Next Article in Journal
Cropland Expansion Masks Ecological Degradation: The Unsustainable Greening of China’s Drylands
Previous Article in Journal
Entomopathogenic Fungus Treatment Affects Trophic Interactions by Altering Volatile Emissions in Tomato
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 15
Issue 5
10.3390/agronomy15051163
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Biochar Promotes Phosphorus Solubilization by Reconstructing Soil Organic Acid and Microorganism Networks

by
Bowen Fan
1,2,3,4,
Liqin Zhao
3,
Fengjun Yang
3,
Changjiang Zhao
1,2,4,* and
Zuotong Li
1,2,4,*
1
College of Agronomy, Heilongjiang Bayi Agricultural University, Daqing 163000, China
2
Key Laboratory of Low-Carbon Green Agriculture in Northeastern China, Ministry of Agriculture and Rural Affairs P.R., Daqing 163000, China
3
College of Horticulture and Landscape Architecture, Heilongjiang Bayi Agricultural University, Daqing 163000, China
4
Engineering Research Center of Crop Straw Utilization, Daqing 163000, China
*
Authors to whom correspondence should be addressed.
Agronomy 2025, 15(5), 1163; https://doi.org/10.3390/agronomy15051163
Submission received: 2 April 2025 / Revised: 3 May 2025 / Accepted: 7 May 2025 / Published: 9 May 2025
(This article belongs to the Section Soil and Plant Nutrition)
Browse Figures
Review Reports Versions Notes

Abstract

:
Biochar has the ability to enhance the solubilization of phosphorus (P) in soil. Nonetheless, the role played by organic acid and microorganism in P solubilization under biochar application conditions remains unclear. In this study, we examined the relationship between soil organic acids and microorganisms, as well as P fractions, following the addition of biochar, utilizing foxtail millet, maize, soybean, and mung bean as materials. The results demonstrated that the addition of biochar increased the availability of P by increasing the content of the resin-P fraction and decreasing the content of the NaOH-Pi, NaOH-Po, and HCl-P fractions in the soil. In addition, resin-P fractions were elevated by 142.78%, 95.27%, 35.99%, and 21.55% in the soils of foxtail millet, maize, soybean, as well as mung bean, respectively. In the microorganisms, the addition of biochar promotes P conversion by increasing the number of labile-P-associated microorganisms and decreasing the number of moderate-labile-P- and non-labile-P-associated microorganisms. In the organic acids, biochar expanded the biological pathways for the solubilization of moderate-labile-P through organic acids. This study illustrates the potential mechanism of biochar to enhance soil P availability.

1. Introduction

Phosphorus (P) is a crucial nutrient for the growth and development of plants. Due to its high adsorption and tendency to precipitate in the soil, a significant portion of phosphate becomes sequestered and is not readily available for direct use by plants [1]. Consequently, enhancing the availability of P in soils is essential for sustainable agricultural production and ecosystem development.
Insoluble P in soil exists mainly in two forms: insoluble inorganic P and insoluble organic P [2,3]. Insoluble inorganic P exists in the soil predominantly in the form of phosphate minerals, including phosphates formed by combining with metal cations such as iron, aluminum, and calcium [4]. Insoluble organic P primarily exists in the organic matter of the soil, occurring in forms such as humus, phospholipids, and nucleic acids [5].
Organic acids and bacteria in the soil increase the solubilization of insoluble P, converting it to a plant-available form of P. There are three primary mechanisms by which organic acids enhance the solubilization of insoluble P in soil. One mechanism is chelation, where the carboxyl and hydroxyl groups within the organic acid molecules form chelating compounds with metal cations, such as Fe, Al, and Ca, present in the soil [6]. This chelation weakens the binding of metal ions to phosphate, thus releasing phosphate ions and increasing P solubility. In addition, the second is acidification, where the acidic nature of organic acids can reduce soil pH and facilitate the dissolution of insoluble phosphates [7]. For instance, under acidic conditions the solubility of iron and aluminum phosphates increases, allowing a greater amount of P to enter the soil solution for plant uptake [8]. The third mechanism is competitive adsorption, where organic acids can compete with phosphate ions for adsorption sites on the surfaces of soil colloids, thereby reducing the fixation of phosphate on the colloid surfaces and increasing the dissolution of P in the soil solution [9]. Bacteria in the soil play an essential role in promoting the dissolution of insoluble P, and these bacteria act through three main pathways. One mechanism involves the secretion of organic acids as many P-solubilizing bacteria are capable of producing organic acids such as gluconic acid, oxalic acid, and citric acid [10]. These organic acids promote phosphate solubilization through acidification, chelation, as well as competitive adsorption, making insoluble P available. Moreover, the second is the secretion of extracellular enzymes, where bacteria can secrete phosphatases that mineralize organic P compounds into inorganic P [11]. Additionally, the third is biological amelioration, where bacterial activity enhances the inter-root environment and improves soil aeration, thereby facilitating the solubilization of insoluble P by plant roots [12].
Biochar is a type of aromatic carbon-rich material generated through the high-temperature pyrolysis of biomass under anoxic conditions, characterized by a well-developed pore structure, a large specific surface area, and significant stability [13]. Biochar applied to the soil can substantially improve soil physical properties, as well as enhance the soil’s ability to retain fertilizers and promote the formation of agglomerates [14]. Moreover, biochar acts as a stabilizing carbon source, sequestering in the soil, reducing the rate of carbon mineralization, and lowering greenhouse gas emissions [15,16]. Biochar promotes the fixation of inorganic nitrogen and the mineralization of organic nitrogen by regulating the microbial community structure, which in turn increases the effectiveness of nitrogen in the soil [17,18]. In addition to regulating the soil carbon and nitrogen cycles, biochar can also increase the availability of P in the soil and improve the efficiency of P uptake and utilization by plants by enhancing phosphatase activity [19,20,21]. In summary, biochar demonstrates great potential for application in improving soil physical structure, regulating carbon and nitrogen cycles, as well as increasing P effectiveness. Nonetheless, few articles have been published regarding the role of organic acids and bacterial communities in the transformation of P fractions following the application of biochar.
In this study, soils planted with foxtail millet, maize, soybean, and mung bean crops were employed as the control group, and biochar addition to soils planted with the four crops was adopted as the test group. Various analytical methods were employed to reveal the effects of biochar addition on P fractions, organic acids, and microbial communities. It predominantly includes (1) indicating the effects of biochar on the transformation of P fractions in soil; (2) clarifying the effects of biochar on organic acids and microbial networks in soil; (3) analyzing the relationship between microbial community structure and P fractions under biochar conditions; (4) establishing a model for the biochar-driven regulation of organic acids and microbial effects on P availability; and (5) validating the role of core organic acids in promoting P-fraction-associated microorganisms and the P available. This work offers in-depth and novel insights into the dissolution of insoluble P facilitated by biochar.

