Abstract
Rapeseed (Brassica napus L.) with substantial lipid and oleic acid content is of great interest to rapeseed breeders. Overexpression of Glycine max transcription factors Dof4 and Dof11 increased lipid accumulation in Arabidopsis and microalgae, in addition to modifying the quantity of certain fatty acid components. Here, we report the involvement of GmDof4 and GmDof11 in regulating fatty acid composition in rapeseeds. Overexpression of GmDof4 and GmDof11 in rapeseed increased oleic acid content and reduced linoleic acid and linolenic acid. Both qPCR and the yeast one-hybrid assay indicated that GmDof4 activated the expression of FAB2 by directly binding to the cis-DNA element on its promoters, while GmDof11 directly inhibited the expression of FAD2. Thus, GmDof4 and GmDof11 might modify the oleic acid content in rapeseed by directly regulating the genes that are associated with fatty acid biosynthesis.
1. Introduction
Rapeseed (Brassica napus L.) is among the most important oil crops worldwide, providing high-quality edible oils and industrial raw materials [1,2,3]. The production and yield of rapeseed has rapidly increased in China in recent years [4]. Rapeseed oil is principally a mixture of seven main fatty acids [5], namely palmitic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3), eicosenoic acid (C20:1), and erucic acid (C22:1), of which oleic acid is the most abundant and has the highest nutritional value [6]. Therefore, creating new rapeseed varieties with a high seed oil content that is rich in oleic acid content is a primary goal for rapeseed breeders [7]. Remarkable progress in increasing the content of seed oil and proportion of oleic acid has been reported by traditional breeding and putative candidate genes have been dissected using quantitative trait loci mapping and molecular markers [8,9,10,11].
Genetic engineering is a potentially efficient method of modifying the expression of single or multiple genes that are involved in lipid metabolism [7,12]. In B. napus, the overexpression of genes encoding glycerol-3-phosphate dehydrogenase [13], acyl-CoA: lysophosphatidic acid acyltransferase [14], mitochondrial pyruvate dehydrogenase kinase [15], and diacylglycerol acyltransferases [16,17,18,19] significantly increased seed oil content. Liu et al. [20] overexpressed triacylglyceride (TAG) synthesis pathway genes in B. napus, including BnGPDH, BnGPAT, BnDGAT, and ScLPAAT, and found that the overexpression of a single gene could increase the content of seed oil, but the simultaneous overexpression of multiple genes may result in more substantial changes in oil composition.
Besides lipid synthase, a number of genes encoding seed-specific transcription factors (TFs) have been shown to play important roles in the regulation of lipid biosynthesis [7,21]. Previous reports have suggested that altering the expression levels of the plant-specific B3 domain family members LEAFY COTYLEDON 2, FUSCA3 and ABSCISIC ACID INSENSITIVE 3 [22,23,24]; NF-YB type TF LEAFY COTYLEDON 1 [7,25]; AP2/EREB domain TF WRI1 [26,27], Arabidopsis 6b-interacting protein 1-like 1 [28]; BnGRF2 (GRF2-like gene from B. napus) [21]; and, SHOOTMERISTEMLESS [29] resulted in a change in the proportions of seed storage materials. These genes could be used to genetically improve the oil content and composition of rapeseed.
Fatty acid dehydrogenase (FAD) and fatty acid elongase (FAE) are the key enzymes that determine fatty acid composition in seed oil. FAD catalyzes the biosynthesis of polyunsaturated fatty acids, such as linoleic and linolenic acid [30,31], while FAE catalyzes the chain elongation reaction, resulting in the formation of long-chain fatty acids, including eicosenoic and erucic acid [30,32]. Previous studies have suggested that inhibition of FAE1 expression increases oleic acid and reduces erucic acid content in rapeseed seed oil [33,34], as did inhibition the expression of the BnFAD2 gene in transgenic seeds [34]. Jung et al. [35] found that expression of the B. rapa BrFAD2 gene in an antisense orientation increased the synthesis of oleic acid in B. napus. FAD3 desaturase is responsible for the synthesis of linolenic acid [36], in BnFAD3 mutants of B. napus, the concentration of linolenic acid was significantly reduced [37].
Dof (DNA binding with one finger) is an important family of TFs in plants, with its members being widely involved in seed development, plant growth, morphogenesis, nutrient metabolism, and other processes [36,38,39,40]. As far as we know, comprehensive analysis of Dof family factors in B. napus has not been previously performed, with few reports of the function of Dof genes in B. napus [41], even though genome-wide analysis has been performed in other Brassica plants [42]. In soybean, 28 Dof members have been identified [43], and eight of them, including GmDof4 and GmDof11, are strongly expressed in the flowers and pods of soybean. Wang et al. [44] found that fatty acid and seed oil content, and seed weight were significantly increased in GmDof4 and GmDof11 overexpressing lines of A. thaliana. Further studies showed that GmDof4 and GmDof11 directly downregulated the expression of the seed storage protein gene CRA1. Moreover, GmDof4 and GmDof11 have been shown to induce the expression of the β-subunit of the ACCase encoding gene acetyl CoA carboxylase (accD) and long-chain-CoA synthetase gene 5 (LACS5), respectively [44]. These results indicate that GmDof4 and GmDof11 can simultaneously increase seed oil content by upregulating genes that are involved in fatty acid synthesis and downregulating genes associated with the accumulation of seed protein in Arabidopsis. In addition, increased lipid accumulation was demonstrated after heterologous expression of GmDof4 in Chlorella ellipsoidea [45], indicating that GmDof4 regulates seed oil content and composition both in higher and lower plants.
In the current study, using the rapeseed cultivar ‘Yangyou 6’ as receptor, we created GmDof4 and GmDof11 overexpression B. napus lines via Agrobacterium-mediated transformation. ‘Yangyou 6’ is a double low variety, which is widely planted in the Jiangsu province of China. Our results demonstrated that, when compared with non-transgenic lines, the content of oleic acid in the transgenic lines increased significantly, whereas the content of linoleic acid and linolenic acid were reduced. We found that GmDof4 and GmDof11 could activate or inhibit genes that are involved in fatty acid synthesis by directly binding to promoter regions. These findings indicate that GmDof4 and GmDof11 have the potential to improve the quality of rapeseed oil.
