Next Article in Journal
Optimization of Flight Mode and Coupling Analysis of Operational Parameters on Droplet Deposition and Drift of Unmanned Aerial Spraying Systems (UASS)
Previous Article in Journal
Synergistic Effect of Mixture of Microsporidium Nosema locustae (Protista: Microsporidia) and Novel Fungus Aspergillus oryzae XJ-1 (Eurotiales: Trichocomaceae) Against Adult Locusta migratoria (Orthoptera: Acrididae) in Laboratory
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Restoring Soil Health: A Study on Effective Microorganisms and Maize Straw Applications

1
College of Desert Control Science and Engineering, Inner Mongolia Agricultural University, Hohhot 010018, China
2
Key Laboratory of Wind and Sand Physics and Sand Control Engineering, Inner Mongolia Autonomous Region, Hohot 010018, China
3
Ordos Wulan Coal (Group) Co., Ltd., Ordos 017000, China
*
Author to whom correspondence should be addressed.
Agronomy 2025, 15(2), 365; https://doi.org/10.3390/agronomy15020365
Submission received: 31 December 2024 / Revised: 25 January 2025 / Accepted: 27 January 2025 / Published: 30 January 2025
(This article belongs to the Section Agricultural Biosystem and Biological Engineering)

Abstract

Soil degradation caused by mining activities has seriously affected the ecological environment of mining areas. Improving the soil quality is the key to solving this problem. This study examined the impact of adding Effective Microorganism (EM) agents and maize straw to the soil from the dump of the Ordos Rongheng open-pit coal mine. We conducted a two-factor complete experiment, varying the amounts of EM agents (0 g·kg−1, 0.1 g·kg−1, 0.2 g·kg−1, 0.3 g·kg−1, and 0.4 g·kg−1) and maize straw (0 g·kg−1, 5 g·kg−1, 10 g·kg−1, 15 g·kg−1, and 20 g·kg−1). Changes in the soil’s physical, chemical, and biological properties were assessed using a six-month-long potting experiment, and a minimum data set was established for soil quality evaluation. Our results indicated that both EM agents and maize straw improved the soil quality. Both additions reduced the soil’s bulk density and pH while increasing its porosity, organic matter, total available nutrients, enzyme activity, and microbial diversity. However, maize straw had no significant effect on the soil moisture content and total available phosphorus, and EM agents did not significantly impact organic matter. The interaction between the two treatments was not significant for soil moisture content, capillary porosity, and total potassium. Finally, we identified five key indicators affecting soil’s quality: the bulk density, available potassium, alkaline phosphatase, bacterial Chao1 index, and fungal Shannon index. The soil quality index (SQI) ranged from 0.158 to 0.568, with the highest SQI being observed with 0.1 g·kg−1 EM agents and 20 g·kg−1 maize straw, which was significantly higher than those from other treatments. New insights into the improvement of soil quality in open-pit mines are provided by these results, which may help guide future ecological restoration of mines.

1. Introduction

China is the world’s largest producer and consumer of coal, which plays a pivotal role in the process of the country’s economic and social development [1]. Coal is China’s main source of energy and has contributed greatly to local economic development, as well as to China’s economic and social development over the years [2]. Mining, especially open-pit coal mining, requires stripping away all the topsoil and rock layers above the coal seams, causing serious damage to the environment, including loss of vegetation, permanent changes in topography, drastic changes in the soil and underground geological structures, and disruption of surface and underground hydrological conditions [3]. The open-pit mining process creates a large number of dumps, generally with a subsoil layer of broken rock and only a soil layer of 40 cm or more above the surface layer, which is then physically compacted by heavy machinery, resulting in a high percentage of rubble, a poor structure, and a lack of soil nutrients. As a result, the physical and chemical properties of the soil at these dumps are poorer than those of the original soil, affecting the living environment of soil microorganisms and lowering the quality of the soil, which is time-consuming and difficult to recover through natural recovery only [4].
Soil is recognized as the foundation of vegetation growth, and the soil conditions after reclamation are directly affected by vegetation recovery [5]. Anthropogenic intervention is recognized as the core of ecological restoration in mining areas at present, and certain ecological and environmental, as well as economic, benefits can be generated by soil improvement in open-pit mining areas [6]. Soil improvement mainly promotes the sustainable ecological recovery of mining areas by increasing the soil’s fertility, improving the soil structure, and enriching microbial functional groups [7]. Maize straw is rich in cellulose, lignin, and hemicellulose, making it an important source of organic fertilization [8]. Used as a soil amendment, maize straw can promote the accumulation of soil organic matter and improve the soil’s structure by reducing its bulk density and increasing its porosity [9]. Ma et al. [10] found that maize straw can improve soil’s physicochemical properties, with soil organic matter being increased by 0.033% per year through continuous observation over three years of field restoration experiments using maize straw. Xia et al. [11] significantly altered the diversity, relative abundance, and function of the soil microbiome through short-term straw return and tillage practices. EM agents, by introducing a variety of microorganisms with the appropriate proportion and a unique fermentation process to mix and cultivate a variety of highly effective composite microbial flora, can rapidly decompose organic matter [12]. Studies have shown that the combination of EM agents and organic fertilizers can reduce the bulk density, increase the soil porosity, improve the water and fertilizer storage performance, and increase the number and activity of beneficial soil microorganisms, thereby improving the crop yield and quality [13]. The decomposition rate of maize straw can be accelerated by mixing it with microbial agents. Sun et al. [14] concluded that the decomposition rate of straw can be significantly increased by adding microbial agents based on a comparison of the effects of different bacterial agents on straw degradation rates.
Soil quality, defined as “the capacity of a soil to function within ecosystem and land-use boundaries to sustain biological productivity, maintain environmental quality, and promote plant and animal health”, has received growing attention in recent decades [15]. EM agents are often used to improve the soil quality, maintain the balance of the inter-root microbial community, and degrade organic matter, and they can significantly accelerate the soil reclamation process [16]. Much of the existing research has been focused on the degradation of maize straw by EM agents and enhancing the quality of arable and farmland soils. However, the soil quality of other types of ecosystems, such as coal mine dumps, in response to the addition of EM agents with maize straw remains unknown. Cerasus humilis (Bunge) Sok is an excellent tree species for soil and water conservation projects and can be closed into forests in a short period of time after afforestation. It also has a fairly high economic value and is an important reference value in the restoration of vegetation in mining areas [17]. Therefore, a 180-day potting experiment of Cerasus humilis (Bunge) Sok was conducted to evaluate the soil quality of an open-pit coal mine dump, and a minimum data set approach was utilized to elucidate the effects of different amendments and dosages on the soil quality of the dumps. The main objectives of this study were to (1) investigate the variation in soil quality in coal mine dumps that occurs in response to the dosage and proportion of the two amendments and (2) determine the best choice of indicators for assessing the soil quality in these dumps. The results of this study have important guiding significance and practical value for the objective and accurate evaluation of soil quality in coal mine dumps that are located in arid and semi-arid areas.

2. Materials and Methods

2.1. Study Description

The study area is located at the junction of Shanxi, Shaanxi, and Mongolia Provinces, belonging to the transition zone from the gully area of the Loess Plateau to the outer edge of the Maowusu Sandland, with the geographic coordinates 38°56′~39°49′ N, 108°58′~110°25′ E. The climate of the region is semi-arid continental in the mesothermal zone, with an average annual precipitation of between 340 and 420 mm. Precipitation is mostly concentrated in July, August, and September, accounting for more than 70% of the total annual precipitation. The average temperature throughout the year is 6.2 °C, with an extreme low of −31.4 °C and an extreme high of 36.6 °C. The zonal soil is mainly dominated by loess and sandy soil, and the average soil cover thickness of the dump is 50 cm, with the soil type of loess, which is overall sticky in texture, poorly permeable, and low in fertility. The initial soil base properties were as follows: soil bulk density: 1.64 g.cm−3; soil pH: 8.71; soil organic matter content: 3.91 g·kg−1; total nitrogen: 0.37 g·kg−1; available nitrogen: 50.32 mg·kg−1; total phosphorus: 0.12 g·kg−1; available phosphorus: 3.47 mg·kg−1; total potassium: 29.1 g·kg−1; and available potassium: 107 mg·kg−1.