2. Material and Methods

2.1. Experimental Material

The foxtail millet variety tested was ‘Red Golden Valley’(a locally dominant cultivar in Heilongjiang Province, China). In addition, the maize variety was ‘Xianyu 335’ (provided by Tieling Pioneer Seed Research Co., Ltd., Tieling, China). The soybean variety used was ‘Heinong 86’ (provided by Heilongjiang Academy of Agricultural Sciences, Harbin, China), while the mung bean variety was ‘Changlv 8’ (a locally dominant cultivar in Heilongjiang Province, China). Meanwhile, the soil was collected from Anda Agricultural Science and Technology Park of Heilongjiang Bayi Agricultural University. The basic physical and chemical properties of the soil were as follows: pH 8.3, electrical conductivity values 24.6 mS/cm, total nitrogen 1.31 g/kg, total phosphorus 0.67 g/kg, and total potassium 18.46 g/kg. Furthermore, the biochar was rice shell biochar, purchased from Heilongjiang Dili Agricultural Development Co., Harbin, China. To mitigate the impact of high P content in biochar on soil P fractions, the purchased biochar was soaked in a 2 mol/L HCl solution for 12 h and subsequently washed six times with deionized water. Subsequently, it was soaked in 0.5 mol/L NaHCO3 solution for 12 h and washed with deionized water for 6 times. Biochar with low P content was obtained. The basic properties of the biochar are as follows: pH 9.13, total carbon 42.18%, total nitrogen 0.70%, total phosphorus 0.07%, total potassium 0.04%. The infrared spectrum of biochar is shown in Supplementary Figure S1.

2.2. Experimental Design

A total of eight treatments were established in the experiment: foxtail millet (MIB), maize (MAB), soybean (SOB), and mung bean (MUB) planted in soil with the addition of 3% biochar, and foxtail millet (MIC), maize (MAC), soybean (SOC), and mung bean (MUC) planted in pure soil. The treatments MIB, MAB, SOB, and MUB were designated as the treatment group (B). Four of the treatments, MIC, MAC, SOC, and MUC, were defined as the control group (CK).
Each pot contained 500 g of soil, and each treatment was replicated three times. Nitrogen, phosphate, and potash fertilizers were applied in the form of urea (N = 46.7%), single superphosphate (P2O5 = 16%), and potassium sulfate (K2O = 60%), respectively. The N, P, and K application rates were 100 mg/kg, 100 mg/kg, and 100 mg/kg, respectively. On the first day, ten seeds were sown in each pot. Seeds were cultivated under the following conditions: light intensity of 1000 µmol m−2 s−1, light duration of 12 h/d, day and night temperatures of 22 °C/18 °C, and relative humidity of 60–80% [22]. All pots with soil were weighed at the beginning of the experiment and watered every morning to maintain the soil moisture content between 70 and 75%. The rhizosphere soil samples were collected after 25 days of plant growth [23]. The samples were divided into two portions: one portion was stored at −80 °C for microbiome and metabolome analyses while the other portion was air-dried for chemical measurements.
Soil culture tests were performed with biochar-induced core organic acids (fumaric acid, citric acid, malic acid, and α-ketoglutarate acid) as additives to clarify the effects of core organic acids on P availability and microbial communities. The soil used for the experiment was the same as that used for potting. The selected core organic acids (2.5 mM fumaric acid, 2.5 mM citric acid, 2.5 mM malic acid, and 2.5 mM α-ketoglutarate acid) were added to the sterile ultra-pure water in aliquots to achieve a final organic acid solution concentration of 10 mM. Meanwhile, 15 g of soil was placed into each well of a six-well plate and 0.7 mL of organic acid solution was added to each well at a time as the treatment group (BA). They were incubated in the dark in a growth chamber at 30 °C for 8 weeks, with organic acid added twice a week. In the control group (C), sterile ultra-pure water was used instead of the organic acid solution, and each treatment was replicated three times. Soil samples were divided into triplicates, and one sample was stored at −80 °C for microbiome determination, one sample was used directly to determine alkaline phosphatase activity, and the other was air-dried to assess the available P content.

2.3. Methods of Testing

2.3.1. Measurement of Chemical Indicators

Extraction of AP and TP were performed utilizing 0.5 M NaHCO3 and HClO4-H2SO4, respectively, and assayed by adopting the ascorbic acid/molybdate reagent blue color method [24]. The Hedley P fractionation scheme was employed to analyze the P fractions, including resin-P, NaHCO3-Pi, NaHCO3-Po, NaOH-Pi, NaOH-Po, HCI-P, and residual P, of samples in composting [25]. The alkaline phosphatase activities were measured using a soil enzyme kit. (Solarbio Science & Technology Co., Beijing, China).

2.3.2. Microbial Amplicon Sequencing

DNA was extracted from soil samples utilizing a Soil DNA Extraction Kit (Omega Bio-tek, Inc., Norcross, GA, USA). The V3-V4 region of the microbial 16S rRNA gene was amplified using primers 338F, ACTCCTACGGGAGGCAGCAG and 806R, GGACTACHVGGGGTWTCTAAT. The 16S gene PCR method was as follows: denaturation at 95 °C for 5 min, 95 °C for 45 s, 55 °C for 50 s, 72 °C for 45 s, and finally extension at 72 °C for 10 min, for a total of 28 cycles. The PCR products were analyzed using 1% agarose gel electrophoresis (170 V, 30 min) and purified with an Agencourt AMPure XP Nucleic Acid Purification Kit (Beckman Coulter, Inc., Brea, CA, USA). Subsequently, the amplification products were sequenced using the Illumina MiSeq PE300 platform (Beijing Allwegene Tech, Ltd., Beijing, China).
Raw data were quality controlled and merged employing Pear (v0.9.6). Chimeric sequences were identified and removed from the trimmed and filtered data by utilizing VSEARCH (v2.7.1). OTU clustering was performed using VSEARCH (v2.7.1). Representative sequences of microbial OTUs were aligned with the Silva138 database using the BLAST algorithm (https://blast.ncbi.nlm.nih.gov) to acquire microbial species annotation data. Both bacterial and archaeal sequences were included in the analysis. Based on phylum-level taxonomic classification, the majority of OTUs were assigned to the domain bacteria (approximately 99.97%), whilst archaea accounted for a smaller fraction (approximately 0.03%). All raw sequences were archived in the NCBI Sequence Read Archive (SRA) under bioproject PRJNA1176377.