2. Materials and Methods
2.1. Plant Growth and Transformation
B. napus cv. ‘Yangyou 6’ plants were grown at 24 °C using a 16-h photoperiod in a growth chamber. GmDof4 (Accession No: DQ857254) and GmDof11 (Accession No: DQ857261) DNA sequences were cloned using the primer pairs: GmDof4-F: GACGCACTCACTGACATCAACACTAG, GmDof4-R: GGTGAGATAAGATTTAGAAGAGGCGTG, and GmDof11-F: GAGACTTCGCAATTTGCATGACTC, GmDof11-R: CTAGCTACTGCTAGAGTGAAGTCATTG, respectively, as designed by Wang, et al. (2007) [44]. The Soybean cultivar 8904 was used for cloning GmDof. The overexpression vectors pBIN438-GmDof4 and pBIN438-GmDof11 were kindly gifted by Professor Shouyi Chen (Institute of Genetics and Developmental Biology, Chinese Academy of Sciences). The vectors contained a neomycin phosphate transferase II (NPT II) gene as a selection marker. The GmDof4 and GmDof11 genes were driven using a CaMV 35S promoter. The vectors were introduced into the Agrobacterium tumefaciens strain GV3101 for genetic transformation into B. napus.
GmDof4 and GmDof11 overexpressing lines of B. napus were generated as described by De Block et al. [46] with some modifications. Certified, uniform, and healthy seeds were surface-sterilized with sodium hypochlorite solution and then rinsed in sterile distilled water. The seeds were germinated in the dark on 1/2 MS basal medium containing 2% (w/v) sucrose. Seven-day-old hypocotyl explants (~15 mm) were prepared and cultured on co-cultivation medium [MS medium supplemented with 2% (w/v) sucrose, 1 mg/L 2,4-D (2,4-dichlorophenoxyacetic acid), and 1 mg/L benzyladenine (BA); pH 5.8] for three days. Explants were then transferred to selection medium [MS medium supplemented with 2% (w/v) sucrose, 1 mg/L 2,4-D, 1 mg/L BA, 300 mg/L cephalosporin (Cef) and 30 mg/L G418; pH 5.8] and incubated at 25 °C. The explants with shoot initials were transferred to shoot outgrowth medium [MS medium supplemented with 2% (w/v) sucrose, 0.3 mg/L NAA, and 300 mg/L Cef; pH 5.8]. Finally, green shoots were transferred to root initiation medium [MS medium supplemented with 2% (w/v) sucrose, 0.3 mg/L NAA, and 300 mg/L Cef; pH 5.8]. All of the regenerated plantlets were transferred into pot containing nutritious soil after becoming fully developed.
2.2. PCR, Semi-Quantitative, and Quantitative Real-Time PCR Analyses
Total DNA was extracted from the young leaves of each transgenic plant using the CTAB method, as described by Porebski et al. [47]. PCR was performed to identify positive transformants using specific primers.
Total RNA was extracted from non-transgenic and GmDof-overexpression seedlings, and the young seeds of B. napus using an RNA isolator (Vazyme, Nanjing, China) in accordance with the manufacturer’s instructions. First-strand cDNA synthesis was performed using the first-strand cDNA synthesis kit HiScript Q RT SuperMix with oligo(dT)23 (50 μM) and Random hexamers (50 ng/μL) as primers for semi-quantitative PCR analysis (Vazyme, Nanjing, China). T2 generation seeds were collected at 30 days after flowering (DAF), from which 30 seeds were randomly selected and used for RNA extraction.
Semi-quantitative PCR was performed, as follows: 95 °C for 3 min then 32 cycles of 95 °C for 30 s, annealing (56 or 58 °C; detailed information shown in Supplemental Table S1) for 30 s, polymerization at 72 °C for 30 s, followed by 72 °C for 5 min. Real-time PCR was performed in an Mx3500p (Agilent, Santa Clara, CA, USA) using FastStart Universal SYBR Green Master (Rox) (Roche Applied Science, Penzberg, Germany). BnActin transcripts were used as the internal reference [18,22]. Relative gene expression was calculated using the2−ΔΔCt method. qPCR was performed with three biological replicates and three technical replicates for every sample.
To identify whether the expression of genes related to fatty acid metabolism in transgenic seeds, namely, FAB2 (Fatty acid biosynthesis 2), FAD2, FAD3, FAD6, FAD7, FAD8, FAE1, and FAE7, were regulated, the expression pattern of genes involved in lipid and fatty acid synthesis were analyzed in seeds at 30 DAF. Amplification primers of these genes were designed to amplify all homologous of specific gene. The primers used for qPCR and the gene ID are listed in Supplementary Table S1.
2.3. Determination of Seed Oil and Fatty Acid Composition
Total seed oil content of the transgenic and non-transgenic plants was determined using near-infrared reflectance (NIR) spectroscopy [48]. Fatty acid concentration was measured using the method that was described by Taylor et al. [49]. The seeds of transgenic (T2 generation) and non-transgenic plants were ground to a fine powder in a mortar. Five mL of iso-propanol were mixed with 0.5 g seed powder and incubated at 100 °C for 5 min. The solution was immediately cooled on ice and 2.5 mL of dichloromethane added. The samples were shaken at 200 rpm for 30 min at room temperature after which, 4 mL of dichloromethane and 4 mL of 1 mol/L KCl in 0.2 mol/L H3PO4 were sequentially added into each tube to separate the organic and aqueous phases. The samples were vortexed and centrifuged at 2000 rpm for 20 min. The supernatant was washed twice with 4 mL of dichloromethane, and the original organic phase combined with the washes and dried under nitrogen to yield triacylglycerol. The triacylglycerol was hydrolyzed and the fatty acid esterified, as described by Fatima et al. [50].