2.2. Test Material

Soil at a depth of 0–40 cm was chosen as the test soil sample for the potting experiments because of the large amount of gravel in the soil at a depth of 50 cm. Specifically, using the “S” sampling method (sampling the soil in the shape of the letter “S” in a rectangular dumping ground), soil was taken from 5 points in the dumping ground and mixed well and cleaned of gravel by passing it through a 2 mm sieve. Maize straw was taken from farmers’ houses near the mine and shredded into small sections of about 1 cm. EM agents were purchased from Hohhot Zhongxinli Agricultural Materials Distribution Department. The main ingredients are Bacillus subtilis, Bacillus megaterium, Bacillus licheniformis, bifidobacteria, yeasts, xylomycetes, and other multi-beneficial microbial bacteria. The number of live bacteria was 100 billion/g. Seedlings of Cerasus humilis (Bunge) Sok were purchased from the Ordos Hangjin Banner Ordinary Plum Nursery.

2.3. Experimental Design

The pot experiment lasted for six months, starting on 17 April 2023 and ending on 15 October 2024. According to a completely randomized design (CRD), a two-factor pot experiment of EM agents × maize straw was arranged, in which a certain amount of soil conditioner was added to each kilogram of soil from the mine dump. The dosages of EM agents were A0 (0 g·kg−1), A1 (0. 1 g·kg−1), A2 (0.2 g·kg−1), A3 (0.3 g·kg−1), and A4 (0.4 g·kg−1), and maize straw was used in amounts of B0 (0 g·kg−1), B1 (5 g·kg−1), B2 (10 g·kg−1), B3 (15 g·kg−1), and B4 (20 g·kg−1). The amount of EM agents used referred to the recommended amount of 300–400 kg·ha−1 by the microbial agent company, and the amount of maize straw used referred to the amount of straw that is returned to the field in the northern region of China, which is 30,000 kg·ha−1. Gradients were established according to the two recommended amounts. The experiment was a 2-factor, 5-level complete experiment with a total of 25 treatments and 5 replications per treatment. Specific details are shown in Table 1, where A0B0 is the control group (CK).
The two amendments were mixed thoroughly with 10 kg of soil (dry weight) from the dumps and filled into pots according to the level of each factor. While filling the pots, water was sprinkled to allow the soil in the pots to settle naturally, in order to ensure that the degree of soil compactness in each pot was as consistent as possible. When a pot was filled with soil to 3 cm from the top edge, the soil surface was leveled. Finally, the pots were irrigated at 70% of the field holding capacity of the CK treatment.
Seedlings were planted in the center of the pots, and the roots of the seedlings were sparse. Adequate and timely irrigation was provided after planting, and normal care was provided for 45 days until the seedlings were fully retired, with various care measures and conditions remaining consistent, except for the experimental design factor levels.

2.4. Sample Collection and Observation

2.4.1. Soil Sampling

The experiment was laid out on 17–19 April 2023, and the topsoil of the pots was taken 120 days later using a 100 cm3 cutting knife. Firstly, the fresh weight of the soil was measured, and then, it was put into the ring knife box and brought back to the laboratory to measure the physical properties of the soil. The soil was then divided into two parts: the first part was stored in an ultra-low-temperature refrigerator at −80 °C for soil DNA extraction and sequencing, and the second part was stored in a refrigerator at 4 °C to determine the soil’s chemical properties and enzyme activities.

2.4.2. Physicochemical Soil Analyses

The soil bulk density, soil water content, total porosity, and soil capillary porosity were determined using the drying method [18]. The pH was determined using the potentiometric method with a water–soil ratio of 2.5:1. The soil organic matter was determined by means of external heating with potassium dichromate. Total nitrogen was determined by means of semi-micro-Kjeldahl titration. Total phosphorus and total potassium were determined using sodium hydroxide fusion–molybdenum antimony resistance colorimetry, available nitrogen was determined by means of alkaline dissolution and diffusion, available phosphorus was determined using sodium bicarbonate immersion–molybdenum antimony resistance colorimetry, and available potassium was determined using the ammonium acetate immersion–flame photometric method [19].

2.4.3. Soil Enzyme Activities

The soil’s enzyme activities were determined with reference to the assay method of Guan [20] et al. Soil sucrase was determined using the 3,5-dinitrosalicylic acid colorimetric method, urease was determined using the indophenol blue colorimetric method, and alkaline phosphatase was determined using the disodium benzene phosphate colorimetric method.

2.4.4. Soil Microbial Community Diversity

A soil sample’s DNA was extracted using the OMEGA soil DNA kit (Omega Bio-Tek, Norcross, GA, USA). The soil’s bacterial 16SrRNA was analyzed using the gene primers 338F (5′-barcode+ACTCCTACGGGGAGGCAGCA-3′) and 806R (5′GGACTACHVGGGGT WT CTAAT-3′), and fungal ITS was performed using the gene primers ITS5 (GGAAGT AAAAGTCGTAACAAGG) and ITS2 (GCTGCGTTCTTCATCGATGC). The PCR amplification products were purified and recovered using the AxygenDNA Gel Recovery Kit (Axygen, Hangzhou, China), and the PCR products were quantified and mixed and then sequenced on the Illumina NovaSeq 6000 platform (Illumina, San Diego, CA, USA). Microbial communities were determined by means of Illumina-based sequencing.

2.5. Soil Quality Assessment Methods

2.5.1. Construction of the Minimum Data Set

In the present study, both total and minimum data sets (TDSs and MDSs) were used to select indicators of the soil quality. Nineteen measured soil properties were included in the TDS. A TDS is a collection of indicators that are selected based on all the measured soil properties without rigorous screening, which increases both the collinearity and complexity of the relations between the quality indicators and management options. As a consequence, the number of soil properties must be lessened to an MDS [15]. The MDS was constructed by combining Pearson correlation analysis and principal component analysis with the Norm value. Principal components with eigenvalues ≥1 were taken, and indicators with loadings ≥0.5 on the same principal component were gathered into one group. If the loadings of an evaluation indicator were lower than 0.5 in each principal component, it was classified into the group with the highest loading value. If a soil indicator had factor loadings ≥0.5 in both principal components, a correlation analysis was performed to determine the indicator’s redundancy. We calculated the Norm value of each group of indicators and selected the indicators with Norm values within 10% of the highest value of each group to analyze the correlations between indicators. If the indicators were highly correlated (r > 0.5), the indicator with the largest Norm value was entered into the minimum data set, and if the correlation was low (r < 0.5), they were all entered into the minimum data set [21]. The Norm value was calculated as follows:
N i k = i = 1 k U i k 2 · λ k
where Nik is the combined loading of the ith indicator on the first k (principal components with eigenvalues greater than 1) principal components with eigenvalues ≥1; the loading of the ith indicator on the kth principal component can be determined; and λk is the eigenvalue of the kth principal component.

2.5.2. Soil Quality Assessment

The weights were determined by means of principal component analysis, and the linear score values of the indicators were derived using the normalization function. Then, the soil quality index (SQI-TDS) for the total data set and the soil quality index (SQI-MDS) for the minimum data set were obtained according to the soil quality index formula [22]. The calculation formula is given below:
S Q I = i = 1 k W i · S i
where SQI is the soil quality index, Wi is the weight of the ith soil indicator, Si is the standardized linear score value of the ith soil indicator, and k is the number of participating indicators. Among them, the indicator linear score value is determined by means of the standardization function, and there are generally three types: parabolic, positive S-type, and inverse S-type. In this study, two types were used: S-type and inverse S-type. S-type indicates that more is better, and inverse S-type indicates that less is better.
The S-type affiliation function is defined as follows:
f x = 0.1   0.1                                                     x a   + 0.9 x a b a ¯         a < x < b 1.0                                                       x b
The inverse S-type affiliation function is defined as follows:
f x = 1.0                                                   x a   1 0.9 b x b a ¯           a < x < b 0.1                                                       x b
where f(x) denotes the affiliation value; x denotes the measured value of the indicator; and a and b denote the lower and upper threshold values, respectively.

2.6. Statistical Analysis

The statistical analysis was performed using SPSS 26.0 (SPSS, Inc., Chicago, IL, USA). The effects of EM agents, maize straw, and their interactions on the soil’s physicochemical properties, enzyme activities, microbial community diversity, and quality indicators were analyzed using two-way ANOVA to explore whether there were significant differences among the treatments. The comparison of treatment means was carried out using Tukey’s multiple-pole difference test at the 5% level. A principal component analysis (PCA) was performed using SPSS 26.0 to calculate the weights of selected variables whose SQIs were significantly different among treatments. Principal component analysis is a statistical method that transforms multiple indicators into a small number of composite indicators through dimension reduction. Correlation coefficients were calculated, and the significance was plotted using the “ggcor” and “ggplot2” packages in R software version 4.3.2. We used linear regression analysis to explore the association of SQI-TDS with SQI-MDS. The remaining graphs were plotted using Origin 2021 (Origin Lab Corporation, Northampton, MA, USA).

