The Biogas Production Potential and Community Structure Characteristics of the Co-Digestion of Dairy Manure and Tomato Residues
Abstract
1. Introduction
2. Materials and Methods
2.1. Raw Materials and Inoculum
2.2. Equipment
2.3. Experimental Design
2.4. Measurement Indicators and Methods
2.5. Statistical Analysis
3. Results and Discussion
3.1. Methane Production
3.2. Anaerobic Digestion Characteristics
3.3. Microbial Community Structure
4. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Sridevi, V.D.; Rema, T.; Srinivasan, S.V. Studies on biogas production from vegetable market wastes in a two-phase anaerobic reactor. Clean Technol. Environ. Policy 2014, 17, 1689–1697. [Google Scholar] [CrossRef]
- Arvanitoyannis, I.S.; Varzakas, T.H. Vegetable waste treatment: Comparison and critical presentation of Methodologies. Crit. Rev. Food Sci. Nutr. 2008, 48, 205–247. [Google Scholar] [CrossRef] [PubMed]
- Neves, L.; Oliveira, R.; Alves, M. Anaerobic co-digestion of coffee waste and sewage sludge. Waste Manag. 2006, 26, 176–181. [Google Scholar] [CrossRef] [PubMed]
- Kaparaju, P.; Rintala, J. Anaerobic co-digestion of potato tuber and its industrial by-products with pig manure. Resour. Conserv. Recycl. 2005, 43, 175–188. [Google Scholar] [CrossRef]
- Qian, X.; Shen, G.; Wang, Z.; Li, J.; Lei, Z.; Zhang, Z. Performance of semi-dry anaerobic co-digestion of swine manure with rice straw under biogas slurry addition. In Proceedings of the 2015 2nd International Conference on Machinery, Materials Engineering, Chemical Engineering and Biotechnology, Chongqing, China, 28–29 November 2015; Atlantis Press: Amsterdam, The Netherlands, 2015; pp. 235–243. [Google Scholar]
- Abbassi-Guendouz, A.; Brockmann, D.; Trably, E.; Dumas, C.; Delgenès, J.-P.; Steyer, J.-P.; Escudié, R. Total solids content drives high solid anaerobic digestion via mass transfer limitation. Bioresour. Technol. 2012, 111, 55–61. [Google Scholar] [CrossRef] [PubMed]
- Fdéz, L.A.; Álvarez-Gallego, C.; Márquez, D.S.; García, L.I.R. Start-up of thermophilic–dry anaerobic digestion of OFMSW using adapted modified SEBAC inoculum. Bioresour. Technol. 2010, 101, 9031–9039. [Google Scholar] [CrossRef] [PubMed]
- Delgenes, J.P.; Carrère, M.; Cacho, J.; Buffière, P.; Guendouz, J. High-solids anaerobic digestion: Comparison of three pilot scales. Water Sci. Technol. 2008, 58, 1757–1763. [Google Scholar]
- Li, Y.B.; Park, S.Y.; Zhu, J.Y. Solid-state anaerobic digestion for methane production from organic waste. Renew. Sustain. Energy Rev. 2011, 15, 821–826. [Google Scholar] [CrossRef]
- Shi, J.; Xu, F.Q.; Wang, Z.J.; Stiverson, J.A.; Yu, Z.T.; Li, Y.B. Effects of microbial and non-microbial factors of liquid anaerobic digestion effluent as inoculum on solid-state anaerobic digestion of corn stover. Bioresour. Technol. 2014, 157, 188–196. [Google Scholar] [CrossRef]
- Jin, W.Y.; Xu, X.C.; Yang, F.L.; Li, C.L.; Zhou, M. Performance enhancement by rumen cultures in anaerobic co-digestion of corn straw with pig manure. Biomass Bioenergy 2018, 115, 120–129. [Google Scholar] [CrossRef]
