Knockout of the KH-Type Splicing Regulatory Protein Drives Glomerulonephritis in MRL-Faslpr Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Animal Experiments
2.3. Western Blot Experiments
2.4. Examination of Lymphadenopathy
2.5. Renal Histopathology
2.6. Immunostaining
2.7. Analysis of Mrna Expression in Cells or Tissues of MRL-Faslpr/KSRP−/− or MRL-Faslpr/KSRP+/+ Animals
2.8. FACS
2.9. Proteome ProfilerTM (R&D Systems)
2.10. Statistics
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Iwata, Y.; Furuichi, K.; Kaneko, S.; Wada, T. The role of cytokine in the lupus nephritis. J. Biomed. Biotechnol. 2011, 2011, 594809. [Google Scholar] [CrossRef] [Green Version]
- Parikh, S.V.; Almaani, S.; Brodsky, S.; Rovin, B.H. Update on lupus nephritis: Core curriculum 2020. Am. J. Kidney Dis. 2020. [Google Scholar] [CrossRef]
- Tsokos, G.C.; Lo, M.S.; Costa Reis, P.; Sullivan, K.E. New insights into the immunopathogenesis of systemic lupus erythematosus. Nat. Rev. Rheumatol. 2016, 12, 716–730. [Google Scholar] [CrossRef] [PubMed]
- Bomback, A.S.; Appel, G.B. Updates on the treatment of lupus nephritis. J. Am. Soc. Nephrol. 2010, 21, 2028–2035. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, Y. State-of-the-art treatment of systemic lupus erythematosus. Int. J. Rheum. Dis. 2020. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maria, N.I.; Davidson, A. Protecting the kidney in systemic lupus erythematosus: From diagnosis to therapy. Nat. Rev. Rheumatol. 2020. [Google Scholar] [CrossRef]
- Frangou, E.; Georgakis, S.; Bertsias, G. Update on the cellular and molecular aspects of lupus nephritis. Clin. Immunol. 2020, 216, 108445. [Google Scholar] [CrossRef]
- Andrews, B.S.; Eisenberg, R.A.; Theofilopoulos, A.N.; Izui, S.; Wilson, C.B.; McConahey, P.J.; Murphy, E.D.; Roths, J.B.; Dixon, F.J. Spontaneous murine lupus-like syndromes. Clinical and immunopathological manifestations in several strains. J. Exp. Med. 1978, 148, 1198–1215. [Google Scholar] [CrossRef]
- Kelley, V.E.; Roths, J.B. Interaction of mutant lpr gene with background strain influences renal disease. Clin. Immunol. Immunopathol. 1985, 37, 220–229. [Google Scholar] [CrossRef]
- Kelley, V.R.; Wuthrich, R.P. Cytokines in the pathogenesis of systemic lupus erythematosus. Semin. Nephrol. 1999, 19, 57–66. [Google Scholar] [PubMed]
- Adamichou, C.; Georgakis, S.; Bertsias, G. Cytokine targets in lupus nephritis: Current and future prospects. Clin. Immunol. 2019, 206, 42–52. [Google Scholar] [CrossRef] [PubMed]
- Nozaki, Y. The network of inflammatory mechanisms in lupus nephritis. Front. Med. 2020, 7, 591724. [Google Scholar] [CrossRef] [PubMed]
- Newman, R.; McHugh, J.; Turner, M. Rna binding proteins as regulators of immune cell biology. Clin. Exp. Immunol. 2016, 183, 37–49. [Google Scholar] [CrossRef] [Green Version]
- Gherzi, R.; Lee, K.Y.; Briata, P.; Wegmuller, D.; Moroni, C.; Karin, M.; Chen, C.Y. A kh domain rna binding protein, ksrp, promotes are-directed mrna turnover by recruiting the degradation machinery. Mol. Cell 2004, 14, 571–583. [Google Scholar] [CrossRef] [PubMed]