3. Results

3.1. Effects of Different Ratios of Maize Straw and EM Agents on Soil Properties in Dump

3.1.1. Soil Physical Properties

According to the two-way ANOVAs, EM agents significantly affected the BD, WC, STP (p < 0.001), and SCP (p < 0.01), whereas maize straw significantly affected the soil’s physical indicators, except WC. There was a significant interaction effect of the EM agents and maize straw on the BD (p < 0.01) and STP (p < 0.05) (Table 2) (Figure 1a). There was no significant difference in the BD between the A0, A1, and A2 treatments, but the BD was significantly higher in the A3 and A4 treatments than in A0 (p < 0.05). The response of the BD to the maize straw dosage was different under different EM agent dosages. The BDs in A0 were ranked as follows: B4 = B3 < B2 < B1 < B0. In A1, the BDs in B1, B3, and B4 were significantly lower than in B0, and the best combination treatment (A1B4) exhibited the most significant decrease in the BD, which was lower than that of the A0B0 (CK) treatment (15.2%). In both A2 and A3, the BDs in B3 and B4 were significantly lower than in B0 (p < 0.05). However, in A4, the BD was not significantly different based on different maize straw dosages (Figure 1b). The WCs of the A1, A2, A3, and A4 treatments were significantly higher than that of the A0 treatment (p < 0.05). The WC varied significantly in response to maize straw addition in the A0, A1, and A3 treatment groups, in the following orders: B1 > B0 > B2 > B3 > B4 in A0; B1 > B4 > B3 > B2 > B0 in A1; and B0 > B4 > B1 > B2 > B3 in A3 (Figure 1c). There was no significant difference between the STPs of the A1, A2, and A3 treatments and the A0 treatment, but for the A4 treatment, it was significantly lower than for the A0 treatment (p < 0.05). In both A0, A1, and A3, the STPs in B3 and B4 were significantly higher than in B0, and the best combination treatment (A1B4) exhibited the most significant increase in STP, which was higher than in the A0B0 (CK) treatment (11.9%). In A2, the STP in B3 was significantly higher than in B0. In A4, the STP was not significantly different based on the addition of maize straw (Figure 1d). There was no significant difference between the SCPs of A4 and A0 treatments, but those of the A1, A2, and A3 treatments were significantly higher than that of the A0 treatment (p < 0.05). Maize straw significantly increased the SCP. In both A0, A1, A3, and A4, the SCP in B4 was significantly higher than in B0, but not in A2.

3.1.2. Soil Chemical Properties

According to the two-way ANOVAs, EM agents significantly (p < 0.01) affected the soil’s chemical indicators, except SOM, whereas maize straw significantly (p < 0.05) affected the soil’s chemical indicators except TP, and a significant (p < 0.05) interaction was observed for the soil’s chemical indicators, except TK (Table 2) (Figure 2a). There was no significant difference between the SOM of the A1, A3, and A4 treatments and the A0 treatment, but the SOM of the A2 treatment was significantly higher than that of the A0 treatment (p < 0.05). The response of the SOM to the maize straw dosage was different under different EM agent dosages. The SOM contents of the B2, B3, and B4 maize straw treatments were significantly higher than that of the B0 treatment under the A0, A1, and A2 EM agent dosages (p < 0.05). In A3, the SOM in B4 was significantly higher than in B0, and the best combination treatment (A3B4) exhibited the most significant increase in SOM, which was higher than in the A0B0 (CK) treatment (86.9%). However, in A4, the SOM was not significantly different depending on the maize straw dosage (Figure 2b). There was no significant difference between the pH values of the A1 and A0 treatments, but the A2, A3, and A4 treatments had significantly lower pH values than the A0 treatment (p < 0.05). The addition of maize straw significantly decreased the soil’s pH: the soil’s pH in B4 was significantly higher than in B0, and the best combination treatment (A2B4) exhibited the most significant decrease in pH, which was lower than in the A0B0 (CK) treatment (8.7%) (Figure 2c). There was no significant difference between the TN contents of the A1 and A4 treatments and that of the A0 treatment, but in the A2 and A3 treatments, they were significantly higher than in the A0 treatment (p < 0.05). The response of the TN contents to the maize straw dosage was different under different EM agent dosages. The TN contents of the B3 and B4 maize straw treatments were significantly higher than that of the B0 treatment with A0, A1, and A3 EM agent dosages (p < 0.05). In A2, the TN in B2 was significantly higher than in B0, and the best combination treatment (A2B2) exhibited the most significant increase in TN, which was higher than in the A0B0 (CK) treatment (173.0%). There was no significant difference in the soil’s TN contents following different treatments in A4 (Figure 2d). There was no significant difference in the AN contents between the A2 and A0 treatments, but in the A1, A3, and A4 treatments, they were significantly higher than in the A0 treatment (p < 0.05). The response of the AN contents to the maize straw dosage was different under different EM agent dosages. Under A1 and A3 EM agent dosages, the AN concentrations of the B2, B3, and B4 treatments were significantly higher than that of the B0 treatment (p < 0.05), and the best combination treatment (A1B4) exhibited the most significant increase in AN, which was higher than in the A0B0 (CK) treatment (158.5%) (Figure 2e). There was no significant difference between the TP contents of the A1 and A2 treatments and the A0 treatment, but those of the A3 and A4 treatments were significantly higher than that of the A0 treatment (p < 0.05). The response of the TP contents to the maize straw dosage was different under different EM agent dosages. In A2 and A3, there were no significant differences in the soil’s TP contents between the different maize straw dosage treatments using the A0 and A1 EM agents, but the B4 treatment led to higher TP contents than the B0 treatment (p < 0.05). In A3, the best combination treatment (A3B4) exhibited the most significant increase in TP, which was higher than in the A0B0 (CK) treatment (43.3%) (Figure 2f). There was no significant difference in the AP contents between the A1 and A0 treatments, but the A2, A3, and A4 treatments had significantly higher AP contents than A0 (p < 0.05). The response of the AP contents to the maize straw dosage was different under different EM agent dosages. Under A2 and A3 EM agent dosages, the AP concentrations of the B2, B3, and B4 treatments were significantly higher than that of the B0 treatment (p < 0.05). In A4, the best combination treatment (A4B4) exhibited the most significant increase in AP, which was higher than in the A0B0 (CK) treatment (341.4%) (Figure 2g). There was no significant difference in the TK contents between the A2 and A0 treatments, which were significantly higher in the A1 treatment but significantly lower in the A3 and A4 treatments (p < 0.05). The response of the TK contents to the maize straw dosage was different under different EM agent dosages. There was no significant difference in the soil’s TK contents following the different treatments with A1, A3, and A4 EM agent dosages, although the TK content of the B3 treatment was higher than that in the B0 treatment with A0 and A2 (p < 0.05) (Figure 2h). There was no significant difference in the AK contents between the A3, A4, and A0 treatments, but those of the A1 and A2 treatments were significantly higher than those of A0 (p < 0.05). The response of the AK contents to the maize straw dosage was different under different EM agent dosages. For the A0, A1, A2, and A3 EM agent dosages, the AK concentrations of the B3 and B4 treatments were significantly higher than those of the B0 treatment (p < 0.05), and the best combination treatment (A1B4) exhibited the most significant increase in AK, which was higher than in the A0B0 (CK) treatment (194.1%).