2.3.3. Measurement of Organic Acids

Weigh 500 mg of soil sample accurately, add 1 mL of 80% methanol water, grind for 6 min on a freezer mill, sonicate for 30 min, centrifuge for 20 min at 14,000 rcf at 4 °C, take 500 μL of supernatant and blow dry with nitrogen, add 10 μL of isotope internal standard, 50 μL of 50% methanol water, and 100 μL of methanol/acetonitrile (1:1), vortex for 1 min, add 20 μL of 200 mM 3NPH HCL and 20 μL of 120 mM EDC HCL (containing 6% pyridine) solution, vortex for 30 s, perform a transient separation for 5 s, and keep at 40 °C for reaction for 60 min. After completion of the reaction, vortex for 30 s, perform 4 °C 14,000 rcf centrifugation for 20 min, and transfer the supernatant into the injection vial and subsequently analyze using the machine.
LC-ESI-MS/MS (UHPLC-Qtrap) was adopted for the qualitative and quantitative determination of the target in the samples with the following parameters: an ExionLC AD system, a Waters HSS T3 (2.1 × 150 mm, 1.8 μm) liquid chromatography column, a column temperature of 40 °C, and an injection volume of 2 μL. Mobile phase A (0.03% formic acid solution) and mobile phase B (0.03% methanol formate).
Upon completion of the onboarding process, the LC-MS raw data were imported into the Sciex quantitative software OS (version 2.1.6) for the automatic identification and integration of each ion fragment using default parameters. A linear regression standard curve was constructed with the ratio of the mass spectral peak area of the analyte to the peak area of the internal standard as the vertical axis and the concentration of the analyte as the horizontal axis. For the calculation of sample concentration, the ratio of mass spectral peak area of the sample analyte to the peak area of the internal standard is substituted into the linear equation to calculate the concentration result [26].

2.4. Statistical Analysis

Data were presented as means and standard deviations derived from three replicate samples, and they were compared in SPSS 25.0 (IBM, Armonk, NY, USA) via one-way ANOVAs with Duncan’s test for multiple comparisons (p < 0.05). GradePad Prism (8.0.1.244) was used for plotting. The microbial diversity index was determined using the “vegan” package within the R software (version 4.2.2). Organic acid and microbial co-occurrence network data were processed utilizing the “igraph” (version 1.3.5) and “ggClusterNet” (version 0.1.0) packages, and network topological properties were evaluated and visualized using Gephi software (0.9.2). Network analysis utilizing Pearson’s correlation coefficients identified key microorganisms associated with P fractions. Structural equation modeling (SEM) was conducted using AMOS 23.0 software to evaluate the proposed pathways through which organic acids influence P availability. Overall SEM goodness-of-fit was based on a Chi-square test (χ2 < 10) and non-significant Chi-square tests (p > 0.05).

3. Results

3.1. Effect of Biochar on Soil P Fractions of Different Crops

Resin-P, NaHCO3-Pi, and NaHCO3-Po are P fractions that are readily available for decomposition and belong to labile-P [27]. The addition of biochar substantially increased the resin-P content in foxtail millet, maize, soybean, and mung bean soils by 142.78%, 95.27%, 35.99%, and 21.55%, respectively (Figure 1a). The addition of biochar significantly increased NaHCO3-Pi content in soybean and mung bean soil by 17.31% and 30.48%, respectively (Figure 1b). The addition of biochar significantly increased NaHCO3-Po content in foxtail millet and mung bean soils by 85.13% and 91.32%, respectively (Figure 1c). These indicate that the addition of biochar can increase the labile-P content in soil.
NaOH-Pi and NaOH-Po belong to moderate-labile-P [28]. The addition of biochar substantially reduced NaOH-Pi content in foxtail millet, maize, and mung bean soils by 16.37%, 25.67%, and 21.31%, respectively, in comparison to the control (Figure 1d). The incorporation of biochar led to a significant reduction in NaOH-Po content in soybean and mung bean soils by 34.89% and 60.66%, respectively, compared to the control (Figure 1e). These findings indicate that biochar can diminish the moderate-labile-P content in soil.
HCI-P belongs to non-labile-P [29]. The addition of biochar can significantly reduce the HCI-P content in maize soil by 8.82% compared to the control, which indicates that biochar can reduce the HCI-P content in soil (Figure 1f). Residual P (Re-P), classified as non-labile-P, represents the most stable portion of the P fraction. There were no significant differences observed in the Re-P content between the biochar-amended foxtail millet, maize, soybean, and mung bean soils compared to the control (Figure 1g).
Total P (TP) and available P (AP) illustrate the total storage of P in the soil and the amount of P available for plant uptake, respectively [27]. There was no significant difference in the TP content of foxtail millet, maize, soybean, and mung bean soils when biochar was added, compared to the control (Figure 1h). The addition of biochar substantially increased the AP content of foxtail millet, maize, soybean, and mung bean soils by 40.61%, 44.69%, 29.29%, and 33.69% (Figure 1i). This indicates that biochar has the potential to enhance the available P content without altering the total P content.

3.2. Effect of Biochar on Soil Organic Acid Fractions of Different Crops

Organic acids can increase the availability of soil P [30]. Gas chromatography-mass spectrometry (GC-MS) was employed to identify and quantify 67 organic acids in soil samples. In the MIC treatment, 38 organic acids were detected, while 40 organic acids were identified in the MIB treatment (Figure 2a). The MAC treatment yielded a total of 41 detected organic acids, and 42 organic acids were identified in the MAB treatment (Figure 2b). This illustrates that biochar addition can enhance the organic acid species in the soil of two cereal crops, maize and foxtail millet. Meanwhile, a total of 39 organic acids were detected in the SOC treatment. A total of 40 organic acids were detected in the SOB treatment, which demonstrates that biochar addition can increase the organic acid species of soybean soil (Figure 2c). In the MUC treatment, a total of 39 organic acids were detected, while 38 organic acids were identified in the MUB treatment (Figure 2d). This suggests that the addition of biochar did not augment the variety of organic acid species in mung bean soil. This may indicate that the phenomenon of biochar increasing the types of organic acids secreted by crops is not universally applicable.
The potential ecological interactions between members of the organic acids were further assessed utilizing the organic acid co-occurrence network. In the CK samples there were 23 edges and 26 nodes, while the B samples exhibited 13 edges and 15 nodes (Figure 3). The co-occurrence network of organic acids following the addition of biochar had fewer edges and nodes compared to the control group; however, the average degree was higher than that of the control (Figure 3). This implies that the interactions between organic acids are more closely related to the addition of biochar. The average path length of the B samples was shorter than that of the control (Figure 3). The network diameter and average clustering coefficient of B samples were larger than that of control (Figure 3). Moreover, node degree is the number of edges connected to that node and highly connected nodes play a central role in the network [31]. In this study, nodes exhibiting a degree greater than five in the organic acid co-occurrence network are classified as core organic acids. The control identified three types of core organic acids: glycolic acid, cinnamic acid, and fumaric acid. The four types of core organic acids in the B samples were citric acid, fumaric acid, malic acid, and 2-ketoglutaric acid, which implies that biochar addition induced an increase in core organic acid species (Figure 3). Additionally, the B samples had fewer edges and points of the organic acid co-occurrence network and had more core organic acid species compared to the control (Figure 3). This is further evidence that the organic acid co-occurrence networks exhibited closer interactions with one another following the addition of biochar.