- Li, Y.Y.; Manandhar, A.; Li, G.X.; Shah, A. Life cycle assessment of integrated solid state anaerobic digestion and composting for on-farm organic residues treatment. Waste Manag. 2018, 76, 294–305. [Google Scholar] [CrossRef] [PubMed]
- Li, C.X.; Champagne, P.; Anderson, B.C. Evaluating and modeling biogas production from municipal fat, oil, and grease and synthetic kitchen waste in anaerobic co-digestions. Bioresour. Technol. 2011, 102, 9471–9480. [Google Scholar] [CrossRef]
- Yu, X.; Yan, L.; Wang, H.; Bi, S.; Zhang, F.; Huang, S.; Wang, Y.; Wang, Y. Anaerobic co-digestion of cabbage waste and cattle manure: Effect of mixing ratio and hydraulic retention time. Renew. Energy 2024, 221, 119743. [Google Scholar] [CrossRef]
- Abbas, Y.; Yun, S.; Mehmood, A.; Shah, F.A.; Wang, K.; Eldin, E.T.; Al-Qahtani, W.H.; Ali, S.; Bocchetta, P. Co-digestion of cow manure and food waste for biogas enhancement and nutrients revival in bio-circular economy. Chemosphere 2023, 311, 137018. [Google Scholar] [CrossRef] [PubMed]
- Mlaik, N.; Sayadi, S.; Masmoudi, M.A.; Yaacoubi, D.; Loukil, S.; Khoufi, S. Optimization of anaerobic co-digestion of fruit and vegetable waste with animal manure feedstocks using mixture design. Biomass Convers. Biorefinery 2024, 14, 4007–4016. [Google Scholar] [CrossRef]
- APHA. Standard Methods for the Examination of Water and Wastewater; American Public Health Association: Washington, DC, USA, 2005. [Google Scholar]
- Page, A.L.; Miller, R.H.; Keeney, D.R. Methods of Soil Analysis: Chemical and Microbiological Properties; American Society of Agronomy, Soil Science Society of America: Madison, WI, USA, 1982. [Google Scholar]
- ISO-5664; Water Quality-Determination of Ammonium-Distillation and Titration Method. International Organization for Standardization: Geneva, Switzerland, 1984.
- Wang, Y.Y.; Li, G.X.; Chi, M.H.; Sun, Y.B.; Zhang, J.X.; Jiang, S.X.; Cui, Z.J. Effects of co-digestion of cucumber residues to corn stover and pig manure ratio on methane production in solid state anaerobic digestion. Bioresour. Technol. 2018, 250, 328–336. [Google Scholar] [CrossRef]
- Brown, D.; Li, Y. Solid state anaerobic co-digestion of yard waste and food waste for biogas production. Bioresour. Technol. 2013, 127, 275–280. [Google Scholar] [CrossRef] [PubMed]
- van Lier, J.B.; Jenicek, P.; Kalyuzhnyi, S.; Guwy, A.J.; Campos, J.L.; Borzacconi, L.; Bolzonella, D.; Alves, M.; Angelidaki, I. Defining the biomethane potential (BMP) of solid organic wastes and energy crops: A proposed protocol for batch assays. Water Sci. Technol. 2009, 59, 927–934. [Google Scholar]
- Zhang, E.L.; Li, J.J.; Zhang, K.Q.; Wang, F.; Yang, H.H.; Zhi, S.L.; Liu, G.Q. Anaerobic digestion performance of sweet potato vine and animal manure under wet, semi-dry, and dry conditions. AMB Express 2018, 8, 45. [Google Scholar] [CrossRef]
- Lin, L.; Yang, L.C.; Xu, F.Q.; Michel, F.C.; Li, Y.B. Comparison of solid-state anaerobic digestion and composting of yard trimmings with effluent from liquid anaerobic digestion. Bioresour. Technol. 2014, 169, 439–446. [Google Scholar] [CrossRef]
- Ge, X.M.; Xu, F.Q.; Li, Y.B. Solid-state anaerobic digestion of lignocellulosic biomass: Recent progress and perspectives. Bioresour. Technol. 2016, 205, 239–249. [Google Scholar] [CrossRef] [PubMed]
- Lin, Y.Q.; Ge, X.M.; Liu, Z.; Li, Y.B. Integration of Shiitake cultivation and solid-state anaerobic digestion for utilization of woody biomass. Bioresour. Technol. 2015, 182, 128–135. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.Y.; Wang, Y.Q.; Yu, Z.H.; Lu, J.X.; Li, D.Y.; Wang, G.Y.; Li, Y.; Wu, Y.; Li, S.Y.; Xu, F.Q.; et al. Effect of inoculum and substrate/inoculum ratio on the performance and methanogenic archaeal community structure in solid state anaerobic co-digestion of tomato residues with dairy manure and corn stover. Waste Manag. 2018, 81, 117–127. [Google Scholar] [CrossRef] [PubMed]
- Zhong, W.Z.; Zhang, Z.Z.; Luo, Y.J.; Sun, S.S.; Qiao, W.; Xiao, M. Effect of biological pretreatments in enhancing corn straw biogas production. Bioresour. Technol. 2011, 102, 11177–11182. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zhang, J.; Li, Y.; Jia, S.; Li, G. Methane production from the co-digestion of pig manure and corn stover with the addition of cucumber residue: Role of the total solids content and feedstock-to-inoculum ratio. Bioresour. Technol. 2020, 306, 123172. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.Q.; Zhang, R.H.; Liu, X.Y.; Chen, C.; Xiao, X.; Feng, L.; He, Y.F.; Liu, G.Q. Evaluating methane production from anaerobic mono- and Co-digestion of kitchen waste, corn stover, and chicken manure. Energy Fuels 2013, 27, 2085–2091. [Google Scholar] [CrossRef]
- Park, S.; Li, Y.B. Evaluation of methane production and macronutrient degradation in the anaerobic co-digestion of algae biomass residue and lipid waste. Bioresour. Technol. 2012, 111, 42–48. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.Y.; Liao, B. Anaerobic co-digestion of vegetable and fruit market waste in LBR+CSTR two-stage process for waste reduction and biogas production. Appl. Biochem. Biotechnol. 2019, 188, 185–193. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Cheng, J.J.; Creamer, K.S. Inhibition of anaerobic digestion process: A review. Bioresour. Technol. 2008, 99, 4044–4064. [Google Scholar] [CrossRef]
- Mahdy, A.; Fotidis, I.A.; Mancini, E.; Ballesteros, M.; González-Fernández, C.; Angelidaki, I. Ammonia tolerant inocula provide a good base for anaerobic digestion of microalgae in third generation biogas process. Bioresour. Technol. 2017, 225, 272–278. [Google Scholar] [CrossRef]
- Li, Y.; Lu, J.; Xu, F.; Li, Y.; Li, D.; Wang, G.; Li, S.; Zhang, H.; Wu, Y.; Shah, A.; et al. Reactor performance and economic evaluation of anaerobic co-digestion of dairy manure with corn stover and tomato residues under liquid, hemi-solid, and solid state conditions. Bioresour. Technol. 2018, 270, 103–112. [Google Scholar] [CrossRef] [PubMed]
- Appels, L.; Baeyens, J.; Degrève, J.; Dewil, R. Principles and potential of the anaerobic digestion of waste-activated sludge. Prog. Energy Combust. Sci. 2008, 34, 755–781. [Google Scholar] [CrossRef]
- Zhang, C.; Yun, S.N.; Li, X.; Wang, Z.Q.; Xu, H.F.; Du, T.T. Low-cost composited accelerants for anaerobic digestion of dairy manure: Focusing on methane yield, digestate utilization and energy evaluation. Bioresour. Technol. 2018, 263, 517–524. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Yan, W.; Sheng, K.C.; Sanati, M. Comparison of high-solids to liquid anaerobic co-digestion of food waste and green waste. Bioresour. Technol. 2014, 154, 215–221. [Google Scholar] [CrossRef] [PubMed]
- Vavilin, V.; Fernandez, B.; Palatsi, J.; Flotats, X. Hydrolysis kinetics in anaerobic degradation of particulate organic material: An overview. Waste Manag. 2008, 28, 939–951. [Google Scholar] [CrossRef] [PubMed]
- Ren, J.W.; Yuan, X.F.; Li, J.; Ma, X.G.; Zhao, Y.; Zhu, W.B.; Wang, X.F.; Cui, Z.J. Performance and microbial community dynamics in a two-phase anaerobic co-digestion system using cassava dregs and pig manure. Bioresour. Technol. 2014, 155, 342–351. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.; Li, Q.; Gao, X.; Wang, X.C. Synergetic promotion of syntrophic methane production from anaerobic digestion of complex organic wastes by biochar: Performance and associated mechanisms. Bioresour. Technol. 2018, 250, 812–820. [Google Scholar] [CrossRef] [PubMed]
- Yue, Z.B.; Chen, R.; Yang, F.; MacLellan, J.; Marsh, T.; Liu, Y.; Liao, W. Effects of dairy manure and corn stover co-digestion on anaerobic microbes and corresponding digestion performance. Bioresour. Technol. 2013, 128, 65–71. [Google Scholar] [CrossRef] [PubMed]
- Tukanghan, W.; Hupfauf, S.; Gómez-Brandón, M.; Insam, H.; Salvenmoser, W.; Prasertsan, P.; Cheirsilp, B.; Sompong, O. Symbiotic Bacteroides and Clostridium-rich methanogenic consortium enhanced biogas production of high-solid anaerobic digestion systems. Bioresour. Technol. Rep. 2021, 14, 100685. [Google Scholar] [CrossRef]
- Liu, Y.C.; Whitman, W.B. Metabolic, phylogenetic, and ecological diversity of the methanogenic archaea. Ann. N. Y. Acad. Sci. 2008, 1125, 171–189. [Google Scholar] [CrossRef]
- Ince, O.; Akyol, Ç.; Ozbayram, E.G.; Tutal, B.; Ince, B. Enhancing methane production from anaerobic co-digestion of cow manure and barley: Link between process parameters and microbial community dynamics. Environ. Prog. Sustain. Energy 2020, 39, 13292. [Google Scholar] [CrossRef]
- Borth, P.L.B.; Perin, J.K.H.; Torrecilhas, A.R.; Lopes, D.D.; Santos, S.C.; Kuroda, E.K.; Fernandes, F. Pilot-scale anaerobic co-digestion of food and garden waste: Methane potential, performance and microbial analysis. Biomass Bioenergy 2022, 157, 106331. [Google Scholar] [CrossRef]
- Xu, R.; Zhang, K.; Liu, P.; Khan, A.; Xiong, J.; Tian, F.; Li, X. A critical review on the interaction of substrate nutrient balance and microbial community structure and function in anaerobic co-digestion. Bioresour. Technol. 2018, 247, 1119–1127. [Google Scholar] [CrossRef] [PubMed]
- Xu, Q.; Long, S.; Liu, X.; Duan, A.; Du, M.; Lu, Q.; Leng, L.; Leu, S.-Y.; Wang, D. Insights into the occurrence, fate, impacts, and control of food additives in food waste anaerobic digestion: A review. Environ. Sci. Technol. 2023, 57, 6761–6775. [Google Scholar] [CrossRef] [PubMed]
Measurement Indicator | Dairy Manure | Tomato Residues | Inoculum |
---|---|---|---|
Water content (%) | 82.2 ± 0.4 | 85.1 ± 0.2 | 62.6 ± 0.8 |
Total Solid (%) | 17.8 ± 0.3 | 14.9 ± 0.2 | 37.4 ± 0.4 |
Volatile solids (%) b | 16.1 ± 0.02 | 10.5 ± 0.5 | 10.2 ± 0.03 |
Volatile solids/Solid content (%) | 42.6 ± 0.2 | 70.2 ± 0.07 | 27.3 ± 0.04 |
pH | 8.0 ± 0.2 | ND a | 8.3 ± 0.4 |
Total carbon (%) b | 45.4 ± 0.0 | 46.6 ± 0.4 | 16.7 ± 0.02 |
Total nitrogen (%) b | 2.4 ± 0.0 | 2.4 ± 0.3 | 0.8 ± 0.01 |
Carbon nitrogen ratio | 18.5 ± 0.0 | 19.5 ± 0.8 | 21.2 ± 0.02 |
Hemicellulose (%) b | 25.1 ± 0.7 | 16.0 ± 0.08 | 14.3 ± 0.2 |
Cellulose (%) b | 23.4 ± 0.5 | 21.5 ± 0.02 | 6.3 ± 0.5 |
Lignin (%) b | 6.1 ± 0.07 | 7.0 ± 0.01 | 5.1 ± 0.7 |
Sequencing Region | Primer Name | Primer Sequence | Species |
---|---|---|---|
V3-V4 | 338F | ACTCCTACGGGGAGGCAGGAG | Bacteria |
806R | GGACTACHVGGGTWTCTAAT | ||
V3-V4 | 344F | ACGGGGYGCAGCAGGCGCGA | Archaea |
806R | GGACTACVSGGGTATCTAAT |
Treatment | pH | TAN (g/kg) | VFAs (g/kg) | ALK (g CaCO3/kg) | VFA/ALK |
---|---|---|---|---|---|
TS6 | 5.6 | 1.0 | 5.8 | 4.4 | 1.32 |
TS8 | 6.2 | 0.7 | 3.7 | 8.3 | 0.45 |
TS10 | 7.5 | 1.6 | 3.1 | 9.8 | 0.32 |
TS12 | 7.6 | 1.0 | 3.4 | 11.2 | 0.30 |
TS15 | 7.6 | 1.2 | 2.3 | 8.9 | 0.26 |
TS18 | 8.3 | 1.8 | 2.9 | 11.7 | 0.25 |
TS20 | 8.5 | 2.1 | 1.1 | 8.4 | 0.13 |
TS22 | 8.3 | 2.1 | 1.3 | 9.5 | 0.14 |
TS25 | 8.4 | 2.2 | 1.2 | 6.5 | 0.18 |
Samples | Observed-Species | Shannon | Simpson | Chao1 | |
---|---|---|---|---|---|
Bacteria | TS6-IP | 1009.5 | 6.878 | 0.966 | 1095.269 |
TS20-IP | 1067.2 | 6.552 | 0.954 | 1189.641 | |
TS25-IP | 1039.8 | 6.821 | 0.967 | 1163.642 | |
TS6-GP | 1087.3 | 7.005 | 0.973 | 1079.027 | |
TS20-GP | 988.1 | 7.128 | 0.977 | 1129.575 | |
TS25-GP | 989.9 | 7.352 | 0.984 | 1077.806 | |
Archaea | TS6-IP | 172 | 4.227 | 0.877 | 185.942 |
TS20-IP | 149 | 3.991 | 0.857 | 162.881 | |
TS25-IP | 158 | 3.548 | 0.773 | 174.237 | |
TS6-GP | 130 | 4.114 | 0.88 | 137.567 | |
TS20-GP | 145 | 4.122 | 0.861 | 152.595 | |
TS25-GP | 140 | 3.722 | 0.804 | 157.254 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Li, Y.; Yao, L.; Fu, L.; Liu, Z. The Biogas Production Potential and Community Structure Characteristics of the Co-Digestion of Dairy Manure and Tomato Residues. Agronomy 2024, 14, 881. https://doi.org/10.3390/agronomy14050881
Wang Y, Li Y, Yao L, Fu L, Liu Z. The Biogas Production Potential and Community Structure Characteristics of the Co-Digestion of Dairy Manure and Tomato Residues. Agronomy. 2024; 14(5):881. https://doi.org/10.3390/agronomy14050881
Chicago/Turabian StyleWang, Yanqin, Yan Li, Li Yao, Longyun Fu, and Zhaodong Liu. 2024. "The Biogas Production Potential and Community Structure Characteristics of the Co-Digestion of Dairy Manure and Tomato Residues" Agronomy 14, no. 5: 881. https://doi.org/10.3390/agronomy14050881
APA StyleWang, Y., Li, Y., Yao, L., Fu, L., & Liu, Z. (2024). The Biogas Production Potential and Community Structure Characteristics of the Co-Digestion of Dairy Manure and Tomato Residues. Agronomy, 14(5), 881. https://doi.org/10.3390/agronomy14050881