3.1.3. Soil Biological Properties

The soil’s biological properties were significantly affected by EM agents, maize straw, and their interaction (p < 0.001, Table 2) (Figure 3a). There were significant differences in the soil SU activities between the A1, A2, A3, and A4 treatments, and all of them were significantly higher than that of the A0 treatment. The soil’s SU activity responded differently to the maize straw dosage at different EM agent dosages. The soil SU activities of the B2, B3, and B4 treatments were higher than that of the B0 treatment with A0 and A4 EM agent dosages, and those of the B1, B2, B3, and B4 treatments were higher than that of the B0 treatment with A1, A2, and A3 EM agent dosages (p < 0.05). In A3, the best combination treatment (A3B4) exhibited the most significant increase in SU activity, which was higher than in the A0B0 (CK) treatment (565.0%) (Figure 3b). There was no significant difference in the soil UR activities between the A2, A3, A4, and A0 treatments, but the SU activity of the A1 treatment was significantly higher than that of the A0 (p < 0.05). The soil UR activity responded differently to the maize straw dosage under different EM agent dosages. As the amount of maize straw increased, an increase in the activity of UR was also observed. The soil UR activities of the B1, B2, B3, and B4 treatments were higher than that of the B0 treatment with A1, A2, and A4 EM agent dosages (p < 0.05). The best combination treatment (A4B4) increased the UR activity by 29.7% compared with the A0B0 (CK) treatment (Figure 3c). There was no significant difference in the soil ALP activities between the A4 and A0 treatments, but the activities of the A1, A2, and A3 treatments were significantly lower than that of A0 (p < 0.05). The soil’s ALP activity responded differently to the maize straw dosage under different EM agent dosages. The soil ALP activities of the B1, B2, B3, and B4 treatments were higher than those of the B0 treatment with A0 and A3 EM agent dosages (p < 0.05). The best combination treatment (A4B4) exhibited the most significant increase in ALP activity, which was higher than in the A0B0 (CK) treatment (72.0%) (Figure 3d). The soil’s BCI was significantly higher in the A0 treatment than in the A1, A2, A3, and A4 treatments, and there was no significant difference between the A1 and A2 treatments; however, it was significantly higher than in the A4 treatment. The soil’s BCI responded differently to the maize straw dosage under different EM agent dosages. There was no significant difference in the soil BCIs of different treatments with an A1 EM agent dosage. However, the soil BCIs of the B1, B2, B3, and B4 treatments were higher than those of the B0 treatment with an A0 EM agent dosage (p < 0.05). The best combination treatment (A0B4) exhibited the most significant increase in BCI, which was higher than in the A0B0 (CK) treatment (67.1%) (Figure 3e). The soil’s BSI was significantly higher in the A0 treatment than in the A1, A2, A3, and A4 treatments, and there was no significant difference between the A2 and A3 treatments; however, it was significantly higher than in the A1 and A4 treatments. The soil’s BSI responded differently to the maize straw dosage under different EM agent dosages. The soil BSIs of the B1, B2, and B4 treatments were higher than that of the B0 treatment with A0 and A3 EM agent dosages, and those of the B2 and B3 treatments were lower than that of the B0 treatment with A1 and A2 EM agent dosages (p < 0.05). The best combination treatment (A1B0) increased the BSI by 11.9% compared with the A0B0 (CK) treatment (Figure 3f). The soil’s BSI was not significantly different between the A0 treatment and the A1 and A2 treatments, but it was significantly higher in the A3 and A4 treatments than in the A0 treatment. The soil’s FCI responded differently to the maize straw dosage under different EM agent dosages. The soil FCIs of the B1, B2, B3, and B4 treatments were higher than that of the B0 treatment with an A0 EM agent dosage, and those of the B2, B3, and B4 treatments were higher than that of the B0 treatment with an A2 EM agent dosage (p < 0.05). The best combination treatment (A3B1) increased the BSI by 191.9% compared with the A0B0 (CK) treatment (Figure 3g). The soil’s FSI was significantly lower in the A0 treatment than in the A1, A2, A3, and A4 treatments, but there were no significant differences between the A1, A2, A3, and A4 treatments. The soil’s FSI responded differently to the maize straw dosage at different EM agent dosages. The soil FSIs of the B1, B2, B3, and B4 treatments were higher than those of the B0 treatment with A0, A3, and A4 EM agent dosages (p < 0.05). The best combination treatment (A2B1) increased the BSI by 68.2% compared with the A0B0 (CK) treatment.

3.2. Establishment of a Minimum Data Set for Soil Quality Evaluation

A total of 19 soil physicochemical–biological indicators were selected to construct a full data set for the principal component analysis. KMO (Kaiser–Meyer–Olkin) sampling and a Bartlett sphericity test were carried out before the analysis, and the results are shown in Table 3: KMO = 0.536 > 0, significance < 0.001. These results indicated that a principal component analysis could be carried out based on the selected indicators.
As shown by the principal component analysis (Table 4), five principal components had eigenvalues greater than 1, and the cumulative variance contribution rate was 78.329%, indicating that these five principal components had a high explanatory power. Based on the Pearson analysis (Figure 4), we compared the correlation coefficients among the indicators according to the group division method and calculated the Norm value. In the first group, AK had the highest Norm value, and the Norm values of SOM, TN, STP, and SCP were in the range of 90% of the highest value; however, they all had correlation coefficients above 0.5 with AK. Therefore, AK was entered into the minimum data set (MDS); in the second group, BD had the highest Norm value and was entered into the MDS; in the third group, BCI had the highest Norm value and was entered into the MDS; in the fourth group, FSI had the highest Norm value and was therefore entered into the MDS; and in the fifth group, ALP had the highest Norm value. Finally, the five soil indicators—AK, BD, BCI, FSI, and ALP—constituted the MDS for evaluating the soil quality assessment of the dumps.
The MDS was selected, and a principal component analysis was performed to obtain the common factor variance of each indicator and specify the weight values of each indicator. The common factor variance and weight values for the TDS and MDS are shown in Table 5: in the TDS, BCI (0.062) > AK (0.061) = ALP (0.061) > BD (0.060) > FSI (0.053); and in the MDS, the order of magnitude of the weights was AK (0.266) > BCI (0.251) > BD (0.235) > FSI (0.142) > ALP (0.106). Soil quality indices (SQIs) were calculated for the TDS and MDS. The two indicators—bulk density and pH—used the inverse S-type affiliation function, and the rest of the indices used the S-type affiliation function. The soil quality indices (TDS-SQIs) of the total data sets ranged from 0.309 to 0.743, with a mean value of 0.518; the soil quality indices (MDS-SQIs) of the minimum data sets ranged from 0.158 to 0.568, with a mean value of 0.413. The linear regression analysis of the TDS and MDS (Figure 5) showed that the TDS-SQI and MDS-SQI were significantly positively correlated (R2 = 0.71914, p < 0.001), and the regression equation was y = 0.77243x + 0.19979. This suggests that the created MDS is a good proxy for the TDS metrics and is well represented.
The SQI of the pots after adding EM agents and maize straw was calculated using the MDS, and the SQI of each treatment is shown in Figure 6. EM agents (F = 3.153; p < 0.05) and maize straw (F = 101.226; p < 0.001) both had a significant effect on the SQI, and the effect of their interaction (F = 9.44; p < 0.001) on the soil quality was also significant. The soil quality indices ranged from 0.231 to 0.538. The highest SQI was found in A2 (0.429), followed by A0 (0.420), A3 (0.410), A1 (0.407), and A4 (0.397) in that order. Averaged across maize straw treatments, the ranking of the SQIs was B4(0.488) > B3(0.449) > B2(0.440) > B1(0.378) > B0(0.308), although the SQI responded differently to maize straw treatments in A0, A1, A2, A3, and A4. Notably, the SQIs of the B1, B2, B3, and B4 treatments were higher than that of the B0 treatment with A0 and A3 EM agent dosages, and those of the B2, B3, and B4 treatments were higher than that of the B0 treatment with A1 and A2 EM agent dosages (p < 0.05, Figure 6). The SQI of the best combination treatment (A1B4, 0.538) increased by 152.6% compared with that of the A0B0 (CK) treatment (0.213).