3.3. Effect of Biochar on the Soil Microbial Community Structure of Different Crops

The Chao1 index in alpha diversity was employed to assess the richness of the microbial community. No significant differences were observed in the Chao1 index between the control and B samples across the various crop soils (Figure 4a). This suggests that biochar addition does not significantly alter the microbial community richness. In addition, Venn diagrams are adopted to represent the intersections and concatenations between treatments. MIC has 77 unique OTUs, MIB has 99 unique OTUs, MAC has 49 unique OTUs, MAB has 31 unique OTUs, SOC has 24 unique OTUs, SOB has 25 unique OTUs, MUC has 19 unique OTUs, and MUB has 23 unique OTUs (Figure 4b).
A microbial co-occurrence network was used to further evaluate the potential ecological interactions among microbial members at the genus level (Figure 4c,d). The number of edges was 635 and the number of points was 533 for CK (Figure 4c,d). The number of edges was 1939 and the number of points was 1649 for the B samples (Figure 4c,d). The addition of biochar resulted in a greater number of edges and nodes in the microbial co-occurrence network compared to the control group (Figure 4c,d). The B samples had a greater average degree, network diameter, and average clustering coefficient than the control (Figure 4c,d). The average path length of the B samples was shorter than that of the control (Figure 4c,d).
Robustness is the resistance of the network to node loss after random removal of the target node [32]. Vulnerability refers to the relative contribution of each node’s susceptibility to the overall system [32]. The robustness of the microbial co-occurrence network was higher than that of the control and the vulnerability was lower than that of the control for B samples (Figure 4e,f).

3.4. Relationship Between Microorganisms and P Fractions After the Addition of Biochar

Network analyses were performed between genus-level microorganisms and P fractions, and the genera screened in the network analyses were defined as P-fraction-associated microorganism [33]. In the control group, five microbial species were linked to the HCl-P fraction, one species was associated with the NaOH-Pi fraction, three species were connected to the NaOH-Po fraction, one species associated with the NaHCO3-Pi fraction, three species were associated with the NaHCO3-Po fraction, and one species was associated with resin-P fraction (Figure 5a). In the B samples, no microorganisms were associated with the HCl-P fraction, one species was associated with the NaOH-Pi fraction, one species was associated with the NaOH-Po fraction, four species were associated with the NaHCO3-Pi fraction, five species were associated with the NaHCO3-Po fraction, and two species were associated with the resin-P fraction (Figure 5b). Therefore, the addition of biochar increased the microorganisms associated with labile-P (NaHCO3-Pi, NaHCO3-Po, and resin-P) and decreased the microorganisms associated with moderate-labile-P and non-labile-P (NaOH-Pi, NaOH-Po, and HCI-P).

3.5. The Potential Response Mechanisms Between Organic Acids, Microbial Communities, and P Fractions

To investigate the relationship between organic acids, microbial communities, and P fractions after the addition of biochar, SEM was employed to analyze the relationships between total organic acid, NMDS1, NMDS2, labile-P, moderate-labile-P, and non-labile-P (Figure 6a,b). In the control, total organic acids could exert a direct and significant influence on non-labile-P (Figure 6a,b). In contrast, in the B samples total organic acids could significantly affect both moderate-labile-P and non-labile-P (Figure 6a,b). In the control, NMDS2 could directly and substantially affect non-labile-P (Figure 6a,b). In B samples, NMDS1 could directly and significantly affect moderate-labile-P and non-labile-P (Figure 6a,b). In the control, total organic acid could directly and substantially influence non-labile-P (Figure 6a,b). In the B samples, total organic acids could indirectly and significantly influence non-labile-P via NMDS1 in addition to directly and significantly affecting non-labile-P (Figure 6a,b).

3.6. Verifying the Promoting Effect of Core Organic Acids on Soil P Availability

To further verify that biochar can promote soil P availability by regulating core organic acids, core organic acids induced by biochar were utilized in soil culture tests. The soil available P content was substantially enhanced by 16.38% in BA samples as compared to C samples (Figure 7a). The alkaline phosphatase content was significantly increased by 39.16% in the BA samples compared to C samples (Figure 7b). The relative abundance of Ensifer, Phaeodactylibacter, TM7a, Elev-16S-1166, RBG-13-54-9, Conexibacter, and KD4-96 genera were substantially higher in BA sample soils compared to in C samples (Figure 7c). Ensifer, Phaeodactylibacter, TM7a, Elev-16S-1166, RBG-13-54-9, Conexibacter, and KD4-96 genera were P-fraction-associated microorganisms following the addition of biochar, which implies that core organic acids induced by biochar can enhance the relative abundance of P-fraction-associated microorganisms (Figure 5).

4. Discussion

4.1. Effect of Biochar on Soil P Availability

The transformation of soil P fractions following biochar addition underscores its capacity to enhance P availability. The results indicate a significant increase in labile P fractions (resin-P, NaHCO3-Pi, and NaHCO3-Po), which are directly available for plant uptake, alongside a decrease in moderate-labile P (NaOH-Pi and NaOH-Po) as well as non-labile P (HCl-P) (Figure 1). For instance, the resin-P fraction increased by 142.78%, 95.27%, 35.99%, and 21.55% in foxtail millet, maize, soybean, and mung bean soils, respectively, indicating the consistent efficacy of biochar across various cropping systems (Figure 1). Moreover, biochar has a unique capacity to interact with soil minerals and this interaction plays a crucial role in enhancing P solubilization [16]. Specifically, biochar’s porous structure and surface functional groups (such as carboxyl and hydroxyl groups) promote the release of P through a combination of mechanisms (Supplementary Figure S1) [15]. Firstly, the acidification effect of biochar is known to enhance the solubility of P, primarily by reducing the formation of insoluble phosphate compounds, such as those bound to iron, aluminum, and calcium [21]. Secondly, biochar’s chelation capacity, where organic acids or other molecules from the biochar interact with metal cations, helps to destabilize metal–phosphate bonds, thereby further increasing the availability of P [34]. This study also demonstrates that biochar does not significantly affect the total P content in the soil, illustrating that its effects are primarily due to the redistribution of existing P fractions rather than the addition of new P sources, which highlights the potential of biochar to enhance the efficiency of P use in soils. By promoting the conversion of moderate-labile-P and non-labile-P fractions into labile-P, biochar application could decrease the reliance on synthetic P fertilizers.