- Lin, W.J.; Zheng, X.; Lin, C.C.; Tsao, J.; Zhu, X.; Cody, J.J.; Coleman, J.M.; Gherzi, R.; Luo, M.; Townes, T.M.; et al. Posttranscriptional control of type i interferon genes by ksrp in the innate immune response against viral infection. Mol. Cell Biol. 2011, 31, 3196–3207. [Google Scholar] [CrossRef] [Green Version]
- Kafer, R.; Schrick, K.; Schmidtke, L.; Montermann, E.; Hobernik, D.; Bros, M.; Chen, C.Y.; Kleinert, H.; Pautz, A. Inactivation of the ksrp gene modifies collagen antibody induced arthritis. Mol. Immunol. 2017, 87, 207–216. [Google Scholar] [CrossRef] [PubMed]
- Kafer, R.; Schmidtke, L.; Schrick, K.; Montermann, E.; Bros, M.; Kleinert, H.; Pautz, A. The rna-binding protein ksrp modulates cytokine expression of cd4(+) t cells. J. Immunol. Res. 2019, 2019, 4726532. [Google Scholar] [CrossRef] [Green Version]
- Schmidt, N.; Art, J.; Forsch, I.; Werner, A.; Erkel, G.; Jung, M.; Horke, S.; Kleinert, H.; Pautz, A. The anti-inflammatory fungal compound (s)-curvularin reduces proinflammatory gene expression in an in vivo model of rheumatoid arthritis. J. Pharmacol. Exp. Ther. 2012, 343, 106–114. [Google Scholar] [CrossRef]
- Henke, J.; Erkel, G.; Brochhausen, C.; Kleinert, H.; Schwarting, A.; Menke, J.; Pautz, A. The fungal lactone oxacyclododecindione is a potential new therapeutic substance in the treatment of lupus-associated kidney disease. Kidney Int. 2014. [Google Scholar] [CrossRef] [Green Version]
- Menke, J.; Lucas, J.A.; Zeller, G.C.; Keir, M.E.; Huang, X.R.; Tsuboi, N.; Mayadas, T.N.; Lan, H.Y.; Sharpe, A.H.; Kelley, V.R. Programmed death 1 ligand (pd-l) 1 and pd-l2 limit autoimmune kidney disease: Distinct roles. J. Immunol. 2007, 179, 7466–7477. [Google Scholar] [CrossRef] [Green Version]
- Chomczynski, P.; Sacchi, N. Single-step method of rna isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 1987, 162, 156–159. [Google Scholar] [CrossRef]
- Rodriguez-Pascual, F.; Hausding, M.; Ihrig-Biedert, I.; Furneaux, H.; Levy, A.P.; Forstermann, U.; Kleinert, H. Complex contribution of the 3′-untranslated region to the expressional regulation of the human inducible nitric-oxide synthase gene. Involvement of the rna-binding protein hur. J. Biol. Chem. 2000, 275, 26040–26049. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bollmann, F.; Art, J.; Henke, J.; Schrick, K.; Besche, V.; Bros, M.; Li, H.; Siuda, D.; Handler, N.; Bauer, F.; et al. Resveratrol post-transcriptionally regulates pro-inflammatory gene expression via regulation of ksrp rna binding activity. Nucleic Acids Res. 2014, 42, 12555–12569. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative pcr and the 2(-delta delta c(t)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Wada, Y.; Gonzalez-Sanchez, H.M.; Weinmann-Menke, J.; Iwata, Y.; Ajay, A.K.; Meineck, M.; Kelley, V.R. Il-34-dependent intrarenal and systemic mechanisms promote lupus nephritis in mrl-fas(lpr) mice. J. Am. Soc. Nephrol. 2019, 30, 244–259. [Google Scholar] [CrossRef] [Green Version]