4. Discussion

The results of a significant number of studies have shown that maize straw can improve soil’s structure, reduce the bulk density, increase the soil porosity and organic matter content, and enhance the diversity of soil microorganisms when it is applied to the soil as a soil conditioner [23,24]. EM agents used as a soil amendment can improve soil’s physicochemical properties, increase its enzyme activity, improve its microbial diversity, and change the composition of its microbial community [12]. This study showed that the addition of EM agents with maize straw significantly reduced the BD and increased the STP and SCP. At different EM agent dosages, a maize straw dosage of 20 g·kg−1 resulted in a lower bulk density and higher total soil porosity and capillary porosity. This result may be due to the decomposition of straw producing a large amount of cellulose, hemicellulose, lignin, and other macromolecular substances. With the addition of EM agents, a large number of microorganisms multiply, and their secretions and metabolites are conducive to the formation of a granular soil structure, while the porosity increases and the bulk density decreases [25,26]. However, only the addition of EM agents had a significant effect on the WC, while maize straw addition and the interaction between the maize straw and EM agents did not have a significant effect on the WC. This may be due to the fact that the initial decomposition of maize straw requires the consumption of a large amount of water in the soil, but when a significant amount of maize straw decomposes, the water will be returned to the soil. This will lead overall to a decreasing and then increasing trend, but the addition of a fungus will accelerate the decomposition of the straw, affecting the progress of the water being returned to the soil, which will lead to irregular and inconsistent soil moisture changes [9]. In this study, the pH, TN, AN, AP, and AK were significantly affected by different dosages of EM agents, maize straw, and their interactions; the SOM was not significantly affected by the EM agents, TP was not significantly affected by the maize straw, and TK was not significantly affected by the interactions. Under different EM agent dosages, maize straw dosages of 10 g·kg−1, 15 g·kg−1, and 20 g·kg−1 led to a lower pH and higher SOM, TN, AN, AP, and AK contents, with the optimal combinations of these six indicators corresponding to A2B4, A3B4, A2B2, A1B4, A4B4, and A1B4, respectively. This was in general agreement with the findings of Yang et al. and Hu [27,28]. On the one hand, maize straw is a carbon-rich energy source, containing a large amount of nitrogen, phosphorus, potassium, and other nutrients that are required for crop growth [29]; on the other hand, the microorganisms in the EM agents, through the decomposition of effective nutrients in the soil, participate in phosphorus solubilization, potassium solubilization, and nitrogen fixation; promote the release of trace elements in the soil and chelating; and enhance the process of soil nutrient cycling. The soil did show an activation effect [9].
Biological indicators are very sensitive to changes in the soil and are important indicators of soil fertility [30]. ALPs are a group of enzymes that catalyze the hydrolysis of phosphate ester or phosphoric anhydride, accelerate the rate of soil organic phosphorus dephosphorylation, and improve the effectiveness of soil phosphorus, and their activity is an important indicator reflecting the biotransformation of soil phosphorus. UR can promote the conversion of urea and the hydrolysis of peptide bonds in the molecules of organic matter, and its activity reflects the supply of soil nitrogen and the capability of nutrient conversion [25], while the magnitude of SU activity reflects the relationship between the accumulation of soil organic carbon and its decomposition and transformation [31]. In this study, ALP, SU, and UR activities were significantly affected by different dosages of EM agents, maize straw, and their interaction. At different EM agent dosages, the SU, UR, and ALP activities were higher at 20 g·kg−1 of maize straw, and the optimal combinations corresponding to these three indicators were A3B4, A4B4, and A4B4, respectively. This result was consistent with the findings of Shan et al. [32], which may be because the mixture of EM agents with maize straw accelerated the decomposition of the straw, and the organic acids that were produced by the decomposition of the straw provided C and N sources for the microorganisms, which then accelerated the mineralization of the microorganisms and the activity of the soil enzymes [33,34]. The microbial diversity index is an important index for evaluating the richness and diversity of soil microbial communities; the Chao1 index characterizes the richness of microbial communities, as the larger its value is, the greater the number of species is; and the Shannon index characterizes the diversity of microbial communities: the larger its value is, the greater the richness and uniformity of species are [35]. In this study, with the increase in maize straw, the bacterial Chao1, bacterial Shannon, fungal Chao1, and fungal Shannon indices increased significantly, but with the increase in EM agents, the bacterial Chao1 and bacterial Shannon indices decreased significantly. This may be due to two aspects: on the one hand, the addition of EM agents and maize straw to the soil increased the soil’s stability, improved its structure, raised the level of its aggregate structure, and enriched its carbon source, thus creating good conditions for microbial growth [36]; on the other hand, with an increase in the dosage of EM agents and maize straw, the community structure of microorganisms changed, and some species became dominant and dominated, which inhibited the growth of other species, thus leading to a decrease in the diversity and richness of bacterial species.
Soil amelioration of open-pit mine dumps can improve the soil’s properties and quality and, at the same time, lay a solid foundation for ecological restoration of the mining area. The soil quality index method is a widely used quantitative soil quality evaluation method [37], and its advantage is that it can fully consider the joint influence of the measured values of evaluation indices, weights, and interactions between indices on the evaluation results. Therefore, this study used this method, and at the same time, we used principal component analysis combined with the Norm value to carry out the screening of the minimum data set (MDS) to the maximum extent to avoid the loss of information on evaluation indicators for other principal components. In this study, a total of five indicators were screened for the MDS, which we established at the dumps, namely, the physical indicator of bulk density, the chemical indicator of available potassium, the biological indicator of alkaline phosphatase, the bacterial Chao1 index, and the fungal Shannon index, which reflect the physicochemical and biological properties of the soil as a whole. It has been shown [38] that the bulk density is the first physical indicator in the top three chemical indicators of the frequency of use of available potassium, which is consistent with the results of most previous studies and has a good representation [39,40,41]. In this study, it was also found that the ALP and soil microbial diversity index, as the core indicators, had a significant impact on the evaluation of the soil quality of the dumps. The soil quality index (SQI) under all the treatments in this study ranged from 0.158 to 0.568. Under the same EM agent dosage, the SQI also increased significantly with an increasing maize straw dosage, with the A1B4 treatment having the highest SQI. This means that the highest dose of maize straw is required to improve the soil quality, but the lowest dose of EM agents is sufficient, thus reducing the cost of soil reclamation at mine dumps. Many beneficial microbial agents require adequate sources of carbon and nitrogen to grow, so the input of carbon and nitrogen sources is critical to ensure proper functioning of beneficial microorganisms. Conveniently, maize straw provides a large amount of carbon and nitrogen sources to meet the growth needs of beneficial microorganisms [42]. Of all the indicators in the MDS that we established in this study, the importance of available potassium and bulk density is widely agreed upon in previous related studies, while the soil bacterial Chao1 and fungal Shannon indices are presented as the core indices for enhancing the soil quality of the dumps of the Ordos open-pit mining area and even for enabling agricultural production, which represents a new direction of thinking.
This study has the following shortcomings: The study was located in a semi-arid area with loess and sandy soils, and it is recommended to repeat the experiment under different climatic and soil conditions. In addition, the study focused on the change in soil properties after improvement and the evaluation of the soil’s quality and did not include indicators relating to plant growth; therefore, it is recommended to correlate the relevant soil indicators with plant growth indicators.

5. Conclusions

(1)
Both Effective Microorganism (EM) agents and maize straw improved the soil properties of the dump, significantly reducing the bulk density and increasing the soil’s porosity, nutrients, enzyme activity, and microbial diversity index. The best straw dosage was the one used in the B4 treatment (maize straw dosage: 20 g·kg−1; conversion: 13.5 t·ha−1).
(2)
In this study, a minimum data set for soil quality evaluation was constructed by means of correlation analysis and principal component analysis of 19 selected physicochemical and biological indicators for the soil. Five indicators—the bulk density, available potassium, alkaline phosphatase, bacterial Chao1 index, and fungal Shannon index—were screened by combining them with the Norm value. There was a significant positive correlation between the soil quality indices (SQIs) that were calculated from different data sets, which indicated that the screened minimum data set could be a good alternative to the total data set for evaluating the soil quality of the dumps of the open-pit mining area.
(3)
Both Effective Microorganism agents, maize straw, and their interaction had significant effects on the soil quality index (SQI), with the A1B4 treatment (Effective Microorganism agents dosage: 0.1 g·kg−1; maize straw dosage: 20 g·kg−1; conversion: Effective Microorganisms 67.5 kg·ha−1, maize straw 13.5 t·ha−1) achieving the highest SQI, which was 152.6% higher than that of the A0B0 (CK) treatment.
(4)
Through potting experiments, the two soil conditioners were found to promote each other and produce positive effects for soil reclamation in mining areas. However, field trials are required to validate the results of this study. Furthermore, it is necessary to consider the long-term sustainability of the study, taking the growth conditions and fruit yields of Cerasus humilis (Bunge) Sok into account.