Fatty acid composition was analyzed using a gas chromatography-mass spectrometer (Trace GC DSQII, Thermo, Waltham, MA, USA) with a DB-WAX capillary column (30 m × 0.25 mm ID × 0.25 μm df) [49]. The peaks were identified by reference to the identified retention times of internal standard FAMEs (Sigma, Lot No.: 18919-1AMP, St. Louis, MO, USA). GC was performed using a gas carrier (helium) flow rate of 30 mL·min−1 and a column and injector temperature of 250 °C. Running temperatures were as follows: 50 °C for 2 min, increasing to 220 °C at a rate of 4 °C/min, and held at 220 °C for 7 min. Each experimental material was biologically replicated three times.
2.4. Detection of DNA Binding Specificity of GmDof4 and GmDof11 by Yeast One-Hybrid Assay
The yeast strain, Y1HGold (MATα, ura3-52, his3-200, ade2-101, trp1-901, leu2-3, 112, gal4Δ, gal80Δ, met-, and MEL1) containing the AbAr reporter gene was used as the assay system. GmDof4 and GmDof11 were amplified and fused to the GAL4 DNA binding domain on the pGADT7 plasmid. Two or three copies of the cis-DNA elements of interest at the promoter of potential targeted genes were synthesized, annealed, and cloned into the “prey” plasmid pAbAi. Then, the recombinant “prey” plasmid was then digested using BstBI for 1 h and transfected into yeast Y1HGold cells according to the manufacturer’s protocol (Clontech, Mountain View, CA, USA). The PCR-identified recombinant Y1HGold strains were then used to introduce pGADT7-GmDof4 or pGADT7-GmDof11 plasmids. The transfected yeast cells were then cultured in SD/-Leu/-Ura plates. Finally, cultures were placed on SD/-Leu/-Ura + AbA (0.2 mg/L) plates. Strains growing in colonies indicated positive GmDof binding on the corresponding cis-DNA element.
2.5. Statistical Analysis
All experimental data, including seed oil and fatty acid content analysis, were compared statistically using one-way analysis of variance (ANOVA) followed by Student’s t test to determine significant differences among the means of different groups using Statistical Product and Service Solutions (SPSS) v16.0 software.
3. Results
3.1. Dof Family Numbers in B. napus
Based on the Arabidopsis annotated Dof genes, 134 homologous genes of AtDof were identified using BlastP (E-value ≤ 1 × 10−5, identity ≥50% and coverage ≥50%) in the B. napus reference genome of Darmor-bzh [51] (Supplementary Table S3). BlastP results showed no homology of either GmDof4 or GmDof11 in the B. napus reference genome using the DNA sequences of GmDof4 and GmDof11 as query terms (results not shown).
3.2. Generation and Identification of B. napus Transgenic Plants
To investigate whether GmDof4 and GmDof11 could regulate lipid biosynthesis in rapeseed, they were transfected into rapeseed plants, under the control of the CaMV 35S promoter, while using the Agrobacterium-mediated method. B. napus L. cultivar “Yangyou 6” was used as the receptor and hypocotyl explants were prepared from seven-day-old seedlings. Each experiment was performed using approximately 650 explants. Twenty and 12 rooted plantlets were obtained for GmDof4 and GmDof11 transformation, respectively. The existents of GmDof4 and GmDof11 in plantlets were identified using PCR (Figures S1 and S2), with the putative transformants then transferred into nutritious soil and placed in a green house. The RNA of the plantlets was extracted and first-strand cDNA synthesized, with the expression of GmDof4 and GmDof11 genes in individual transgenic plants detected by semi-quantitative PCR (Figure 1). Finally, seven and five overexpression lines of GmDof4 and GmDof11 were obtained, respectively. Two GmDof4 transformants (DOF4-2 and DOF4-20) demonstrated no GmDof4 expression, and the expression of GmDof11 in the DOF11-12 transformant was very low. Based on the expression levels of GmDof4 and GmDof11, the transgenic plants DOF4-9, DOF4-13, DOF11-1, and DOF11-6 were further analyzed. When compared with the non-transgenic plants, no significant difference was observed in their growth and development. The presence of the GmDof transgene in T1 generation transgenic plants was confirmed by PCR.
Figure 1.
Semi-quantitative RT-PCR analysis of GmDof4 and GmDof11 transgenic plants. BnActin expression is displayed as the internal control. The lengths of the amplification products of BnActin, GmDof4 and GmDof11 were 144 bp, 135 bp and 186 bp respectively.
3.3. Changes in the Fatty Acid Composition of GmDof4 and GmDof11 Overexpressing Lines of B. napus
The relative content of the principal fatty acids in the seeds of GmDof transgenic and non-transgenic lines was analyzed using gas chromatography (GC). The T1 and T2 progenies of DOF4-9, DOF4-13, DOF11-1, and DOF11-6 lines were produced by self-pollination. The seeds of homozygous T1 lines that had no gene segregation were used for the fatty acid content determination. The results showed that the quantities of major unsaturated fatty acids, such as oleic, linoleic, and linolenic acid, underwent significant alteration in four transgenic lines compared with the non-transgenic plants. However, the content of the two principal saturated fatty acids, namely, palmitic acid and stearic acid, were consistent with those of the non-transgenic lines (Figure 2, Supplementary Table S2). Among the fatty acids, the content of oleic acid in four overexpression lines was significantly increased, from 62.8% in the non-transgenic rapeseed to 67.11–71.32%. Conversely, the content of linoleic and linolenic acid in the four overexpression lines was significantly lower than in the non-transgenic lines. In addition, total lipid content was measured in the seeds of the overexpression and non-transgenic plants by NIR. Seed oil content of the GmDof4 and GmDof11 overexpression lines was ~39%, being not significantly different than the non-transgenic lines (Figure 3). These results indicate that the expression of GmDof4 and GmDof11 stimulated the accumulation of oleic acid and regulated the fatty acid composition of rapeseed, but, neither gene could increase total seed oil content.
Figure 2.
Composition of the major fatty acids in GmDof4 and GmDof11 transgenic seeds. The data represent the means ± SD of three replicate experiments and were analyzed by Student’s t-test (n = 3). * p < 0.05; ** p < 0.01.
Figure 3.
Total lipid contents in the seeds of GmDof4 and GmDof11 transgenic plants. The data represent the means ± SD of three replicate experiments and were analyzed by Student’s t-test (n = 3).