- Zhu, J.; Yamane, H.; Paul, W.E. Differentiation of effector cd4 t cell populations (*). Annu. Rev. Immunol. 2010, 28, 445–489. [Google Scholar] [CrossRef] [Green Version]
- Walling, B.L.; Kim, M. Lfa-1 in t cell migration and differentiation. Front. Immunol. 2018, 9, 952. [Google Scholar] [CrossRef] [Green Version]
- Akira, S.; Maeda, K. Control of rna stability in immunity. Annu. Rev. Immunol. 2021. [Google Scholar] [CrossRef]
- Briata, P.; Bordo, D.; Puppo, M.; Gorlero, F.; Rossi, M.; Perrone-Bizzozero, N.; Gherzi, R. Diverse roles of the nucleic acid-binding protein khsrp in cell differentiation and disease. Wiley Interdiscip. Rev. RNA 2016, 7, 227–240. [Google Scholar] [CrossRef] [Green Version]
- Schwarting, A.; Wada, T.; Kinoshita, K.; Tesch, G.; Kelley, V.R. Ifn-gamma receptor signaling is essential for the initiation, acceleration, and destruction of autoimmune kidney disease in mrl-fas(lpr) mice. J. Immunol. 1998, 161, 494–503. [Google Scholar]
- Duster, M.; Becker, M.; Gnirck, A.C.; Wunderlich, M.; Panzer, U.; Turner, J.E. T cell-derived ifn-gamma downregulates protective group 2 innate lymphoid cells in murine lupus erythematosus. Eur. J. Immunol. 2018, 48, 1364–1375. [Google Scholar] [CrossRef] [Green Version]
- Schmidt, T.; Paust, H.J.; Krebs, C.F.; Turner, J.E.; Kaffke, A.; Bennstein, S.B.; Koyro, T.; Peters, A.; Velden, J.; Hunemorder, S.; et al. Function of the th17/interleukin-17a immune response in murine lupus nephritis. Arthritis Rheumatol. 2015, 67, 475–487. [Google Scholar] [CrossRef] [PubMed]
- Oke, V.; Gunnarsson, I.; Dorschner, J.; Eketjall, S.; Zickert, A.; Niewold, T.B.; Svenungsson, E. High levels of circulating interferons type i, type ii and type iii associate with distinct clinical features of active systemic lupus erythematosus. Arthritis Res. 2019, 21, 107. [Google Scholar] [CrossRef] [Green Version]
- Abdirama, D.; Tesch, S.; Griessbach, A.S.; von Spee-Mayer, C.; Humrich, J.Y.; Stervbo, U.; Babel, N.; Meisel, C.; Alexander, T.; Biesen, R.; et al. Nuclear antigen-reactive cd4(+) t cells expand in active systemic lupus erythematosus, produce effector cytokines, and invade the kidneys. Kidney Int. 2021, 99, 238–246. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Ma, T.; Han, J.; Zhou, J.; Wang, J.; Zhang, J.; Zheng, S. Increased apoptosis induction in cd4+ cd25+ foxp3+ t cells contributes to enhanced disease activity in patients with rheumatoid arthritis through il-10 regulation. Eur. Rev. Med. Pharm. Sci. 2014, 18, 78–85. [Google Scholar]
- Tao, J.H.; Cheng, M.; Tang, J.P.; Liu, Q.; Pan, F.; Li, X.P. Foxp3, regulatory t cell, and autoimmune diseases. Inflammation 2017, 40, 328–339. [Google Scholar] [CrossRef] [PubMed]
- Tyden, H.; Lood, C.; Gullstrand, B.; Jonsen, A.; Ivars, F.; Leanderson, T.; Bengtsson, A.A. Pro-inflammatory s100 proteins are associated with glomerulonephritis and anti-dsdna antibodies in systemic lupus erythematosus. Lupus 2017, 26, 139–149. [Google Scholar] [CrossRef]