Author Contributions

Conceptualization, Q.Z. and S.C.; methodology, Q.Z. and S.C.; software, Q.Z. and L.S.; validation, Q.Z., S.C. and M.Y.; investigation, Q.Z., S.C. and T.L.; resources, S.C. and Z.J.; data curation, Q.Z. and S.C.; writing—original draft preparation, Q.Z. and S.C.; writing—review and editing, Q.Z. and S.C.; visualization, Q.Z.; project administration, S.C.; funding acquisition, S.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Research and Demonstration of Key Technologies for Efficient Vegetation Construction in Surface Mining Discharge Sites [2022EEDSKJZDZX012].

Data Availability Statement

All the data supporting the conclusions of this article are included in the article.

Acknowledgments

We appreciate the editors and anonymous reviewers for their constructive comments on this manuscript.

Conflicts of Interest

Author Zhi Jia was employed by the company Ordos Wulan Coal (Group) Co., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Zhen, Q.; Ma, W.M.; Li, M.M.; He, H.H.; Zhang, X.C.; Wang, Y. Effects of vegetation and physicochemical properties on solute transport in reclaimed soil at an opencast coal mine site on the Loess Plateau, China. Catena 2015, 133, 403–411. [Google Scholar] [CrossRef]
  2. Lei, H.; Peng, Z.; Yigang, H.; Yang, Z. Vegetation and soil restoration in refuse dumps from open pit coal mines. Ecol. Eng. 2016, 94, 638–646. [Google Scholar] [CrossRef]
  3. Li, X.; Bi, Y.L.; Du, S.Z.; Wang, Y.; Guo, C. Effects of re-vegetation type and arbuscular mycorrhizal fungal inoculation on soil enzyme activities and microbial biomass in coal mining subsidence areas of Northern China. Catena 2019, 177, 202–209. [Google Scholar] [CrossRef]
  4. Liu, J.; Zhang, S.W.; Song, G.F.; Wang, Y.; Zhu, Y.F.; Lu, S.J.; Lan, M.; Xia, S.S. Bacterial community structure of reclaimed soil and its relationship with soil fertility. Trans. Chin. Soc. Agric. Eng. Trans. CSAE 2021, 37, 124–133. [Google Scholar] [CrossRef]
  5. Kuang, X.Y.; Cao, Y.G.; Luo, G.B.; Li, S.Z.; Bai, Z.K. Analysis of biomass differences in Melilotus suaveolens Ledeb. based on different ratios of reconstructed soil materials. J. Agric. Resour. Environ. 2019, 36, 453–461. [Google Scholar]
  6. Hou, D.Y.; Ding, Z.Y.; Li, G.H.; Wu, L.H.; Hu, P.J.; Guo, G.L.; Wang, X.R.; Ma, Y.; O’Connor, D.; Wang, X.H. A sustainability assessment framework for agricultural land remediation in China. Land Degrad. Dev. 2018, 29, 1005–1018. [Google Scholar] [CrossRef]
  7. Bi, Y.L.; Guo, C.; Wang, K. Research progress of biological improvement of reclaimed soil in coal mining area. Coal Sci. Technol. 2020, 48, 52–59. [Google Scholar]
  8. Zhang, L.; Hou, K.; Zhang, Q.; He, S.F.; Long, G.L.; Yin, L.C.; Zhu, H.M.; Tian, C.; Luo, G.W.; Rong, X.M.; et al. Partial substitution of chemical fertilizers with maize straw: Seeking long-term improvement of rice yield by raising quality indicators of a red paddy soil. Land Degrad. Dev. 2022, 33, 3748–3760. [Google Scholar] [CrossRef]
  9. Rong, Y. The Study on the Formulation, Application Method and Mechanism of Sponge-Nutrient Soil in the Western Opencast Mining Areas. Ph.D Thesis, University of Mining & Technology, Beijing, China, 2018. [Google Scholar]
  10. Ma, Y.L.; Shi, H.K.; Zhang, S.K.; Lv, R.H. Whole maize straw addition: The changes of soil physical and chemical properties and the effect on winter wheat. J. China Agric. Univ. 2003, 8 (Suppl. S1), 42–46. [Google Scholar]
  11. Xia, X.Y.; Zhang, P.P.; He, L.L.; Gao, X.X.; Li, W.J.; Zhou, Y.Y.; Li, Z.X.; Li, H.; Yang, L. Effects of tillage managements and maize straw returning on soil microbiome using 16S rDNA sequencing. J. Integr. Plant Biol. 2019, 61, 765–777. [Google Scholar] [CrossRef]
  12. Mao, Y.N. Effects of EM on Microbial Diversity and Activity in Rhizosphere Soil of Bletilla striata. Master’s Thesis, Shaanxi University of Technology, Hanzhong, China, 2019. [Google Scholar]
  13. Fan, S.; Li, Z.; Xu, Q.; Sun, Q.; Lu, Y.; Sha, C.; Zheng, J. Effects of mixed application of biochar, EM bacteria organic fertilizer and chemical fertilizer on soil fertility, tree growth and fruit quality in peach orchard. Soil Fertil. Sci. China 2022, 11, 77–82. [Google Scholar] [CrossRef]
  14. Sun, C.H.; Chen, L.Y.; Chen, J.; Gun, L.L.; Ao, J.; Wang, Z.X. Effect of Microbial Preparation on the Degradation and Number of Microbiology of the Straw. J. Microbiol. 2023, 43, 84–89. [Google Scholar] [CrossRef]
  15. Zhao, W.; Huang, L.M. Deciphering spatial variability and dominant controls of soil quality under four types of grassland along a southeast-northwest transect in Tibet, southwestern China. Catena 2024, 243, 108221. [Google Scholar] [CrossRef]
  16. Lu, Z.J.; Wang, H.S.; Wang, Z.X.; Liu, J.Z.; Li, Y.T.; Xia, L.; Song, S.X. Critical steps in the restoration of coal mine soils: Microbial-accelerated soil reconstruction. J. Environ. Manag. 2024, 368, 122200. [Google Scholar] [CrossRef] [PubMed]
  17. Dong, X.H.; Liu, L.; Li, J.F.; Du, J.F.; Wang, P.F.; Zhang, J.C. Soil and Water Conservation Function of Cerasus Humilis in Hilly-gully Region of Loess Plateau. Bull. Soil Water Conserv. 2016, 36, 242–247. [Google Scholar] [CrossRef]
  18. Cha, T. Determination of soil physical properties. In Physical and Chemical Analysis of Soil; China Forestry Publishing House: Beijing, China, 2017; pp. 27–56. [Google Scholar]
  19. Bao, S. Soil and Agricultural Chemistry Analysis, 3rd ed.; China Agriculture Press: Beijing, China, 2000; pp. 25–114. [Google Scholar]
  20. Guan, S. Soil Enzymes and Their Research Methodologies, 1st ed.; China Agriculture Press: Beijing, China, 1986; pp. 274–331. [Google Scholar]
  21. Jin, H.F.; Shi, D.M.; Chen, Z.F.; Liu, Y.J.; Lou, Y.B.; Yang, X. Evaluation indicators of cultivated layer soil quality for red soil slope farmland based on cluster and PCA analysis. Trans. Chin. Soc. Agric. Eng. Trans. CSAE 2018, 34, 155–164. [Google Scholar] [CrossRef]
  22. Yuan, Y.; Wang, H.; Luo, Y.; Sui, P.X.; Li, R.P.; Zheng, H.B.; Piao, J.; Liu, W.R.; Zheng, J.Y. Evaluation of Tillage Practices on the Soil Quality of Black Soil Farmland Based on the Minimum Data Set. J. Maize Sci. 2023, 31, 148–157. [Google Scholar] [CrossRef]
  23. Mei, N.; Liu, L.; Sui, P.X.; Zhang, W.K.; Tian, P.; Wang, F.; Su, S.H.; Wang, M.J.; Meng, G.X.; Qi, H. Effects of Tillage and Straw Management on Brown Soil Physical and Chemical Properties and Maize Yield. J. Maize Sci. 2017, 25, 87–94. [Google Scholar] [CrossRef]
  24. Shen, Y.; Chen, H. The Progress of Study on Soil Improvement Research with Straw Stalk. Chin. Agric. Sci. Bull. 2009, 25, 291–294. [Google Scholar]
  25. Wang, W.; Liu, G.; Wang, Z. Screening of maize stover degradation complex strains and fermentation to produce short chain fatty acids. Hubei Agric. Sci. 2024, 63, 55–58. [Google Scholar] [CrossRef]
  26. Zhang, Z.G.; Dong, C.J.; Gao, P.; Shang, Q.M. Greenhouse Pepper Cultivation Improved with Vegetable Residue Compost and Microbial Agents in Soil. Acta Boreali Occident. Sin. 2011, 31, 1243–1249. [Google Scholar]
  27. Hu, C.; Cao, Z.P.; Luo, Y.R.; Ma, Y.L. Effect of long-term application of microorganismic compost or vermicompost on soil fertility and microbial biomass carbon. Chin. J. Eco Agric. 2007, 3, 48–51. [Google Scholar]
  28. Yang, X.J.; He, H.; Cheng, L.Y.; Chang, X.J.; Li, S.; Yu, M.M.; Wang, B.Q.; Li, J.H. Effects of Organic Materials Applied to Saline Soil on Crop Growth and Soil Saline-alkali Index. Environ. Sci. 2024, 1–18. [Google Scholar] [CrossRef]
  29. Jin, Z.Q.; Shah, T.; Zhang, L.; Liu, H.Y.; Peng, S.B.; Nie, L.X. Effect of straw returning on soil organic carbon in rice–wheat rotation system: A review. Food Energy Secur. 2020, 9, e200. [Google Scholar] [CrossRef]
  30. Gil, S.F.; Trasar, C.C.; Leirós, M.; Seoane, S. Different approaches to evaluating soil quality using biochemical properties. Soil Biol. Biochem. 2005, 37, 877–887. [Google Scholar] [CrossRef]
  31. Wang, F.; Zhang, J.S.; Gao, P.C.; Tong, Y.A. Effect of application of different organic materials on soil microbiological properties and soil fertility in Weibei in rainfed high land. Plant Nutr. Fertil. Sci. 2011, 17, 702–709. [Google Scholar]
  32. Shan, D.; He, J.L.; Xing, E.D.; Rong, H.; Liu, Y.P. Effects of microbial fertilizer on microorganism and enzyme activity in coal mine dump of typical steppe. Bull. Soil Water Conserv. 2017, 37, 81–85. [Google Scholar] [CrossRef]
  33. Lu, P.N.; Liu, J.H.; Zhang, F.Y. Effects of microbial fertilizer and straw returned on soil characteristics of oat in saline-alkali land. J. North. Agric. 2017, 45, 37–42. [Google Scholar] [CrossRef]
  34. Akhtar, K.; Wang, W.Y.; Khan, A.; Ren, G.X.; Zaheer, S.; Sial, T.; Feng, Y.Z.; Yang, G.H. Straw mulching with fertilizer nitrogen: An approach for improving crop yield, soil nutrients and enzyme activities. Soil Use Manag. 2019, 35, 526–535. [Google Scholar] [CrossRef]
  35. Zhou, Y.Y.; Jiao, F. Effects of Nitrogen Fertilizer Reduction on Soil Fungal Diversity in Paddy Field under Continuous Straw Returning. J. Heilongjiang Bayi Agric. Univ. 2024, 36, 1–8. [Google Scholar]
  36. Jin, C.E.; Ji, Q.; Wang, Y.L.; Wang, R.; He, J.Q.; Lei, J.Y. Effects of different fertilization measures on soil enzyme activity and microbial diversity in dryland of southern Ningnan. Soil Fertil. Sci. China 2023, 12, 40–49. [Google Scholar]
  37. Wang, Y.L.; Liang, Y.; Cai, H.G.; Xu, K.N.; Zhang, S.M.; Zhang, C.; Fan, W.; Yuan, J.C.; Liu, J.Z.; Ren, J. Soil Quality Evaluation of Black Soil under Different Returning Treatments of Organic Materials Based on Minimum Data Set. Chin. J. Soil Sci. 2024, 55, 68–75. [Google Scholar] [CrossRef]
  38. Li, X.; Zhang, W.J.; Wu, L.; Ren, Y.; Zhang, J.D.; Xu, M.G. Advance in Indicator Screening and Methodologies of Soil Quality Evaluation. Sci. Agric. Sin. 2021, 54, 3043–3056. [Google Scholar] [CrossRef]
  39. Mei, N.; Gu, Y.; Li, D.Z.; Liang, Y.; Yuan, J.C.; Liu, J.Z.; Ren, J.; Cai, H.G. Soil quality evaluation in topsoil layer of black soil in Jilin Province based on minimum data set. Trans. Chin. Soc. Agric. Eng. Trans. CSAE 2021, 37, 91–98. [Google Scholar] [CrossRef]
  40. Shi, D.P.; Ye, Z.Z.; Li, H.T.; Lv, S.Q.; Wang, L.Q.; Zhou, C.J. Effects of combined application of biochar and nitrogen fertilizer on soil quality. Chin. J. Appl. Ecol. 2023, 34, 442–450. [Google Scholar] [CrossRef]
  41. Wang, S.Q.; Luo, Z.Z.; Niu, Y.N.; Cai, L.Q.; Liu, J.H.; Li, L.Z. Soil Quality Evaluation of Alfalfa Fields in Semi-arid Areas of the Loess Plateau Based on Minimum Data Set. Chin. J. Grassl. 2023, 45, 81–90. [Google Scholar] [CrossRef]
  42. Li, Z.X.; Li, J.H.; Li, T.T.; Zhang, Q.; Gao, C.H.; Lu, J.J.; Jin, D.S.; Xu, M.G. Effects of functional microbial agents on the microbial community and fertility of reclaimed soil in a coal mining area. Environ. Technol. Innov. 2024, 36, 103891. [Google Scholar] [CrossRef]
Figure 1. The dump soil’s physical properties under different dosages of EM agents and maize straw. Notes: bulk density (a), water content (b), total porosity (c), and capillary porosity (d). Bars with the same uppercase letter in each EM agent treatment were not significantly different at p < 0.05, and different lowercase letters indicate significant differences among the five maize straw dosages according to Tukey’s HSD test.
Figure 1. The dump soil’s physical properties under different dosages of EM agents and maize straw. Notes: bulk density (a), water content (b), total porosity (c), and capillary porosity (d). Bars with the same uppercase letter in each EM agent treatment were not significantly different at p < 0.05, and different lowercase letters indicate significant differences among the five maize straw dosages according to Tukey’s HSD test.
Agronomy 15 00365 g001
Figure 2. The dump soil’s chemical properties under different dosages of EM agents and maize straw. Notes: organic matter (a), pH (b), total nitrogen (c), alkaline hydrolysis nitrogen (d), total phosphorus (e), available phosphorus (f), total potassium (g), and available potassium (h). Bars with the same uppercase letter in each EM agent treatment were not significantly different at p < 0.05, and different lowercase letters indicate significant differences among the five maize straw dosages according to Tukey’s HSD test.
Figure 2. The dump soil’s chemical properties under different dosages of EM agents and maize straw. Notes: organic matter (a), pH (b), total nitrogen (c), alkaline hydrolysis nitrogen (d), total phosphorus (e), available phosphorus (f), total potassium (g), and available potassium (h). Bars with the same uppercase letter in each EM agent treatment were not significantly different at p < 0.05, and different lowercase letters indicate significant differences among the five maize straw dosages according to Tukey’s HSD test.
Agronomy 15 00365 g002
Figure 3. The dump soil’s biological properties under different dosages of EM agents and maize straw. Notes: sucrase (a), urease (b), alkaline phosphatase (c), bacterial Chao1 index (d), bacterial Shannon index (e), fungal Chao1 index (f), and fungal Shannon index (g). Bars with the same uppercase letter in each EM agent treatment were not significantly different at p < 0.05, and different lowercase letters indicate significant differences among the five maize straw dosages according to Tukey’s HSD test.
Figure 3. The dump soil’s biological properties under different dosages of EM agents and maize straw. Notes: sucrase (a), urease (b), alkaline phosphatase (c), bacterial Chao1 index (d), bacterial Shannon index (e), fungal Chao1 index (f), and fungal Shannon index (g). Bars with the same uppercase letter in each EM agent treatment were not significantly different at p < 0.05, and different lowercase letters indicate significant differences among the five maize straw dosages according to Tukey’s HSD test.
Agronomy 15 00365 g003
Figure 4. Pearson correlation of the soil evaluation indices. The colors indicate the magnitude of the significant correlations, with the color gradients indicating the Pearson’s correlation coefficients. The asterisks on the box indicate a significant difference (* p < 0.05, ** p < 0.01, *** p < 0.001).
Figure 4. Pearson correlation of the soil evaluation indices. The colors indicate the magnitude of the significant correlations, with the color gradients indicating the Pearson’s correlation coefficients. The asterisks on the box indicate a significant difference (* p < 0.05, ** p < 0.01, *** p < 0.001).
Agronomy 15 00365 g004
Figure 5. Linear regression analysis of soil quality indices in different data sets. Note: Gray areas are 95% confidence interval bands. MDS, minimum data set; TDS, total data set.
Figure 5. Linear regression analysis of soil quality indices in different data sets. Note: Gray areas are 95% confidence interval bands. MDS, minimum data set; TDS, total data set.
Agronomy 15 00365 g005
Figure 6. The soil quality index of the dump under different dosages of EM agents and maize straw. EM agent treatments: EM agent dosage A0, 0 g·kg−1; A1, 0.1 g·kg−1; A2, 0.2 g·kg−1; A3, 0.3 g·kg−1; A4, 0.4 g·kg−1. Maize straw treatments: maize straw dosage B0, 0 g·kg−1; B1, 5 g·kg−1; B2, 10 g·kg−1; B3, 15 g·kg−1; B4, 20 g·kg−1. Bars with the same uppercase letter in each EM agent treatment were not significantly different at p < 0.05, and different lowercase letters indicate significant differences among the five maize straw dosages according to Tukey’s HSD test. * and *** next to a number indicate a significance level of p < 0.05 and p < 0.001, respectively.
Figure 6. The soil quality index of the dump under different dosages of EM agents and maize straw. EM agent treatments: EM agent dosage A0, 0 g·kg−1; A1, 0.1 g·kg−1; A2, 0.2 g·kg−1; A3, 0.3 g·kg−1; A4, 0.4 g·kg−1. Maize straw treatments: maize straw dosage B0, 0 g·kg−1; B1, 5 g·kg−1; B2, 10 g·kg−1; B3, 15 g·kg−1; B4, 20 g·kg−1. Bars with the same uppercase letter in each EM agent treatment were not significantly different at p < 0.05, and different lowercase letters indicate significant differences among the five maize straw dosages according to Tukey’s HSD test. * and *** next to a number indicate a significance level of p < 0.05 and p < 0.001, respectively.
Agronomy 15 00365 g006
Table 1. Mass ratios of different amendments added to dump soil.
Table 1. Mass ratios of different amendments added to dump soil.
TreatmentFactor AFactor B
EM Agent Dosage (g/kg)Miaze Straw Dosage (g/kg)
A0B0(CK)00
A0B105
A0B2010
A0B3015
A0B4020
A1B00.10
A1B10.15
A1B20.110
A1B30.115
A1B40.120
A2B00.20
A2B10.25
A2B20.210
A2B30.215
A2B40.220
A3B00.30
A3B10.35
A3B20.310
A3B30.315
A3B40.320
A4B00.40
A4B10.45
A4B20.410
A4B30.415
A4B40.420
Table 2. F values of the effects of EM agent dosage (A), maize straw dosage (B), and their interaction on the physicochemical and biological properties of the dump soil.
Table 2. F values of the effects of EM agent dosage (A), maize straw dosage (B), and their interaction on the physicochemical and biological properties of the dump soil.
BDWCSTPSCPSOMpHTN
A8.067 ***6.12 ***7.845 ***3.718 **1.799 ns25.274 ***7.966 ***
B10.602 ***1.023 ns16.656 ***14.609 ***19.542 ***29.807 ***16.245 ***
A × B2.458 **1.523 ns1.752 *1.527 ns2.194 *9.035 ***3.382 ***
ANTPAPTKAKSUUR
A4.287 **4.663 **15.723 ***12.41 ***10.838 ***1539.669 ***9.408 ***
B2.986 *0.49 ns15.999 ***4.767 **63.648 ***2660.103 ***68.512 ***
A × B2.277 **2.765 **3.459 ***0.996 ns6.361 ***389.255 ***18.821 ***
ALPBCIBSIFCIFSI
A280.447 ***29.511 ***57.896 ***37.286 ***44.611 ***
B292.359 ***7.005 ***11.728 ***23.466 ***50.987 ***
A × B75.336 ***6.519 ***33.661 ***21.487 ***33.656 ***
Notes: BD: bulk density; STP: soil total porosity; SCP: soil capillary porosity; WC: water content; SOM: soil organic matter; TN: total nitrogen; AN: alkaline hydrolysis nitrogen; TP: total phosphorus; AP: available phosphorus; TK: total potassium; AK: available potassium; ALP: alkaline phosphate; SU: sucrase; UR: urease; BCI: bacterial Chao1 index; BSI: bacterial Shannon index; FCI: fungal Chao1 index; FSI: fungal Shannon index. *, **, ***, and ns next to a number indicate a significance level of p < 0.05, p < 0.01, p < 0.001, and p > 0.05, respectively.
Table 3. Inspection of KMO and Bartlett test results.
Table 3. Inspection of KMO and Bartlett test results.
KMO Sampling Fitness Measure0.536
Bartlett’s test of sphericityApproximate chi-square393.755
Degrees of freedom171
Significance0.000
Table 4. Principal component analysis of soil evaluation index.
Table 4. Principal component analysis of soil evaluation index.
IndicatorPrincipal ComponentGroupNorm
12345
STP0.77−0.513−0.2530.015−0.01412.283
SCP0.828−0.014−0.0360.304−0.14912.256
SOM0.844−0.2850.057−0.099−0.09612.325
pH−0.719−0.311−0.114−0.0720.08112.015
TN0.880.084−0.1120.0470.00212.372
AN0.620.165−0.2660.028−0.32311.765
AP0.6060.4720.364−0.2370.16511.928
TK0.506−0.444−0.4190.0630.32411.715
AK0.9120.021−0.168−0.1910.06412.471
SU0.7570.460.052−0.1350.01512.192
UR0.7650.0750.319−0.219−0.19612.135
BD−0.7210.540.2920.0080.05122.195
WC0.1190.492−0.4860.3490.20421.251
BSI0.018−0.690.4170.2750.01721.392
BCI0.136−0.7010.5550.237−0.21831.558
FCI0.2530.20.6390.4610.14531.335
FSI0.3360.301−0.0050.7050.30541.374
TP0.0730.5580.2190.105−0.51351.180
ALP0.4280.0210.535−0.3940.53751.569
Eigenvalue7.1983.0562.151.4031.075
Variance contribution (%)37.88716.08311.3167.3845.658
Cumulative variance contribution (%)37.88753.9765.28672.67178.329
Table 5. Common factor variance and weight of soil evaluation index.
Table 5. Common factor variance and weight of soil evaluation index.
IndicatorTotal Data Set (TDS)Minimum Data Set (MDS)
CommunalityWeightCommunalityWeight
BD0.8990.0600.7250.235
STP0.9210.062
SCP0.8020.054
WC0.6560.044
SOM0.8170.055
pH0.6380.043
TN0.7970.054
AN0.5870.039
TP0.6390.043
AP0.8060.054
TK0.7370.050
AK0.9010.0610.8220.226
ALP0.9130.0610.3270.106
SU0.8050.054
UR0.7790.052
BCI0.9210.0620.7730.251
BSI0.7260.049
FCI0.7460.050
TSI0.7930.0530.4380.142
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chen, S.; Zhang, Q.; Liu, T.; Yan, M.; Shao, L.; Jia, Z. Restoring Soil Health: A Study on Effective Microorganisms and Maize Straw Applications. Agronomy 2025, 15, 365. https://doi.org/10.3390/agronomy15020365

AMA Style

Chen S, Zhang Q, Liu T, Yan M, Shao L, Jia Z. Restoring Soil Health: A Study on Effective Microorganisms and Maize Straw Applications. Agronomy. 2025; 15(2):365. https://doi.org/10.3390/agronomy15020365

Chicago/Turabian Style

Chen, Shichao, Qing Zhang, Tongtong Liu, Min Yan, Luying Shao, and Zhi Jia. 2025. "Restoring Soil Health: A Study on Effective Microorganisms and Maize Straw Applications" Agronomy 15, no. 2: 365. https://doi.org/10.3390/agronomy15020365

APA Style

Chen, S., Zhang, Q., Liu, T., Yan, M., Shao, L., & Jia, Z. (2025). Restoring Soil Health: A Study on Effective Microorganisms and Maize Straw Applications. Agronomy, 15(2), 365. https://doi.org/10.3390/agronomy15020365

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop