.; et al. ABCB5 is a limbal stem cell gene required for corneal development and repair. Nature 2014, 511, 353–357. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Watanabe, K.; Nishida, K.; Yamato, M.; Umemoto, T.; Sumide, T.; Yamamoto, K.; Maeda, N.; Watanabe, H.; Okano, T.; Tano, Y. Human limbal epithelium contains side population cells expressing the ATP-binding cassette transporter ABCG2. FEBS Lett. 2004, 565, 6–10. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; de Paiva, C.S.; Luo, L.; Kretzer, F.L.; Pflugfelder, S.C.; Li, D.Q. Characterization of putative stem cell phenotype in human limbal epithelia. Stem Cells 2004, 22, 355–366. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rama, P.; Matuska, S.; Paganoni, G.; Spinelli, A.; De Luca, M.; Pellegrini, G. Limbal stem-cell therapy and long-term corneal regeneration. N. Engl. J. Med. 2010, 363, 147–155. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pellegrini, G.; Dellambra, E.; Golisano, O.; Martinelli, E.; Fantozzi, I.; Bondanza, S.; Ponzin, D.; McKeon, F.; De Luca, M. p63 identifies keratinocyte stem cells. Proc. Natl. Acad. Sci. USA 2001, 98, 3156–3161. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, D.Q.; Kim, S.; Li, J.M.; Gao, Q.; Choi, J.; Bian, F.; Hu, J.; Zhang, Y.; Li, J.; Lu, R.; et al. Single-cell transcriptomics identifies limbal stem cell population and cell types mapping its differentiation trajectory in limbal basal epithelium of human cornea. Ocul. Surf. 2021, 20, 20–32. [Google Scholar] [CrossRef] [PubMed]
- Ligocki, A.J.; Fury, W.; Gutierrez, C.; Adler, C.; Yang, T.; Ni, M.; Bai, Y.; Wei, Y.; Lehmann, G.L.; Romano, C. Molecular characteristics and spatial distribution of adult human corneal cell subtypes. Sci. Rep. 2021, 11, 16323. [Google Scholar] [CrossRef] [PubMed]
- Català, P.; Groen, N.; Dehnen, J.A.; Soares, E.; van Velthoven, A.J.H.; Nuijts, R.M.M.A.; Dickman, M.M.; LaPointe, V.L.S. Single cell transcriptomics reveals the heterogeneity of the human cornea to identify novel markers of the limbus and stroma. Sci. Rep. 2021, 11, 21727. [Google Scholar] [CrossRef]
- Collin, J.; Queen, R.; Zerti, D.; Bojic, S.; Dorgau, B.; Moyse, N.; Molina, M.M.; Yang, C.; Dey, S.; Reynolds, G.; et al. A single cell atlas of human cornea that defines its development, limbal progenitor cells and their interactions with the immune cells. Ocul. Surf. 2021, 21, 279–298. [Google Scholar] [CrossRef] [PubMed]
- Kameishi, S.; Umemoto, T.; Matsuzaki, Y.; Fujita, M.; Okano, T.; Kato, T.; Yamato, M. Characterization of rabbit limbal epithelial side population cells using RNA sequencing and single-cell qRT-PCR. Biochem. Biophys. Res. Commun. 2016, 473, 704–709. [Google Scholar] [CrossRef]
- Kaplan, N.; Wang, J.; Wray, B.; Patel, P.; Yang, W.; Peng, H.; Lavker, R.M. Single-Cell RNA Transcriptome Helps Define the Limbal/Corneal Epithelial Stem/Early Transit Amplifying Cells and How Autophagy Affects This Population. Investig. Opthalmol. Vis. Sci. 2019, 60, 3570–3583. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Altshuler, A.; Amitai-Lange, A.; Tarazi, N.; Dey, S.; Strinkovsky, L.; Hadad-Porat, S.; Bhattacharya, S.; Nasser, W.; Imeri, J.; Ben-David, G.; et al. Discrete limbal epithelial stem cell populations mediate corneal homeostasis and wound healing. Cell Stem Cell 2021, 28, 1248–1261.E8. [Google Scholar] [CrossRef]