3.4. Changes in the Expression of Fatty Acid Metabolism-Related Genes in GmDof4 and GmDof11 Transgenic Plants
Referring to previous reports, the expression of target genes that were directly controlled by GmDof4 and GmDof11 were additionally analyzed, including the 12S storage protein subunit encoding gene CRA1, the ACCase β subunit encoding gene accD, and LCAS5. The expression of accD was significantly upregulated in two GmDof4 transgenic seeds compared with its expression in the non-transgenic plants. FAB2, which is responsible for oleic acid synthesis, FAD3 and FAD8, which is responsible for the synthesis of linolenic acid from linoleic acid, were significantly upregulated by more than threefold in both lines (Figure 4). However, no significant difference was found in the expression of the other genes, except for LACS5, which was slightly upregulated. The expression of accD was also upregulated by approximately threefold in two GmDof11 transgenic seeds. However, the expression of FAD2 and FAD6, which are the coding genes responsible for the synthesis of linoleic acid, was inhibited (Figure 4). These results indicate that GmDof4 and GmDof11 do upregulate the expression of accD, and both genes jointly and specifically upregulate or downregulate the genes that are involved in the synthesis of fatty acids.
Figure 4.
Gene expression detected by qRT-PCR in transgenic and non-transgenic seeds. RT-qPCR was used to determine the relative expression of genes related to lipid and fatty acid metabolism. Bars indicate SD (n = 3), Significant differences between transgenic and non-transgenic seeds are labelled with asterisks: ** p < 0.01 (Student’s t test).
In addition, qPCR results demonstrated that the gene expression levels of FAE1 and FAE7, which are responsible for the synthesis of eicosanoic acid, were lower than the detection limit of the qPCR technique (Ct > 40). Moreover, there was no expression of the CRA1 gene in both the GmDof4 transgenic and non-transgenic seeds, but it was detected in the two GmDof11 transgenic seeds with slight expression (expression level relative to BnActin ≈ 10−4), indicating that CRA1 might be upregulated slightly in the GmDof11 transgenic plants.
3.5. Yeast One-Hybrid Assay to Detect Target Genes of GmDof4 and GmDof11
Based on the transcriptome data in various tissues and organs of B. napus obtained earlier by our group, more than one copy of the CRA1, FAB2, and FAD2 genes was found in B. napus (Table 1). Analysis of the promoters demonstrates numerous Dof-binding cis-DNA elements in the promoter regions of these genes (Table 1). To test whether GmDof4 and GmDof11 regulated the expression of the aforementioned genes by directly binding to their promoter regions, we investigated part of the putative Dof binding elements in the 1.5 kb promoter region of the CRA1, FAB2, and FAD2 genes according to the binding features of GmDof4 and GmDof11. The results showed that GmDof4 protein could bind strongly to the FAB2-1 and FAB2-2 cis-DNA elements (Figure 5a). These results suggest that GmDof4 protein may regulate FAB2 by binding directly to their promoters. Analysis of GmDof11 protein binding activity demonstrated that GmDof11 binds strongly to FAD2-1 but weakly to CRA1-1 and FAD2-2 (Figure 5a). These results indicate that the GmDof11 protein can directly regulate CRA1 and FAD2.
Table 1.
Number of transcripts of GmDof regulated genes in seeds at 34 days after flowering (DAF) and the cis-DNA elements of these genes.
Figure 5.
GmDof4 and GmDof11 interact with the cis-DNA elements in the promoter regions of downstream genes in the transgenic plants (a) Interaction between GmDof4 and the cis-DNA elements in the promoter regions of CRA1 and FAB2. The bolded and underlined sequences indicate the core sequence of the Dof-binding elements. The putative Dof-binding elements were cloned into pAbAi, and these plasmids were transfected into yeast Y1HGold cells with pGADT7-GmDof4. Growth of the transfected yeast cells on the SD/-Leu/-Ura + AbA (0.2 mg/L) plates indicates that GmDof4 protein can bind to its corresponding cis-DNA element. PTC is a strain that contains pGADT7-GmDof4 and a pAbAi plasmid with an element in the promotor region of AtaccD, which was confirmed to interact with the GmDof4 protein. NTC is a strain that contains pGADT7-GmDof4 and an empty pAbAi plasmid. (b) Interaction between GmDof11 and the cis-DNA elements in the promoter regions of CRA1 and FAD2. The bolded and underlined sequences indicate the core sequence of the Dof-binding elements. The putative Dof-binding elements were cloned into pAbAi, and these plasmids were transfected into yeast Y1HGold cells with pGADT7-GmDof11. Growth of the transfected yeast cells on SD/-Leu/-Ura + AbA (0.2 mg/L) plates indicates that the GmDof11 protein can bind to its corresponding cis-DNA element. PTC is a strain that contains pGADT7-GmDof11 and a pAbAi plasmid with an element in the promotor region of AtCRA1, which was confirmed to be interacting with GmDof11 protein. NTC is a strain that contains pGADT7-GmDof11 and an empty pAbAi plasmid.
4. Discussion
4.1. Overexpression of GmDof4 and GmDof11 Augmented the Oleic Acid in B. napus Seed Oil
GmDof4 and GmDof11 are TFs involved in the regulation of seed oil synthesis in soybean. Overexpression of GmDof4 or GmDof11 augments oil synthesis in transgenic Arabidopsis and the single-cell microalga C. ellipsoidea [44,45]. GmDof4 and GmDof11 overexpressed rapeseed plants were produced using Agrobacterium-mediated genetic transformation. However, no significant change was found in the seed oil content in the four transgenic lines. Comparison of the fatty acids in GmDof4 and GmDof11 transgenic and non-transgenic plants showed a significant change in fatty acid composition. The relative level of the monounsaturated fatty acid oleic acid increased, while the relative levels of the polyunsaturated fatty acids linoleic and linolenic acid decreased significantly in the GmDof transgenic plants compared with the non-transgenic plants. These results suggest that GmDof4 and GmDof11 may play a role in the late stage of fatty acid synthesis in B. napus, by regulating the synthesis of a few specific fatty acids rather than the carbon metabolic flux that would alter the relative levels of the major fatty acids. This phenomenon is different from those in Arabidopsis and C. ellipsoidea. The total lipid content increased significantly in transgenic Arabidopsis seeds and C. ellipsoidea cells, but the relative levels of each fatty acid did not change, except for linoleic acid in Arabidopsis overexpressing GmDof4 [44,52]. The difference may be due to the large genome of B. napus and the complex network regulation of the synthesis and accumulation of oil during seed development. Therefore, increasing the oil content of rapeseed may require precise and more targeted genetic engineering.
4.2. GmDof4 and GmDof11 Regulated the Genes of Fatty Acid Synthesis by Binding to the Cis-DNA Elements in the Promoter Region of These Genes
In oil crops, lipid and fatty acid synthesis involves a number of enzymes [5,7,12]. FAB2, which encodes a stearoyl-ACP desaturase, catalyzes the synthesis of oleic acid. The expression level of FAB2 affects the content of oleic acid [53,54]. Kachroo et al. found that the stearic acid content in the FAB2 gene mutant (ssi2) was approximately 18 times higher than that in WT plants, and the content of oleic, linoleic, and linolenic acid was significantly reduced. Meanwhile, FAB2 is involved in the activation of NPR1-dependent and -independent defense responses [55,56,57]. FAD2 and FAD3 are two important enzymes in the synthesis of unsaturated fatty acids in seed oils. They are integrated into the endoplasmic reticulum and they are responsible for the catalysis of the conversion of oleic acid to linoleic acid and then linolenic acid. Furthermore, in plastids FAD6 is an isoenzyme of FAD2, while FAD7 and FAD8 are isoenzymes of FAD3 [31,58]. FAD6, FAD7, and FAD8 are closely related to the synthesis of unsaturated fatty acids on chloroplast membranes [59]. The expression of these genes affect leaf lipids in Arabidopsis [31,56]. Therefore, we examined the expression of these desaturases in transgenic lines.
accD, which encodes the β-subunit of ACCase, was upregulated in seeds of the GmDof4 transgenic plants at 30 DAF. This result is consistent with studies in Arabidopsis. In addition, FAB2, FAD3, and FAD8 genes were significantly upregulated. This finding suggests that GmDof4 likely increased oleic acid synthesis by increasing the expression of genes that are related to oleic acid synthesis, in spite of the upregulated FAD3 not increasing the content of C18:3, which is possibly due to the complexity of the regulation of fatty acid accumulation in seeds. The expression of FAD2 and FAD6 were downregulated in GmDof11 transgenic seeds. The downregulation of FAD2 may have caused a decrease in the content of linoleic acid and linolenic acid, thereby increasing the proportion of oleic acid. It is not clear whether the change in the expression of FAD6 and FAD8 in the overexpression plants changed the response to stress. Expression of FAE1 and FAE7 genes, which are responsible for erucic acid (C22:1) synthesis, were not detected in all plants. This result may be due to the fact that the rapeseed variety that is used here has low erucic acid characteristics, and erucic acid synthesis genes are severely inhibited. In addition, although the expression of accD was upregulated in the seeds of the four transgenic lines, seeds oil content of did not increase. This result indicates that other regulation mechanisms in the seeds of B. napus related to the accumulation of oil.
In Arabidopsis, GmDof4 binds directly to the Dof-binding cis-DNA element in the promoter regions of the accD and CRA1 genes, and GmDof11 directly regulates the expression of LCAS and CRI1 genes [44]. In this study, we found that GmDof4 bound to the cis-DNA element in the promoter region of FAB2, whereas GmDof11 bound to the cis-DNA element in the promoter region of CRA1 and FAD2. These results indicate that GmDof4 and GmDof11 regulated components of fatty acid synthesis in seed oil by regulating the expression of specific genes. Whether the slight upregulation of the CRA1 gene in GmDof11 transgenic seeds was caused by the direct interaction of GmDof11 and the cis-DNA element of CRA1 should be further examined using a dual luciferase reporter system. Evaluation of the number of Dof binding elements (A/T)TTTG or CAAA(A/T) at the promoter regions of the potential target genes revealed that they contained a large number of Dof binding elements (Table 1). While considering that there are 134 putative Dof genes in B. napus, the existence of those elements indicates that the specific spatial and temporal expression of these genes may be regulated by various Dof TFs. This makes it possible to regulate the expression of the genes that are involved in lipid and fatty acid synthesis in B. napus by GmDof4 and GmDof11. Interestingly, except for BnaC.accD.c (BnaC09g27690D), which showed incomplete genome sequencing at the promoter region, the 1.5 kb promoter region of three accD duplicates in B. napus were identical (Figure S3). The homology of the accD gene to Arabidopsis was 96.74%. In addition, it has been suggested that the 5′-untranslated region (UTR) of plant FAD2 genes is evolutionarily conserved [35,60]. These results strongly suggest that the regulation of expression of the genes involved in fatty acid synthesis might also be highly conserved. GmDof4 and GmDof11 proteins increased oleic acid content in seed oil by activating or inhibiting genes that are associated with fatty acid synthesis in B. napus. Both proteins may be used as a genetic resource to improve the quality of rapeseed oil.
Supplementary Materials
The following are available online at http://www.mdpi.com/2073-4395/8/10/222/s1, Figure S1: PCR analysis of putative transformants of GmDof4, Figure S2: PCR analysis of putative transformants of GmDof11, Figure S3: Homology of the accD gene promoters in B. napus and A. thaliana, Table S1: Amplification primers used for Semi-quantitative and quantitative RT-PCR, Table S2: Composition of the major fatty acids in GmDof4 and GmDof11 transgenic seeds, Table S3: the Dof genes in B. napus.
Author Contributions
Y.W. designed the experiment, Q.S. and J.X. performed experiments, L.L. and D.L. created the materials, J.W. and J.J. analyzed data and revised the manuscript. All the authors approved the final manuscript.
Funding
This research was funded by National Nature Science Foundation of China (31330057, 31601330, 31771824), the National Key Basic Research Program (2015CB150201), National Undergraduate Training Program for Innovation and Entrepreneurship (201711117034Z), and the Priority Academic Program Development of Jiangsu Higher Education Institutions.
Conflicts of Interest
The authors declare no conflict of interest.
References
- Lin, L.; Allemekinders, H.; Dansby, A.; Campbell, L.; Durance-Tod, S.; Berger, A.; Jones, P.J.H. Evidence of health benefits of canola oil. Nutr. Rev. 2013, 71, 370–385. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aldhaidhawi, M.; Chiriac, R.; Badescu, V. Ignition delay, combustion and emission characteristics of Diesel engine fueled with rapeseed biodiesel—A literature review. Renew. Sustain. Energy Rev. 2017, 73, 178–186. [Google Scholar] [CrossRef] [Scilit]
- Saka, S.; Kusdiana, D. Biodiesel fuel from rapeseed oil as prepared in supercritical methanol. Fuel 2001, 80, 225–231. [Google Scholar] [CrossRef] [Scilit]
- Hu, Q.; Hua, W.; Yin, Y.; Zhang, X.K.; Liu, L.J.; Shi, J.Q.; Zhao, Y.G.; Qin, L.; Chen, C.; Wang, H.Z. Rapeseed research and production in China. Crop J. 2016, 5, 127–135. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.D.; Long, Y.; Yin, Y.T.; Zhang, C.Y.; Gan, L.; Liu, L.Z.; Yu, L.J.; Meng, J.L.; Li, M.T. New insights into the genetic networks affecting seed fatty acid concentrations in Brassica napus. BMC Plant Biol. 2015, 15, 91. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gillingham, L.G.; Harris-Janz, S.; Jones, P.J.H. Dietary monounsaturated fatty acids are protective against metabolic syndrome and cardiovascular disease risk factors. Lipids 2011, 46, 209–228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weselake, R.J.; Taylor, D.C.; Rahman, M.H.; Shah, S.; Laroche, A.; McVetty, P.B.E.; Harwood, J.L. Increasing the flow of carbon into seed oil. Biotechnol. Adv. 2009, 27, 866–878. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, J.Y.; Dimov, Z.; Becker, H.C.; Ecke, W.; Möllers, C. Mapping QTL controlling fatty acid composition in a doubled haploid rapeseed population segregating for oil content. Mol. Breed. 2008, 21, 115–125. [Google Scholar] [CrossRef] [Scilit]
- Delourme, R.; Falentin, C.; Huteau, V.; Clouet, V.; Horvais, R.; Gandon, B.; Specel, S.; Hanneton, L.; Dheu, J.E.; Deschamps, M.; et al. Genetic control of oil content in oilseed rape (Brassica napus L.). Theor. Appl. Genet. 2006, 113, 1331–1345. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Javed, N.; Geng, J.F.; Tahir, M.; McVetty, P.B.E.; Li, G.; Duncan, R.W. Identification of QTL influencing seed oil content, fatty acid profile and days to flowering in Brassica napus L. Euphytica 2016, 207, 191–211. [Google Scholar] [CrossRef] [Scilit]
- Teh, L.; Möllers, C. Genetic variation and inheritance of phytosterol and oil content in a doubled haploid population derived from the winter oilseed rape Sansibar × Oase cross. Theor. Appl. Genet. 2016, 129, 181–199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Katavic, V.; Shi, L.; Yu, Y.Y.; Zhao, L.F.; Haughn, G.W.; Kunst, L. Investigation of the contribution of oil biosynthetic enzymes to seed oil content in Brassica napus and Arabidopsis thaliana. Can. J. Plant Sci. 2014, 94, 1109–1112. [Google Scholar] [CrossRef] [Scilit]
- Vigeolas, H.; Waldeck, P.; Zank, T.; Geigenberger, P. Increasing seed oil content in oil-seed rape (Brassica napus L.) by over-expression of a yeast glycerol-3-phosphate dehydrogenase under the control of a seed-specific promoter. Plant Biotechnol. J. 2007, 5, 431–441. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zou, J.; Katavic, V.; Giblin, E.M.; Barton, D.L.; MacKenzie, S.L.; Keller, W.A.; Hu, X.; Taylor, D.C. Modification of seed oil content and acyl composition in the brassicaceae by expression of a yeast sn-2 acyltransferase gene. Plant Cell 1997, 9, 909–923. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zou, J.; Qi, Q.; Katavic, V.; Marillia, E.-F.; Taylor, D.C. Effects of antisense repression of an Arabidopsis thaliana pyruvate dehydrogenase kinase cDNA on plant development. Plant Mol. Biol. 1999, 41, 837–849. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taylor, D.C.; Zhang, Y.; Kumar, A.; Francis, T.; Giblin, E.M.; Barton, D.L.; Ferrie, J.R.; Laroche, A.; Shah, S.; Zhu, W.M.; et al. Molecular modification of triacylglycerol accumulation by over-expression of DGAT1 to produce canola with increased seed oil content under field conditions. Botany 2009, 87, 533–543. [Google Scholar] [CrossRef] [Scilit]
- Peng, D.; Zhang, L.; Tan, X.F.; Yuan, D.Y.; Liu, X.M.; Zhou, B. Increasing seed oil content and altering oil quality of Brassica napus L. by over-expression of diacylglycerol acyltransferase 1 (SsDGAT1) from Sapium sebiferum (L.) Roxb. Mol. Breed. 2016, 36, 136. [Google Scholar] [CrossRef] [Scilit]
- Zhao, C.Z.; Li, H.; Zhang, W.X.; Wang, H.L.; Xu, A.X.; Tian, J.H.; Zou, J.T.; Taylor, D.C.; Zhang, M. BnDGAT1s function similarly in oil deposition and are expressed with uniform patterns in tissues of Brassica napus. Front. Plant Sci. 2017, 8, 2205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aznar-Moreno, J.; Denolf, P.; Van Audenhove, K.; De Bodt, S.; Engelen, S.; Fahy, D.; Wallis, J.G.; Browse, J. Type 1 diacylglycerol acyltransferases of Brassica napus preferentially incorporate oleic acid into triacylglycerol. J. Exp. Bot. 2015, 66, 6497–6506. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, F.; Xia, Y.P.; Wu, L.; Fu, D.H.; Hayward, A.; Luo, J.L.; Yan, X.H.; Xiong, X.J.; Fu, P.; Wu, G.; et al. Enhanced seed oil content by overexpressing genes related to triacylglyceride synthesis. Gene 2015, 557, 163–171. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, J.; Hua, W.; Yang, H.L.; Zhan, G.M.; Li, R.J.; Deng, L.B.; Wang, X.F.; Liu, G.H.; Wang, H.Z. The BnGRF2 gene (GRF2-like gene from Brassica napus) enhances seed oil production through regulating cell number and plant photosynthesis. J. Exp. Bot. 2012, 63, 3727–3740. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tan, H.L.; Yang, X.H.; Zhang, F.X.; Zheng, X.; Qu, C.M.; Mu, J.Y.; Fu, F.Y.; Li, J.N.; Guan, R.Z.; Zhang, H.S.; et al. Enhanced seed oil production in canola by conditional expression of Brassica napus LEAFY COTYLEDON1 and LEC1-LIKE in developing seeds. Plant Physiol. 2011, 156, 1577–1588. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elahi, N.; Duncan, R.W.; Stasolla, C. Decreased seed oil production in FUSCA3 Brassica napus mutant plants. Plant Physiol. Biochem. 2015, 96, 222–230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baud, S.; Mendoza, M.S.; To, A.; Harscoët, E.; Lepiniec, L.; Dubreucq, B. WRINKLED1 specifies the regulatory action of LEAFY COTYLEDON2 towards fatty acid metabolism during seed maturation in Arabidopsis. Plant J. 2007, 50, 825–838. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elahi, N.; Duncan, R.W.; Stasolla, C. Modification of oil and glucosinolate content in canola seeds with altered expression of Brassica napus LEAFY COTYLEDON1. Plant Physiol. Biochem. 2016, 100, 52–63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Q.; Shao, J.H.; Tang, S.H.; Shen, Q.W.; Wang, T.H.; Chen, W.L.; Hong, Y.Y. Wrinkled1 accelerates flowering and regulates lipid homeostasis between oil accumulation and membrane lipid anabolism in Brassica napus. Front. Plant Sci. 2015, 6, 1–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, J.; Hua, W.; Zhan, G.M.; Wei, F.; Wang, X.F.; Liu, G.L.; Wang, H.Z. Increasing seed mass and oil content in transgenic Arabidopsis by the overexpression of wri1-like gene from Brassica napus. Plant Physiol. Biochem. 2010, 48, 9–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, M.J.; Lydiate, D.J.; Li, X.; Lui, H.L.; Gjetvaj, B.; Hegedus, D.D.; Rozwadowski, K. Repression of seed maturation genes by a trihelix transcriptional repressor in Arabidopsis seedlings. Plant Cell 2009, 21, 54–71. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elhiti, M.; Yang, C.C.; Chan, A.; Durnin, D.C.; Belmonte, M.F.; Ayele, B.T.; Tahir, M.; Stasolla, C. Altered seed oil and glucosinolate levels in transgenic plants overexpressing the Brassica napus SHOOTMERISTEMLESS gene. J. Exp. Bot. 2012, 63, 4447–4461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ohlrogge, J.; Browse, J. Lipid biosynthesis. Plant Cell 1995, 7, 957–970. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wallis, J.G.; Browse, J. Mutants of Arabidopsis reveal many roles for membrane lipids. Prog. Lipid Res. 2002, 41, 254–278. [Google Scholar] [CrossRef] [Scilit]
- Beisson, F.; Koo, A.J.K.; Ruuska, S.; Schwender, J.; Pollard, M.; Thelen, J.J.; Paddock, T.; Salas, J.J.; Savage, L.; Milcamps, A.; et al. Arabidopsis Genes Involved in Acyl Lipid Metabolism. A 2003 Census of the Candidates, a Study of the Distribution of Expressed Sequence Tags in Organs, and a Web-Based Database. Plant Physiol. 2003, 132, 681–697. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, J.; Lang, C.; Wu, X.; Liu, R.; Zheng, T.; Zhang, D.; Chen, J.; Wu, G. RNAi knockdown of fatty acid elongase1 alters fatty acid composition in Brassica napus. Biochem. Biophys. Res. Commun. 2015, 466, 518–522. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, J.H.; Lang, C.X.; Wang, F.L.; Wu, X.L.; Liu, R.H.; Zheng, T.; Zhang, D.Q.; Chen, J.Q.; Wu, G.T. Depressed expression of FAE1 and FAD2 genes modifies fatty acid profiles and storage compounds accumulation in Brassica napus seeds. Plant Sci. 2017, 263, 177–182. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jung, J.H.; Kim, H.; Go, Y.S.; Lee, S.B.; Hur, C.-G.; Kim, H.U.; Suh, M.C. Identification of functional BrFAD2-1 gene encoding microsomal delta-12 fatty acid desaturase from Brassica rapa and development of Brassica napus containing high oleic acid contents. Plant Cell Rep. 2011, 30, 1881–1892. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yanagisawa, S. The Dof family of plant transcription factors. Trends Plant Sci. 2002, 7, 555–560. [Google Scholar] [CrossRef] [Scilit]
- Bocianowski, J.; Mikołajczyk, K.; Bartkowiak-Broda, I. Determination of fatty acid composition in seed oil of rapeseed (Brassica napus L.) by mutated alleles of the FAD3 desaturase genes. J. Appl. Genet. 2012, 53, 27–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Noguero, M.; Atif, R.M.; Ochatt, S.; Thompson, R.D. The role of the DNA-binding One Zinc Finger (DOF) transcription factor family in plants. Plant Sci. 2013, 209, 32–45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kurai, T.; Wakayama, M.; Abiko, T.; Yanagisawa, S.; Aoki, N.; Ohsugi, R. Introduction of the ZmDof1 gene into rice enhances carbon and nitrogen assimilation under low-nitrogen conditions. Plant Biotechnol. J. 2011, 9, 826–837. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Diaz, I.; Martinez, M.; Isabel-Lamoneda, I.; Rubio-Somoza, I.; Carbonero, P. The DOF protein, SAD, interacts with GAMYB in plant nuclei and activates transcription of endosperm-specific genes during barley seed development. Plant J. 2005, 42, 652–662. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, J.Y.; Dai, H.B. Brassica napus Cycling Dof Factor1 (BnCDF1) is involved in flowering time and freezing tolerance. Plant Growth Regul. 2016, 80, 315–322. [Google Scholar] [CrossRef] [Scilit]
- Ma, J.; Li, M.Y.; Wang, F.; Tang, J.; Xiong, A.S. Genome-wide analysis of Dof family transcription factors and their responses to abiotic stresses in Chinese cabbage. BMC Genom. 2015, 16, 33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tian, A.G.; Wang, J.; Cui, P.; Han, Y.J.; Xu, H.; Cong, L.J.; Huang, X.G.; Wang, X.L.; Jiao, Y.Z.; Wang, B.J.; et al. Characterization of soybean genomic features by analysis of its expressed sequence tags. Theor. Appl. Genet. 2004, 108, 903–913. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, H.W.; Zhang, B.; Hao, Y.J.; Huang, J.; Tian, A.G.; Liao, Y.; Zhang, J.S.; Chen, S.Y. The soybean Dof-type transcription factor genes, GmDof4 and GmDof11, enhance lipid content in the seeds of transgenic Arabidopsis plants. Plant J. 2007, 52, 716–729. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, J.H.; Hao, Q.; Bai, L.L.; Xu, J.; Yin, W.B.; Song, L.Y.; Xu, L.; Guo, X.J.; Fan, C.M.; Chen, Y.H.; et al. Overexpression of the soybean transcription factor GmDof4 significantly enhances the lipid content of Chlorella ellipsoidea. Biotechnol. Biofuels 2014, 7, 128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Block, M.; De Brouwer, D.; Tenning, P. Transformation of Brassica napus and Brassica oleracea Using Agrobacterium tumefaciens and the Expression of the bar and neo Genes in the Transgenic Plants. Plant Physiol. 1989, 91, 694–701. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Porebski, S.; Bailey, L.G.; Baum, B.R. Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Mol. Biol. Rep. 1997, 15, 8–15. [Google Scholar] [CrossRef] [Scilit]
- Tkachuk, R. Oil and protein analysis of whole rapeseed kernels by near infrared reflectance spectroscopy. J. Am. Oil Chem. Soc. 1981, 58, 819–822. [Google Scholar] [CrossRef] [Scilit]
- Taylor, D.C.; Barton, D.L.; Giblin, E.M.; MacKenzie, S.L.; van den Berg, C.; McVetty, P. Microsomal Lyso-phosphatidic acid acyltransferase from a Brassica oleracea cultivar incorporates erucic acid into the sn-2 position of seed triacylglycerols. Plant Physiol. 1995, 109, 409–420. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fatima, T.; Snyder, C.L.; Schroeder, W.R.; Cram, D.; Datla, R.; Wishart, D.; Weselake, R.J.; Krishna, P. Fatty acid composition of developing sea buckthorn (Hippophae rhamnoides L.) berry and the transcriptome of the mature seed. PLoS ONE 2012, 7, e34099. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chalhoub, B.; Denoeud, F.; Liu, S.; Parkin, I.A.P.; Tang, H.; Wang, X.; Chiquet, J.; Belcram, H.; Tong, C.; Samans, B.; et al. Early allopolyploid evolution in the post-Neolithic Brassica napus oilseed genome. Science 2014, 345, 950–953. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, D.; Hua, Y.; Wang, X.; Zhao, H.; Shi, L.; Xu, F. A High-Density Genetic Map Identifies a Novel Major QTL for Boron Efficiency in Oilseed Rape (Brassica napus L.). PLoS ONE 2014, 9, e112089. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kachroo, P.; Shanklin, J.; Shah, J.; Whittle, E.J.; Klessig, D.F. A fatty acid desaturase modulates the activation of defense signaling pathways in plants. Proc. Natl. Acad. Sci. USA 2001, 98, 9448–9453. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, N.; Hu, Z.R.; Li, Y.H.; Li, C.; Peng, F.X.; Yao, Y.Y.; Peng, H.R.; Ni, Z.F.; Xie, C.J.; Sun, Q.X. Overexpression of a wheat stearoyl-ACP desaturase (SACPD) gene TaSSI2 in Arabidopsis ssi2 mutant compromise its resistance to powdery mildew. Gene 2013, 524, 220–227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kachroo, A.; Lapchyk, L.; Fukushige, H.; Hildebrand, D.; Klessig, D.; Kachroo, P. Plastidial fatty acid signaling modulates salicylic acid- and jasmonic acid-mediated defense pathways in the Arabidopsis ssi2 mutant. Plant Cell 2003, 15, 2952–2965. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kachroo, P.; Venugopal, S.C.; Navarre, D.A.; Lapchyk, L.; Kachroo, A. Role of salicylic acid and fatty acid desaturation pathways in ssi2-mediated signaling. Plant Physiol. 2005, 139, 1717–1735. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kachroo, A.; Shanklin, J.; Whittle, E.; Lapchyk, L.; Hildebrand, D.; Kachroo, P. The Arabidopsis stearoyl-acyl carrier protein-desaturase family and the contribution of leaf isoforms to oleic acid synthesis. Plant Mol. Biol. 2007, 63, 257–271. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nishiuchi, T.; Hamada, T.; Kodama, H.; Iba, K. Wounding changes the spatial expression pattern of the arabidopsis plastid omega-3 fatty acid desaturase gene (FAD7) through different signal transduction pathways. Plant Cell 1997, 9, 1701–1712. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gibson, S.; Arondel, V.; Iba, K.; Somerville, C. Cloning of a temperature-regulated gene encoding a chloroplast ω-3 desaturase from Arabidopsis thaliana. Plant Physiol. 1994, 106, 1615–1621. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, M.J.; Kim, H.; Shin, J.S.; Chung, C.-H.; Ohlrogge, J.B.; Suh, M.C. Seed-specific expression of sesame microsomal oleic acid desaturase is controlled by combinatorial properties between negative cis-regulatory elements in the SeFAD2 promoter and enhancers in the 5′-UTR intron. Mol. Genet. Genom. 2006, 276, 351–368. [Google Scholar] [CrossRef] [Scilit] [PubMed]
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).