4.2. Reconstruction of Organic Acid and Microbial Networks

Studies have demonstrated that the addition of biochar increased organic acid species in foxtail millet, maize, as well as soybean soils, and yet did not increase organic acid species in mung bean soils, which implies that biochar can increase organic acid species in soil, but this does not apply to all crops (Figure 2). Furthermore, the co-occurrence network of organic acids following the addition of biochar had fewer edges and nodes compared to the control group; nonetheless, the average degree was higher than that of the control (Figure 3), which implies that the interactions between organic acids are more closely related to the addition of biochar [35]. The average path length following the addition of biochar was shorter than that of the control (Figure 3). This finding suggests that the overall connectivity and efficiency of the organic acid co-occurrence network were enhanced with the addition of biochar [36]. The network diameter and average clustering coefficient of the addition of biochar were larger than that of the control (Figure 3), which reveals that the degree of clustering of the organic acid co-occurrence network was greater after the addition of biochar, and the co-occurrence relationship among the nodes was strong [35]. These results imply a closer interaction between different types of organic acids following biochar addition, which could contribute to the enhanced dissolution of insoluble P in the soils of various crops. The addition of biochar decreased the number of edges and points in the organic acid co-occurrence network and increased the number of core organic acid species in the organic acid co-occurrence network (Figure 3). This is further evidence that the organic acid co-occurrence networks demonstrated closer interactions with one another following the addition of biochar.
The addition of biochar increased the number of edges and nodes, average degree, network diameter, and the average clustering coefficient in the microbial co-occurrence network (Figure 4), which indicates a greater degree of clustering in the microbial co-occurrence network and closer interactions between genera following the addition of biochar [35]. The addition of biochar led to a shorter average path length (Figure 4), which demonstrates that the overall connectivity and efficiency of the microbial co-occurrence network were higher after the addition of biochar [36,37]. The degree of clustering within both the microorganism and organic acid networks increased following the addition of biochar (Figure 4). This enhancement may be attributed to the ability of soil organic acid communities to regulate microbial communities.
Organic acids and soil microorganism are two key factors influencing P availability as they directly interact with P fractions through mechanisms such as acidification, chelation, and the secretion of phosphatase enzymes [6,7,38]. Interestingly, the similar clustering trends observed in both the organic acid and microbial networks suggest potential interactions between these two components (Figure 3 and Figure 4). In addition, organic acids, whether produced by plant roots or microorganisms, can affect microbial activity by providing carbon sources and creating microenvironments conducive to microbial growth [6,39]. Conversely, microorganisms can influence organic acid production through metabolic processes, creating a feedback loop that enhances P solubilization. Biochar appears to mediate this interplay by creating a favorable soil environment, characterized by improved aeration, water retention, and redox conditions [14]. Furthermore, the network analysis illustrated that the addition of biochar increased the microorganisms associated with labile-P and decreased the microorganisms associated with moderate-labile-P and non-labile-P (Figure 5), which implies that biochar selectively enhances microbial populations that contribute to the solubilization of P. This may be due to the functional groups of biochar enhancing the activity of a specific class of organic acids that promote the solubilization of insoluble P by modulating microbial activity (Supplementary Figure S1) [40]. This may also be a reason why biochar, being an alkaline material, nevertheless promotes P effectiveness in the soil.

4.3. Drivers of P Solubilization by Biochar

The SEM analysis provides valuable insights into the mechanisms driving P solubilization under biochar conditions. In addition, total organic acids following the addition of biochar had a significant effect on moderate-labile-P and non-labile-P (Figure 6). This may be attributed to the porous structure of biochar, which improves the physical conditions of the soil, thereby promoting the growth of the crop root system and increasing the activity of organic acids secreted by the roots [41]. NMDS1 with the addition of biochar could directly and significantly affect moderate-labile-P and non-labile-P (Figure 6), which may be attributed to the ability of biochar to improve the P-solubilizing capacity of P-solubilizing microorganisms via alterations in soil redox potential, subsequently enhancing the solubilization of insoluble P [34]. The addition of biochar to total organic acids can indirectly and significantly influence non-labile P via NMDS1, in addition to directly and significantly affecting non-labile-P (Figure 6). This suggests that the incorporation of biochar enables organic acids and microorganisms to dissolve insoluble P through multiple pathways.
The role of core organic acids in driving P solubilization was further validated through soil culture experiments. The core organic acids induced by biochar significantly increased the available P content in the soil (Figure 7). This may imply that core organic acids induced by biochar contribute to soil P availability [42,43]. Moreover, the addition of biochar-induced core organic acids significantly increased alkaline phosphatase activity in the soil (Figure 7), which may be attributed to the participation of certain core organic acids in the tricarboxylic acid cycle which enhance the secretion of alkaline phosphatase by microorganisms, subsequently increasing P availability [44,45]. The increased relative abundance of P-fraction-associated microorganisms further supports the hypothesis that biochar-induced organic acids create a conducive environment for microbial activity (Figure 7). The cost of biochar production is approximately 1800 RMB per ton, and in practical agricultural production biochar typically does not require pretreatment. Previous studies have shown that untreated biochar can enhance P availability in soil [15]. However, due to the P inherently present in untreated biochar, it remains unclear whether biochar directly supplies P to the soil or indirectly enhances soil P availability. The objective of this study is to demonstrate that, in addition to directly providing P to the soil, biochar can also indirectly improve soil P availability through its inherent material properties (Supplementary Figure S1). Conventional P fertilizers, when applied to the soil, are largely fixed, resulting in a low efficiency of P uptake by plants. Biochar, through its inherent material properties, can enhance soil P availability, playing an irreplaceable role in agricultural production.

5. Conclusions

In this study, we investigated the mechanism of promoting soil P dissolution by biochar. The results demonstrated that biochar promoted the dissolution of P in the soil, increased P availability, and enhanced the degree of clustering of organic acid and microbial co-occurrence networks. Regarding microorganisms, biochar enhanced the population of labile-P-associated microorganisms. Concerning organic acids, biochar augmented the variety of core organic acids and expanded the biological pathways for the solubilization of insoluble P through organic acids. In addition, core organic acids in soil culture tests can enhance the relative abundance of P-fraction-associated microorganisms while increasing soil P availability. These findings highlight the significant role of biochar in promoting soil P dissolution and offer a novel theoretical foundation for its use in agricultural soil management.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy15051163/s1. Figure S1. Infrared spectrum of biochar.

Author Contributions

Conceptualization, B.F.; methodology, B.F.; data curation, B.F.; writing—original draft, B.F.; formal analysis, B.F.; visualization, L.Z.; supervision, L.Z.; writing—original draft, L.Z.; project administration, F.Y.; visualization, F.Y.; data curation, F.Y.; formal analysis, C.Z.; writing—review and editing, C.Z.; methodology, C.Z.; investigation, C.Z.; resources, Z.L.; methodology, Z.L.; writing—original draft, Z.L; visualization, Z.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially supported by the Construction Project of Double First-Class Initiative in Heilongjiang Province “Green and Low-Carbon of Grain Crops” (LJGXCG2022-107), the Provincial-Academy Technology Cooperation Project in Heilongjiang (YS20B16) and the Training Program for Youth Innovation Talents of Heilongjiang Educational Committee (UNPYSCT-2020042).