- Song, Z.; Tsai, C.H.; Mei, H. Comparison of different methods to isolate mouse limbal epithelial cells. Exp. Eye Res. 2021, 212, 108767. [Google Scholar] [CrossRef] [PubMed]
- Sun, T.T.; Tseng, S.C.; Lavker, R.M. Location of corneal epithelial stem cells. Nature 2010, 463, E10–E11, discussion E11. [Google Scholar] [CrossRef]
- Majo, F.; Rochat, A.; Nicolas, M.; Jaoudé, G.A.; Barrandon, Y. Oligopotent stem cells are distributed throughout the mammalian ocular surface. Nature 2008, 456, 250–254. [Google Scholar] [CrossRef]
- Pastuszak, M.; Groszewski, K.; Pastuszak, M.; Dyrla, P.; Wojtuń, S.; Gil, J. Cytokeratins in gastroenterology. Systematic review. Prz. Gastroenterol. 2015, 10, 61–70. [Google Scholar] [CrossRef]
- Massoudi, D.; Malecaze, F.; Galiacy, S.D. Collagens and proteoglycans of the cornea: Importance in transparency and visual disorders. Cell Tissue Res. 2016, 363, 337–349. [Google Scholar] [CrossRef] [PubMed]
- Mohan, R.R.; Tovey, J.C.; Gupta, R.; Sharma, A.; Tandon, A. Decorin biology, expression, function and therapy in the cornea. Curr. Mol. Med. 2011, 11, 110–128. [Google Scholar] [CrossRef]
- Joseph, A.; Hossain, P.; Jham, S.; Jones, R.E.; Tighe, P.; McIntosh, R.S.; Dua, H.S. Expression of CD34 and L-selectin on human corneal keratocytes. Investig. Ophthalmol. Vis. Sci. 2003, 44, 4689–4692. [Google Scholar] [CrossRef] [Green Version]
- Hashimoto, K.; Kouno, T.; Ikawa, T.; Hayatsu, N.; Miyajima, Y.; Yabukami, H.; Terooatea, T.; Sasaki, T.; Suzuki, T.; Valentine, M.; et al. Single-cell transcriptomics reveals expansion of cytotoxic CD4 T cells in supercentenarians. Proc. Natl. Acad. Sci. USA 2019, 116, 24242–24251. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Clevers, H.; Alarcon, B.; Wileman, T.; Terhorst, C. The T cell receptor/CD3 complex: A dynamic protein ensemble. Annu. Rev. Immunol. 1988, 6, 629–662. [Google Scholar] [CrossRef] [PubMed]
- Sims, J.E.; Tunnacliffe, A.; Smith, W.J.; Rabbitts, T.H. Complexity of human T-cell antigen receptor beta-chain constant- and variable-region genes. Nature 1984, 312, 541–545. [Google Scholar] [CrossRef]
- Wolpe, S.D.; Sherry, B.; Juers, D.; Davatelis, G.; Yurt, R.W.; Cerami, A. Identification and characterization of macrophage inflammatory protein 2. Proc. Natl. Acad. Sci. USA 1989, 86, 612–616. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sherry, B.; Tekamp-Olson, P.; Gallegos, C.; Bauer, D.; Davatelis, G.; Wolpe, S.D.; Masiarz, F.; Coit, D.; Cerami, A. Resolution of the two components of macrophage inflammatory protein 1, and cloning and characterization of one of those components, macrophage inflammatory protein 1 beta. J. Exp. Med. 1988, 168, 2251–2259. [Google Scholar] [CrossRef]
- Ziegler-Heitbrock, L.; Ancuta, P.; Crowe, S.; Dalod, M.; Grau, V.; Hart, D.N.; Leenen, P.J.; Liu, Y.J.; MacPherson, G.; Randolph, G.J.; et al. Nomenclature of monocytes and dendritic cells in blood. Blood 2010, 116, e74–e80. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.Y.; Zhu, G.; Westerhausen-Larson, A.; Converse, R.; Kao, C.W.; Sun, T.T.; Kao, W.W. Cornea-specific expression of K12 keratin during mouse development. Curr. Eye Res. 1993, 12, 963–974. [Google Scholar] [CrossRef] [PubMed]
- Norman, B.; Davis, J.; Piatigorsky, J. Postnatal gene expression in the normal mouse cornea by SAGE. Investig. Ophthalmol. Vis. Sci. 2004, 45, 429–440. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ramirez-Miranda, A.; Nakatsu, M.N.; Zarei-Ghanavati, S.; Nguyen, C.V.; Deng, S.X. Keratin 13 is a more specific marker of conjunctival epithelium than keratin 19. Mol. Vis. 2011, 17, 1652–1661. [Google Scholar]
- Kivela, T.; Uusitalo, M. Structure, development and function of cytoskeletal elements in non-neuronal cells of the human eye. Prog. Retin. Eye Res. 1998, 17, 385–428. [Google Scholar] [CrossRef]
- Zhu, Y.; Wang, T.; Gu, J.; Huang, K.; Zhang, T.; Zhang, Z.; Liu, H.; Tang, J.; Mai, Y.; Zhang, Y.; et al. Characterization and generation of human definitive multipotent hematopoietic stem/progenitor cells. Cell Discov. 2020, 6, 89. [Google Scholar] [CrossRef]
- Laurenti, E.; Gottgens, B. From haematopoietic stem cells to complex differentiation landscapes. Nature 2018, 553, 418–426. [Google Scholar] [CrossRef]
- Albert, R.; Veréb, Z.; Csomós, K.; Moe, M.C.; Johnsen, E.O.; Olstad, O.K.; Nicolaissen, B.; Rajnavölgyi, E.; Fésüs, L.; Berta, A.; et al. Cultivation and characterization of cornea limbal epithelial stem cells on lens capsule in animal material-free medium. PLoS ONE 2012, 7, e47187. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dolphin, C.T.; Beckett, D.J.; Janmohamed, A.; Cullingford, T.E.; Smith, R.L.; Shephard, E.A.; Phillips, I.R. The flavin-containing monooxygenase 2 gene (FMO2) of humans, but not of other primates, encodes a truncated, nonfunctional protein. J. Biol. Chem. 1998, 273, 30599–30607. [Google Scholar] [CrossRef] [Green Version]
- Whetstine, J.R.; Yueh, M.F.; McCarver, D.G.; Williams, D.E.; Park, C.S.; Kang, J.H.; Cha, Y.N.; Dolphin, C.T.; Shephard, E.A.; Phillips, I.R.; et al. Ethnic differences in human flavin-containing monooxygenase 2 (FMO2) polymorphisms: Detection of expressed protein in African-Americans. Toxicol. Appl. Pharmacol. 2000, 168, 216–224. [Google Scholar] [CrossRef] [PubMed]
- Cacioppo, J.A.; Koo, Y.; Lin, P.C.; Gal, A.; Ko, C. Generation and characterization of an endothelin-2 iCre mouse. Genesis 2015, 53, 245–256. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lobo, E.P.; Delic, N.C.; Richardson, A.; Raviraj, V.; Halliday, G.M.; Di, G.N.; Myerscough, M.R.; Lyons, J.G. Self-organized centripetal movement of corneal epithelium in the absence of external cues. Nat. Commun. 2016, 7, 12388. [Google Scholar] [CrossRef]
- Szymanska, M.; Shrestha, K.; Girsh, E.; Harlev, A.; Eisenberg, I.; Imbar, T.; Meidan, R. Reduced Endothelin-2 and Hypoxic Signaling Pathways in Granulosa-Lutein Cells of PCOS Women. Int. J. Mol. Sci. 2021, 22, 8216. [Google Scholar] [CrossRef] [PubMed]
- Rattner, A.; Yu, H.; Williams, J.; Smallwood, P.M.; Nathans, J. Endothelin-2 signaling in the neural retina promotes the endothelial tip cell state and inhibits angiogenesis. Proc. Natl. Acad. Sci. USA 2013, 110, E3830–E3839. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Patel, C.; Narayanan, S.P.; Zhang, W.; Xu, Z.; Sukumari-Ramesh, S.; Dhandapani, K.M.; Caldwell, R.W.; Caldwell, R.B. Activation of the endothelin system mediates pathological angiogenesis during ischemic retinopathy. Am. J. Pathol. 2014, 184, 3040–3051. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alrashdi, S.F.; Deliyanti, D.; Talia, D.M.; Wilkinson-Berka, J.L. Endothelin-2 Injures the Blood-Retinal Barrier and Macroglial Müller Cells: Interactions with Angiotensin II, Aldosterone, and NADPH Oxidase. Am. J. Pathol. 2018, 188, 805–817. [Google Scholar] [CrossRef] [Green Version]
- Klipper, E.; Levit, A.; Mastich, Y.; Berisha, B.; Schams, D.; Meidan, R. Induction of endothelin-2 expression by luteinizing hormone and hypoxia: Possible role in bovine corpus luteum formation. Endocrinology 2010, 151, 1914–1922. [Google Scholar] [CrossRef]
- Kis, B.; Deli, M.A.; Kobayashi, H.; Abrahám, C.S.; Yanagita, T.; Kaiya, H.; Isse, T.; Nishi, R.; Gotoh, S.; Kangawa, K.; et al. Adrenomedullin regulates blood-brain barrier functions in vitro. Neuroreport 2001, 12, 4139–4142. [Google Scholar] [CrossRef]
- Fritz-Six, K.L.; Dunworth, W.P.; Li, M.; Caron, K.M. Adrenomedullin signaling is necessary for murine lymphatic vascular development. J. Clin. Investig. 2008, 118, 40–50. [Google Scholar] [CrossRef] [Green Version]
- Dunworth, W.P.; Fritz-Six, K.L.; Caron, K.M. Adrenomedullin stabilizes the lymphatic endothelial barrier in vitro and in vivo. Peptides 2008, 29, 2243–2249. [Google Scholar] [CrossRef] [Green Version]
- Yi, Z.; Fan, H.; Liu, X.; Tang, Q.; Zuo, D.; Yang, J. Adrenomedullin improves intestinal epithelial barrier function by downregulating myosin light chain phosphorylation in ulcerative colitis rats. Mol. Med. Rep. 2015, 12, 3615–3620. [Google Scholar] [CrossRef] [Green Version]
- Klein, K.R.; Caron, K.M. Adrenomedullin in lymphangiogenesis: From development to disease. Cell. Mol. Life Sci. 2015, 72, 3115–3126. [Google Scholar] [CrossRef]
- Hoopes, S.L.; Willcockson, H.H.; Caron, K.M. Characteristics of multi-organ lymphangiectasia resulting from temporal deletion of calcitonin receptor-like receptor in adult mice. PLoS ONE 2012, 7, e45261. [Google Scholar] [CrossRef]
- Li, L.; Clevers, H. Coexistence of quiescent and active adult stem cells in mammals. Science 2010, 327, 542–545. [Google Scholar] [CrossRef] [Green Version]
- Ishikawa, Y.; Sakurai, H. Heat-induced expression of the immediate-early gene IER5 and its involvement in the proliferation of heat-shocked cells. FEBS J. 2015, 282, 332–340. [Google Scholar] [CrossRef]
- Ishikawa, Y.; Kawabata, S.; Sakurai, H. HSF1 transcriptional activity is modulated by IER5 and PP2A/B55. FEBS Lett. 2015, 589, 1150–1155. [Google Scholar] [CrossRef] [Green Version]
- Nakamura, S.; Nagata, Y.; Tan, L.; Takemura, T.; Shibata, K.; Fujie, M.; Fujisawa, S.; Tanaka, Y.; Toda, M.; Makita, R.; et al. Transcriptional repression of Cdc25B by IER5 inhibits the proliferation of leukemic progenitor cells through NF-YB and p300 in acute myeloid leukemia. PLoS ONE 2011, 6, e28011. [Google Scholar] [CrossRef] [PubMed]
- Ding, K.K.; Shang, Z.F.; Hao, C.; Xu, Q.Z.; Shen, J.J.; Yang, C.J.; Xie, Y.H.; Qiao, C.; Wang, Y.; Xu, L.L.; et al. Induced expression of the IER5 gene by gamma-ray irradiation and its involvement in cell cycle checkpoint control and survival. Radiat. Environ. Biophys. 2009, 48, 205–213. [Google Scholar] [CrossRef] [PubMed]
- Sandell, L.L.; Sanderson, B.W.; Moiseyev, G.; Johnson, T.; Mushegian, A.; Young, K.; Rey, J.P.; Ma, J.X.; Staehling-Hampton, K. Trainor PA. RDH10 is essential for synthesis of embryonic retinoic acid and is required for limb, craniofacial, and organ development. Genes Dev. 2007, 21, 1113–1124. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kays, T.W.; Piatigorsky, J. Aldehyde dehydrogenase class 3 expression: Identification of a cornea-preferred gene promoter in transgenic mice. Proc. Natl. Acad. Sci. USA 1997, 94, 13594–13599. [Google Scholar] [CrossRef] [Green Version]
- Sax, C.M.; Salamon, C.; Kays, W.T.; Guo, J.; Yu, F.X.; Cuthbertson, R.A.; Piatigorsky, J. Transketolase is a major protein in the mouse cornea. J. Biol. Chem. 1996, 271, 33568–33574. [Google Scholar] [CrossRef] [Green Version]
Gene | Primers |
---|---|
MGARP-F | CCCAGTGCTACAGTTGTGGT |
MGARP-R | CCTCTGGGGTTGTTTCAGGG |
ALDH3-F | TGATCCAGGAGCAGGAGCAG |
ALDH3-R | GGACGTACACCACCTCCTCA |
SLURP1-F | GTACCCCTTCAACCAGAGCC |
SLURP1-R | GTCTCGGAAGCAGCAGAAGA |
TKT-F | ACTTCGACAAGGCCAGCTAC |
TKT-R | GCCCAGGCGATTGATGTCTA |
LYPD2-F | CCGGGAGATAGTGTACCCT |
LYPD2-R | AGTATTGCAGCAGGACACGG |
AQP5-F | CCTGGCTGCCATCCTTTACTT |
AQP5-R | AGGCTCATACGTGCCTTTGAT |
DBX2-F | GTACTGGGACGTTGTGGCTT |
DBX2-R | ACCCGCAGCAAATTCTCGAT |
SPINK7-F | ATCCCCTGCCCCATCACATA |
SPINK7-R | GCTCTCGGTACACAAGTGACA |
PIEZO2-F | ACTTCCATGACCGGTTCCTT |
PIEZO2-R | GGGTGGGCCAGTCTGTAG |
KRT12-F | CCAGGTGAGGTCAGCGTAGAA |
KRT12-R | CCTCCAGGTTGCTGCTGATGAGC |
GAPDH-F | ACCCAGAAGACTGTGGATGG |
GAPDH-R | CAGTGAGCTTCCCGTTCAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Song, Z.; Chen, B.; Tsai, C.-H.; Wu, D.; Liu, E.; Hawkins, I.S.; Phan, A.; Auman, J.T.; Tao, Y.; Mei, H. Differentiation Trajectory of Limbal Stem and Progenitor Cells under Normal Homeostasis and upon Corneal Wounding. Cells 2022, 11, 1983. https://doi.org/10.3390/cells11131983
Song Z, Chen B, Tsai C-H, Wu D, Liu E, Hawkins IS, Phan A, Auman JT, Tao Y, Mei H. Differentiation Trajectory of Limbal Stem and Progenitor Cells under Normal Homeostasis and upon Corneal Wounding. Cells. 2022; 11(13):1983. https://doi.org/10.3390/cells11131983
Chicago/Turabian StyleSong, Zhenwei, Brian Chen, Chi-Hao Tsai, Di Wu, Emily Liu, Isha Sharday Hawkins, Andrew Phan, James Todd Auman, Yazhong Tao, and Hua Mei. 2022. "Differentiation Trajectory of Limbal Stem and Progenitor Cells under Normal Homeostasis and upon Corneal Wounding" Cells 11, no. 13: 1983. https://doi.org/10.3390/cells11131983
APA StyleSong, Z., Chen, B., Tsai, C.-H., Wu, D., Liu, E., Hawkins, I. S., Phan, A., Auman, J. T., Tao, Y., & Mei, H. (2022). Differentiation Trajectory of Limbal Stem and Progenitor Cells under Normal Homeostasis and upon Corneal Wounding. Cells, 11(13), 1983. https://doi.org/10.3390/cells11131983