- Rordorf, C.; Schnebli, H.P.; Baltz, M.L.; Tennent, G.A.; Pepys, M.B. The acute-phase response in (nzb x nzw)f1 and mrl/l mice. J. Exp. Med. 1982, 156, 1268–1273. [Google Scholar] [CrossRef] [Green Version]
- Wang, C.M.; Deng, J.H.; Mao, G.F.; He, Y.L.; Shi, X. Serum amyloid a: A potential biomarker assessing disease activity in systemic lupus erythematosus. Med. Sci. Monit. 2020, 26, e923290. [Google Scholar] [CrossRef]
- Chait, A.; den Hartigh, L.J.; Wang, S.; Goodspeed, L.; Babenko, I.; Altemeier, W.A.; Vaisar, T. Presence of serum amyloid a3 in mouse plasma is dependent on the nature and extent of the inflammatory stimulus. Sci. Rep. 2020, 10, 10397. [Google Scholar] [CrossRef]
- Zhang, N.; Ahsan, M.H.; Purchio, A.F.; West, D.B. Serum amyloid a-luciferase transgenic mice: Response to sepsis, acute arthritis, and contact hypersensitivity and the effects of proteasome inhibition. J. Immunol. 2005, 174, 8125–8134. [Google Scholar] [CrossRef] [Green Version]
- Italiani, P.; Manca, M.L.; Angelotti, F.; Melillo, D.; Pratesi, F.; Puxeddu, I.; Boraschi, D.; Migliorini, P. Il-1 family cytokines and soluble receptors in systemic lupus erythematosus. Arthritis Res. 2018, 20, 27. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kiberd, B.A.; Stadnyk, A.W. Established murine lupus nephritis does not respond to exogenous interleukin-1 receptor antagonist; a role for the endogenous molecule? Immunopharmacology 1995, 30, 131–137. [Google Scholar] [CrossRef]
- Zijtregtop, E.A.M.; van der Strate, I.; Beishuizen, A.; Zwaan, C.M.; Scheijde-Vermeulen, M.A.; Brandsma, A.M.; Meyer-Wentrup, F. Biology and clinical applicability of plasma thymus and activation-regulated chemokine (tarc) in classical hodgkin lymphoma. Cancers 2021, 13, 884. [Google Scholar] [CrossRef] [PubMed]
- Yoshie, O.; Matsushima, K. Ccr4 and its ligands: From bench to bedside. Int. Immunol. 2015, 27, 11–20. [Google Scholar] [CrossRef] [Green Version]
- Stanley, S.; Mok, C.C.; Vanarsa, K.; Habazi, D.; Li, J.; Pedroza, C.; Saxena, R.; Mohan, C. Identification of low-abundance urinary biomarkers in lupus nephritis using electrochemiluminescence immunoassays. Arthritis Rheumatol. 2019, 71, 744–755. [Google Scholar] [CrossRef]
- Okamoto, H.; Nishimura, H.; Kamatani, N. A role for tarc/ccl17, a cc chemokine, in new zealand mice. Rheumatology 2005, 44, 819–820. [Google Scholar] [CrossRef] [Green Version]
- Kevil, C.G.; Hicks, M.J.; He, X.; Zhang, J.; Ballantyne, C.M.; Raman, C.; Schoeb, T.R.; Bullard, D.C. Loss of lfa-1, but not mac-1, protects mrl/mpj-fas(lpr) mice from autoimmune disease. Am. J. Pathol. 2004, 165, 609–616. [Google Scholar] [CrossRef] [Green Version]
- Wacholtz, M.C.; Patel, S.S.; Lipsky, P.E. Leukocyte function-associated antigen 1 is an activation molecule for human t cells. J. Exp. Med. 1989, 170, 431–448. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Trabucchi, M.; Briata, P.; Garcia-Mayoral, M.; Haase, A.D.; Filipowicz, W.; Ramos, A.; Gherzi, R.; Rosenfeld, M.G. The rna-binding protein ksrp promotes the biogenesis of a subset of micrornas. Nature 2009, 459, 1010–1014. [Google Scholar] [CrossRef] [Green Version]
- So, B.Y.F.; Yap, D.Y.H.; Chan, T.M. Micrornas in lupus nephritis-role in disease pathogenesis and clinical applications. Int. J. Mol. Sci. 2021, 22, 10737. [Google Scholar] [CrossRef] [PubMed]
Oligo | 5′-primer | 3′primer | Probe |
---|---|---|---|
muCD11a | CCCTCCTAAGCGCAGATGAG | TGATCGCATGTCCGAGACAG | NA |
muCD68 | GGCAGCACAGTGGACATTC | CAATGATGAGAGGCAGCAAG | TCAGCTGCCTGACAAGGGACACTTG |
muFOXP3 | AGAAGCTGGGAGCTATGCAGG | GGGTTACGATGCAGCAAGAGC | CCTGGCTGGGAAGATGGCGCTG |
muGATA-3 | CTACCGGGTTCGGATGTAAGTC | GTTCACACACTCCCTGCCTTCT | AGGCCCAAGGCACGATCCAGC |
muIFN-γ | TCAAGTGGCATAGATGTGGAAGAA | TGGCTCTGCAGGATTTTCATG | TCACCATCCTTTTGCCAGTTCCTCCAG |
muIL-10 | TGAAAATAAGAGCAAGGCAGTG | TCATTCATGGCCTTGTAGACAC | TGAGGCGCTGTCATCGATTTCTCCC |
muIL-6 | GAGGATACCACTCCCAACAGACC | AAGTGCATCATCGTTGTTCATACA | CAGAATTGCCATTGCACAACTCTTTTCTCA |
mu-IL1Ra | GGAAAAGACCCTGCAAGATGC | TGGTCCTTGTAAGTACCCAGC | NA |
muPol2a | ACCACGTCCAATGATATTGTGGAG | ATGTCATAGTGTCACACAGGAGCG | CTGGGCATTGAGGCTGTGCGGAA |
muROR-γT | CACGGCCCTGGTTCTCAT | CAGATGTTCCACTCTCCTCTTCTCT | ATGCCAACCGTCCTGGGCTCC |
muS100A8 | CTCCGTCTTCAAGACATCGTTTG | TCATTCTTGTAGAGGGCATGGTG | CAATGCCGTCTGAACTGGAGAAGGCC |
muSAA3 | CCTGGGAGTTGACAGCCAAA | TCCGGGCAGCATCATAGTTC | NA |
muT-bet | ACCAGAACGCAGAGATCACTCA | CAAAGTTCTCCCGGAATCCTT | CTGAAAATCGACAACAACCCCTTTGCC |
muTBP | CTACCGTGAATCTTGGCTGT | CTCTTGGCTCCTGTGCACA | NA |
muTNF-α | CATCCTTCTCAAAATTCGAGTGACAA | TGGGAGTAGACAAGGTACAACCC | CACGTCGTAGCAAACCACCAAGTGGA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Schmidtke, L.; Meineck, M.; Saurin, S.; Otten, S.; Gather, F.; Schrick, K.; Käfer, R.; Roth, W.; Kleinert, H.; Weinmann-Menke, J.; et al. Knockout of the KH-Type Splicing Regulatory Protein Drives Glomerulonephritis in MRL-Faslpr Mice. Cells 2021, 10, 3167. https://doi.org/10.3390/cells10113167
Schmidtke L, Meineck M, Saurin S, Otten S, Gather F, Schrick K, Käfer R, Roth W, Kleinert H, Weinmann-Menke J, et al. Knockout of the KH-Type Splicing Regulatory Protein Drives Glomerulonephritis in MRL-Faslpr Mice. Cells. 2021; 10(11):3167. https://doi.org/10.3390/cells10113167
Chicago/Turabian StyleSchmidtke, Lisa, Myriam Meineck, Sabrina Saurin, Svenja Otten, Fabian Gather, Katharina Schrick, Rudolf Käfer, Wilfried Roth, Hartmut Kleinert, Julia Weinmann-Menke, and et al. 2021. "Knockout of the KH-Type Splicing Regulatory Protein Drives Glomerulonephritis in MRL-Faslpr Mice" Cells 10, no. 11: 3167. https://doi.org/10.3390/cells10113167
APA StyleSchmidtke, L., Meineck, M., Saurin, S., Otten, S., Gather, F., Schrick, K., Käfer, R., Roth, W., Kleinert, H., Weinmann-Menke, J., & Pautz, A. (2021). Knockout of the KH-Type Splicing Regulatory Protein Drives Glomerulonephritis in MRL-Faslpr Mice. Cells, 10(11), 3167. https://doi.org/10.3390/cells10113167