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Xue, Y.; Zhuang, Q.; Zhu, S.; Xiao, B.; Liang, C.; Liao, H.; Tian, J. Genome wide transcriptome analysis reveals complex regulatory mechanisms underlying phosphate homeostasis in soybean nodules. Int. J. Mol. Sci. 2018, 19, 2924. [Google Scholar] [CrossRef] [PubMed]
  2. Basinski, J.J.; Bone, S.E.; Klein, A.R.; Thongsomboon, W.; Mitchell, V.; Shukle, J.T.; Druschel, G.K.; Thompson, A.; Aristilde, L. Unraveling iron oxides as abiotic catalysts of organic phosphorus recycling in soil and sediment matrices. Nat. Commun. 2024, 15, 5930. [Google Scholar] [CrossRef]
  3. Fiuza, D.A.F.; Vitorino, L.C.; Souchie, E.L.; Neto, M.R.; Bessa, L.A.; Silva, C.F.d.; Trombela, N.T. Effect of Rhizobacteria Inoculation via Soil and Seeds on Glycine max L. Plants Grown on Soils with Different Cropping History. Microorganisms 2022, 10, 691. [Google Scholar] [CrossRef] [PubMed]
  4. Abdelmigid, H.M.; Morsi, M.M.; Hussien, N.A.; Alyamani, A.A.; Alhuthal, N.A.; Albukhaty, S. Green synthesis of phosphorous-containing hydroxyapatite nanoparticles (nHAP) as a novel nano-fertilizer: Preliminary assessment on pomegranate (Punica granatum L.). Nanomaterials 2022, 12, 1527. [Google Scholar] [CrossRef]
  5. McLaren, T.I.; Smernik, R.J.; McLaughlin, M.J.; McBeath, T.M.; Kirby, J.K.; Simpson, R.J.; Guppy, C.N.; Doolette, A.L.; Richardson, A.E. Complex forms of soil organic phosphorus—A major component of soil phosphorus. Environ. Sci. Technol. 2015, 49, 13238–13245. [Google Scholar] [CrossRef]
  6. Weng, L.; Vega, F.A.; Van Riemsdijk, W.H. Competitive and synergistic effects in pH dependent phosphate adsorption in soils: LCD modeling. Environ. Sci. Technol. 2011, 45, 8420–8428. [Google Scholar] [CrossRef]
  7. Andersson, K.O.; Tighe, M.K.; Guppy, C.N.; Milham, P.J.; McLaren, T.I.; Schefe, C.R.; Lombi, E. XANES demonstrates the release of calcium phosphates from alkaline vertisols to moderately acidified solution. Environ. Sci. Technol. 2016, 50, 4229–4237. [Google Scholar] [CrossRef]
  8. Shulse, C.N.; Chovatia, M.; Agosto, C.; Wang, G.; Hamilton, M.; Deutsch, S.; Yoshikuni, Y.; Blow, M.J. Engineered root bacteria release plant-available phosphate from phytate. Appl. Environ. Microbiol. 2019, 85, e01210–e01219. [Google Scholar] [CrossRef] [PubMed]
  9. Cacace, C.; Rizzello, C.G.; Brunetti, G.; Verni, M.; Cocozza, C. Reuse of wasted bread as soil amendment: Bioprocessing, effects on alkaline soil and escarole (Cichorium endivia) production. Foods 2022, 11, 189. [Google Scholar] [CrossRef]
  10. Teng, Z.; Shao, W.; Zhang, K.; Yu, F.; Huo, Y.; Li, M. Enhanced passivation of lead with immobilized phosphate solubilizing bacteria beads loaded with biochar/nanoscale zero valent iron composite. J. Hazard. Mater. 2020, 384, 121505. [Google Scholar] [CrossRef]
  11. Wang, J.; Lu, X.; Zhang, J.; Wei, G.; Xiong, Y. Regulating soil bacterial diversity, community structure and enzyme activity using residues from golden apple snails. Sci. Rep. 2020, 10, 16302. [Google Scholar] [CrossRef] [PubMed]
  12. Roberts, W.M.; George, T.S.; Stutter, M.I.; Louro, A.; Ali, M.; Haygarth, P.M. Phosphorus leaching from riparian soils with differing management histories under three grass species. J. Environ. Qual. 2020, 49, 74–84. [Google Scholar] [CrossRef] [PubMed]
  13. Nleya, T.; Clay, S.A.; Arinaitwe, U. Poor Emergence of Brassica Species in Saline–Sodic Soil Is Improved by Biochar Addition. Agronomy 2025, 15, 811. [Google Scholar] [CrossRef]
  14. Li, Z.; Qi, X.; Fan, X.; Du, Z.; Hu, C.; Zhao, Z.; Isa, Y.; Liu, Y. Amending the seedling bed of eggplant with biochar can further immobilize Cd in contaminated soils. Sci. Total Environ. 2016, 572, 626–633. [Google Scholar] [CrossRef] [PubMed]
  15. Agegnehu, G.; Bass, A.M.; Nelson, P.N.; Bird, M.I. Benefits of biochar, compost and biochar–compost for soil quality, maize yield and greenhouse gas emissions in a tropical agricultural soil. Sci. Total Environ. 2016, 543, 295–306. [Google Scholar] [CrossRef]
  16. Woolf, D.; Amonette, J.E.; Street-Perrott, F.A.; Lehmann, J.; Joseph, S. Sustainable biochar to mitigate global climate change. Nat. Commun. 2010, 1, 56. [Google Scholar] [CrossRef]
  17. Yu, L.; Yu, M.; Lu, X.; Tang, C.; Liu, X.; Brookes, P.C.; Xu, J. Combined application of biochar and nitrogen fertilizer benefits nitrogen retention in the rhizosphere of soybean by increasing microbial biomass but not altering microbial community structure. Sci. Total Environ. 2018, 640, 1221–1230. [Google Scholar] [CrossRef]
  18. Harter, J.; Krause, H.-M.; Schuettler, S.; Ruser, R.; Fromme, M.; Scholten, T.; Kappler, A.; Behrens, S. Linking N2O emissions from biochar-amended soil to the structure and function of the N-cycling microbial community. ISME J. 2014, 8, 660–674. [Google Scholar] [CrossRef]
  19. Mahmood, M.; Wang, Y.; Ahmed, W.; Mehmood, S.; Ayyoub, A.; Elnahal, A.S.; Li, W.; Zhan, X. Exploring biochar and fishpond sediments potential to change soil phosphorus fractions and availability. Front. Plant Sci. 2023, 14, 1224583. [Google Scholar] [CrossRef]
  20. Wang, K.; Ren, T.; Yan, J.; Lu, Z.; Cong, R.; Li, X.; Lu, J. Soil phosphorus availability alters the effects of straw carbon on microbial mediated phosphorus conversion. Plant Soil 2023, 491, 575–590. [Google Scholar] [CrossRef]
  21. Yang, L.; Wu, Y.; Wang, Y.; An, W.; Jin, J.; Sun, K.; Wang, X. Effects of biochar addition on the abundance, speciation, availability, and leaching loss of soil phosphorus. Sci. Total Environ. 2021, 758, 143657. [Google Scholar] [CrossRef] [PubMed]
  22. Gupta, I.; Singh, R.; Kaushik, A.; Singh, H.P.; Batish, D.R. Comparative investigation of powder and extract of biochar from Broussonetia papyrifera on the growth and eco-physiological attributes of Vigna radiata. Carbon Res. 2024, 3, 31. [Google Scholar] [CrossRef]
  23. Lavecchia, A.; Curci, M.; Jangid, K.; Whitman, W.B.; Ricciuti, P.; Pascazio, S.; Crecchio, C. Microbial 16S gene-based composition of a sorghum cropped rhizosphere soil under different fertilization managements. Biol. Fertil. Soils 2015, 51, 661–672. [Google Scholar] [CrossRef]
  24. Murphy, J.; Riley, J.P. A modified single solution method for the determination of phosphate in natural waters. Anal. Chim. Acta 1962, 27, 31–36. [Google Scholar] [CrossRef]
  25. Wei, Y.; Zhao, Y.; Wang, H.; Lu, Q.; Cao, Z.; Cui, H.; Zhu, L.; Wei, Z. An optimized regulating method for composting phosphorus fractions transformation based on biochar addition and phosphate-solubilizing bacteria inoculation. Bioresour. Technol. 2016, 221, 139–146. [Google Scholar] [CrossRef]
  26. Meng, X.; Pang, H.; Sun, F.; Jin, X.; Wang, B.; Yao, K.; Wang, L.; Hu, Z. Simultaneous 3-nitrophenylhydrazine derivatization strategy of carbonyl, carboxyl and phosphoryl submetabolome for LC-MS/MS-based targeted metabolomics with improved sensitivity and coverage. Anal. Chem. 2021, 93, 10075–10083. [Google Scholar] [CrossRef]
  27. Luo, L.; Ye, H.; Zhang, D.; Gu, J.D.; Deng, O. The dynamics of phosphorus fractions and the factors driving phosphorus cycle in Zoige Plateau peatland soil. Chemosphere 2021, 278, 130501. [Google Scholar] [CrossRef]
  28. Ma, T.; Zhan, Y.; Chen, W.; Xu, S.; Wang, Z.; Tao, Y.; Shi, X.; Sun, B.; Ding, G.; Li, J. Impact of aeration rate on phosphorus conversion and bacterial community dynamics in phosphorus-enriched composting. Bioresour. Technol. 2022, 364, 128016. [Google Scholar] [CrossRef]
  29. Xu, G.; Zhang, Y.; Shao, H.; Sun, J. Pyrolysis temperature affects phosphorus transformation in biochar: Chemical fractionation and 31P NMR analysis. Sci. Total. Environ. 2016, 569, 65–72. [Google Scholar] [CrossRef]
  30. Gargallo-Garriga, A.; Preece, C.; Sardans, J.; Oravec, M.; Urban, O.; Peñuelas, J. Root exudate metabolomes change under drought and show limited capacity for recovery. Sci. Rep. 2018, 8, 12696. [Google Scholar] [CrossRef]
  31. Wu, H.; Gao, T.; Hu, A.; Wang, J. Network Complexity and Stability of Microbes Enhanced by Microplastic Diversity. Environ. Sci. Technol. 2024, 58, 4334–4345. [Google Scholar] [CrossRef]
  32. Yang, F.; Wang, M.; Zhao, L.; Fan, B.; Sun, N.; Liu, J.; Sun, X.; Dong, Z. The role of cattle manure-driven polysaccharide precursors in humus formation during composting of spent mushroom substrate. Front. Microbiol. 2024, 15, 1375808. [Google Scholar] [CrossRef] [PubMed]
  33. Chen, W.; Zhan, Y.; Zhang, X.; Shi, X.; Wang, Z.; Xu, S.; Chang, Y.; Ding, G.; Li, J.; Wei, Y. Influence of carbon-to-phosphorus ratios on phosphorus fractions transformation and bacterial community succession in phosphorus-enriched composting. Bioresour. Technol. 2022, 362, 127786. [Google Scholar] [CrossRef]
  34. Fan, B.; Zhao, C.; Zhao, L.; Wang, M.; Sun, N.; Li, Z.; Yang, F. Biochar application can enhance phosphorus solubilization by strengthening redox properties of humic reducing microorganisms during composting. Bioresour. Technol. 2024, 395, 130329. [Google Scholar] [CrossRef] [PubMed]
  35. Guo, B.; Zhang, L.; Sun, H.; Gao, M.; Yu, N.; Zhang, Q.; Mou, A.; Liu, Y. Microbial co-occurrence network topological properties link with reactor parameters and reveal importance of low-abundance genera. NPJ Biofilms Microbiomes 2022, 8, 3. [Google Scholar] [CrossRef]
  36. Xiang, Q.; Zhu, D.; Qiao, M.; Yang, X.R.; Li, G.; Chen, Q.L.; Zhu, Y.G. Temporal dynamics of soil bacterial network regulate soil resistomes. Environ. Microbiol. 2023, 25, 505–514. [Google Scholar] [CrossRef] [PubMed]
  37. Wang, H.; Wang, Z.; Qin, Q.; Ke, Q.; Chen, L.; Song, X.; Chen, X.; Wu, L.; Cao, J. Successive monoculture of Eucalyptus spp. alters the structure and network connectivity, rather than the assembly pattern of rhizosphere and bulk soil bacteria. Appl. Soil Ecol. 2024, 113, 166–177. [Google Scholar] [CrossRef]
  38. Bai, K.; Wang, W.; Zhang, J.; Yao, P.; Cai, C.; Xie, Z.; Luo, L.; Li, T.; Wang, Z. Effects of phosphorus-solubilizing bacteria and biochar application on phosphorus availability and tomato growth under phosphorus stress. BMC Biol. 2024, 22, 211. [Google Scholar] [CrossRef]
  39. Lu, L.; Qin, W.; Wu, M.; Chen, Q.; Pan, B.; Xing, B. Biochar promotes FePO4 solubilization through modulating organic acids excreted by Talaromyces pinophilus. Carbon Res. 2025, 4, 27. [Google Scholar] [CrossRef]
  40. Wei, Y.; Zhao, Y.; Shi, M.; Cao, Z.; Lu, Q.; Yang, T.; Fan, Y.; Wei, Z. Effect of organic acids production and bacterial community on the possible mechanism of phosphorus solubilization during composting with enriched phosphate-solubilizing bacteria inoculation. Bioresour. Technol. 2018, 247, 190–199. [Google Scholar] [CrossRef]
  41. Osman, A.I.; Fawzy, S.; Farghali, M.; El-Azazy, M.; Elgarahy, A.M.; Fahim, R.A.; Maksoud, M.A.; Ajlan, A.A.; Yousry, M.; Saleem, Y. Biochar for agronomy, animal farming, anaerobic digestion, composting, water treatment, soil remediation, construction, energy storage, and carbon sequestration: A review. Environ. Chem. Lett. 2022, 20, 2385–2485. [Google Scholar] [CrossRef] [PubMed]
  42. Zhu, M.; Lv, X.; Franks, A.E.; Brookes, P.C.; Xu, J.; He, Y. Maize straw biochar addition inhibited pentachlorophenol dechlorination by strengthening the predominant soil reduction processes in flooded soil. J. Hazard. Mater. 2020, 386, 122002. [Google Scholar] [CrossRef] [PubMed]
  43. Sanchez-Hernandez, J.C. Biochar activation with exoenzymes induced by earthworms: A novel functional strategy for soil quality promotion. J. Hazard. Mater. 2018, 350, 136–143. [Google Scholar] [CrossRef] [PubMed]
  44. Silber, A.; Levkovitch, I.; Graber, E. pH-dependent mineral release and surface properties of cornstraw biochar: Agronomic implications. Environ. Sci. Technol. 2010, 44, 9318–9323. [Google Scholar] [CrossRef]
  45. Menezes-Blackburn, D.; Paredes, C.; Zhang, H.; Giles, C.D.; Darch, T.; Stutter, M.; George, T.S.; Shand, C.; Lumsdon, D.; Cooper, P. Organic acids regulation of chemical–microbial phosphorus transformations in soils. Environ. Sci. Technol. 2016, 50, 11521–11531. [Google Scholar] [CrossRef]
Agronomy 15 01163 g001
Figure 1. Effect of biochar on soil P fractions. (a): Resin-P content; (b): NaHCO3-Pi content; (c): NaHCO3-Po content; (d): NaOH-Pi content; (e): NaOH-Po content; (f): HCI-P content; (g): Re-P content; (h): TP content; (i): AP content. Note: CK and B group, respectively, correspond to treatment conditions with 0% or 3% biochar. Re-P represents residual P. TP represents total P. AP represents available P. Values are presented as means ± standard deviations.
Figure 1. Effect of biochar on soil P fractions. (a): Resin-P content; (b): NaHCO3-Pi content; (c): NaHCO3-Po content; (d): NaOH-Pi content; (e): NaOH-Po content; (f): HCI-P content; (g): Re-P content; (h): TP content; (i): AP content. Note: CK and B group, respectively, correspond to treatment conditions with 0% or 3% biochar. Re-P represents residual P. TP represents total P. AP represents available P. Values are presented as means ± standard deviations.
Agronomy 15 01163 g001
Agronomy 15 01163 g002
Figure 2. Effect of biochar on soil organic acid fractions. (a): Organic acid content of MIC and MIB; (b): organic acid content of MAC and MAB; (c): organic acid content of SOC and SOB; (d): organic acid content of MUC and MUB.
Figure 2. Effect of biochar on soil organic acid fractions. (a): Organic acid content of MIC and MIB; (b): organic acid content of MAC and MAB; (c): organic acid content of SOC and SOB; (d): organic acid content of MUC and MUB.
Agronomy 15 01163 g002
Agronomy 15 01163 g003
Figure 3. Organic acid ecological network in CK (a) and B (b) treatment. Note: The CK treatment consisted of MIC, MAC, SOC, and MUC. The B treatment consisted of MIB, MAB, SOB, and MUB. CK and B, respectively, correspond to treatment conditions with 0% or 3% biochar.
Figure 3. Organic acid ecological network in CK (a) and B (b) treatment. Note: The CK treatment consisted of MIC, MAC, SOC, and MUC. The B treatment consisted of MIB, MAB, SOB, and MUB. CK and B, respectively, correspond to treatment conditions with 0% or 3% biochar.
Agronomy 15 01163 g003
Agronomy 15 01163 g004
Figure 4. Effects of biochar on microbial community composition and diversity. (a) Community richness; (b) the quantity difference in common and unique OTUs in different groups; (c) microbial ecological network in CK treatment; (d) microbial ecological network in B treatment; (e) robustness of the network; and (f) vulnerability of the network. Note: CK and B, respectively, correspond to treatment conditions with 0% or 3% biochar.
Figure 4. Effects of biochar on microbial community composition and diversity. (a) Community richness; (b) the quantity difference in common and unique OTUs in different groups; (c) microbial ecological network in CK treatment; (d) microbial ecological network in B treatment; (e) robustness of the network; and (f) vulnerability of the network. Note: CK and B, respectively, correspond to treatment conditions with 0% or 3% biochar.
Agronomy 15 01163 g004
Agronomy 15 01163 g005
Figure 5. Network analysis of microorganism related to P fractions according to Pearson’s correlation (p < 0.05, r2 > 0.80) for CK (a) and B (b) treatments in composting. Red lines represented the significantly positive correlations, while green lines represented the significantly negative correlations.
Figure 5. Network analysis of microorganism related to P fractions according to Pearson’s correlation (p < 0.05, r2 > 0.80) for CK (a) and B (b) treatments in composting. Red lines represented the significantly positive correlations, while green lines represented the significantly negative correlations.
Agronomy 15 01163 g005
Agronomy 15 01163 g006
Figure 6. The structural equation models of CK (a) and B treatment (b), which represented the hypothesized causal relationships among different microbial groups, organic acids, and P fractions. Arrows describe the casual relationship (solid: significant relationship; dotted: nonsignificant relationship). Numbers adjacent to arrow represent path coefficients. Significance level is described: * 0.01 < p < 0.05, ** 0.001 < p < 0.01, *** p < 0.001.
Figure 6. The structural equation models of CK (a) and B treatment (b), which represented the hypothesized causal relationships among different microbial groups, organic acids, and P fractions. Arrows describe the casual relationship (solid: significant relationship; dotted: nonsignificant relationship). Numbers adjacent to arrow represent path coefficients. Significance level is described: * 0.01 < p < 0.05, ** 0.001 < p < 0.01, *** p < 0.001.
Agronomy 15 01163 g006
Agronomy 15 01163 g007
Figure 7. Effect of core organic acids on soil available P, alkaline phosphatase, and P-fraction-associated microorganisms. (a): Available P content; (b): alkaline phosphatase content; (c): relative abundance of P-fraction-associated microorganisms. Note: AP represents available P. ALP represents alkaline phosphatase. Values are presented as means ± standard deviations.
Figure 7. Effect of core organic acids on soil available P, alkaline phosphatase, and P-fraction-associated microorganisms. (a): Available P content; (b): alkaline phosphatase content; (c): relative abundance of P-fraction-associated microorganisms. Note: AP represents available P. ALP represents alkaline phosphatase. Values are presented as means ± standard deviations.
Agronomy 15 01163 g007
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Fan, B.; Zhao, L.; Yang, F.; Zhao, C.; Li, Z. Biochar Promotes Phosphorus Solubilization by Reconstructing Soil Organic Acid and Microorganism Networks. Agronomy 2025, 15, 1163. https://doi.org/10.3390/agronomy15051163

AMA Style

Fan B, Zhao L, Yang F, Zhao C, Li Z. Biochar Promotes Phosphorus Solubilization by Reconstructing Soil Organic Acid and Microorganism Networks. Agronomy. 2025; 15(5):1163. https://doi.org/10.3390/agronomy15051163

Chicago/Turabian Style

Fan, Bowen, Liqin Zhao, Fengjun Yang, Changjiang Zhao, and Zuotong Li. 2025. "Biochar Promotes Phosphorus Solubilization by Reconstructing Soil Organic Acid and Microorganism Networks" Agronomy 15, no. 5: 1163. https://doi.org/10.3390/agronomy15051163

APA Style

Fan, B., Zhao, L., Yang, F., Zhao, C., & Li, Z. (2025). Biochar Promotes Phosphorus Solubilization by Reconstructing Soil Organic Acid and Microorganism Networks. Agronomy, 15(5), 1163. https://doi.org/10.3390/agronomy15051163

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop