Next Article in Journal
Patterns and Relationships of Pesticide Use in Agricultural Crops of Latin America: Review and Analysis of Statistical Data
Previous Article in Journal
A Deep-Learning-Based Detection Method for Small Target Tomato Pests in Insect Traps
Previous Article in Special Issue
The Grapevine MADS-Box Protein VvAGL11 Induces Early Flowering in Arabidopsis
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A Molecular Marker Within the NLP3-B1 Gene Is Associated with Earliness in Spring Wheat (Triticum aestivum L.)

1
All-Russia Research Institute of Agricultural Biotechnology, 127550 Moscow, Russia
2
Kurchatov Centre for Genome Research, National Research Centre “Kurchatov Institute”, 123182 Moscow, Russia
*
Author to whom correspondence should be addressed.
Agronomy 2024, 14(12), 2888; https://doi.org/10.3390/agronomy14122888
Submission received: 22 October 2024 / Revised: 20 November 2024 / Accepted: 2 December 2024 / Published: 3 December 2024

Abstract

:
Earliness is a critical agronomic trait that enables plants to avoid adverse weather conditions during the late growing season or at harvest. In wheat, earliness is controlled by at least three distinct mechanisms: vernalization requirement, photoperiod sensitivity, and a mechanism independent of the first two, so called, earliness per se. In this work we report a locus on chromosome 3B within NLP3-B1 (TraesCS3B02G190300) gene, coding a nitrate-sensitive transcription factor protein, which is associated with earliness in F5:6 of PI-518620 x CI-17241 spring wheat cross. The variant ‘A’ of the single nucleotide polymorphism NLP3-B1: c.1824+137G>A, which is proper to evolutionary earlier haplotypes, provides heading and anthesis that is 2 days earlier. The effect of this novel marker on earliness was additive to the effect of PPD-D1 locus in the same population; however, the effect of the former was weaker. Similarly, allele Ppd-D1a and the variant ‘A’ of the NLP3-B1: c.1824+137G>A polymorphism statistically significantly reduced the plant height (for 2.2 and 1.3 cm, correspondingly) and changed some other agronomical traits; however, these light pleiotropic effects are not of practical value. The possible direct impact of NLP3-B1 on the timing of flowering via altered nitrate sensitivity has been discussed, and other candidate genes on chromosome 3B have also been suggested.

1. Introduction

Early maturity is an important trait for spring wheat [1]. In northern areas with cold climates and short growing seasons, it allows for the avoidance of pre-harvest sprouting and frost damage of the grain, while in southern warmer areas, it allows for plants to avoid terminal drought stress [2,3].
In wheat, three types of earliness genes are traditionally distinguished: vernalization response genes (VRN), photoperiod sensitivity genes (PPD), and earliness per se genes (EPS) [4]. Wheat is usually a long-day crop, and under short days it shows delayed heading [5]. Photoperiod-neutral mutations provide early transitions to flowering independently of day length [6]. Photoperiod sensitivity in wheat is mainly controlled by the genes located on chromosomes of the 2-nd homoeologous group—PPD-D1 on 2D, and PPD-B1 on 2B [7]. These genes are the members of the pseudo-response regulator (PRR) family and are associated with circadian functions. A shifted expression pattern of these genes produces a photoperiod-insensitive phenotype [8,9].
PPD-D1 is one of the most significant genes affecting photoperiod response in wheat. Initially, only two alleles of this gene were known: insensitive to day length Ppd-D1a and sensitive Ppd-D1b. The Ppd-D1a allele occurred due to 2089 base pairs deletion in the promoter region of the gene [9]. Further, some other haplotypes of this gene were discovered [8]. Other valuable alleles conferring photoperiod neutrality are the mutations of PPD-B1 gene: Ppd-B1a, Ppd-B1d, and Ppd-B1c. These dominant photoperiod-neutral forms occurred due to copy-number variation mutations. Another allele, Ppd-B1a.1, contains a miniature inverted-repeat transposable element (MITE) insertion in the promoter region [7].
Additionally, flowering time genes orthologous to the Arabidopsis CONSTANS (CO) gene were reported in homoeologous group 6 chromosomes, which interact with PPD [10]. Vernalization is a requirement of exposure to cold temperatures, usually occurring in fall and spring, around the winter period, for the transition to flowering. Spring wheat does not require vernalization; however, variation at Vernalization (VRN) loci may change the time of flowering [2]. Vernalization in wheat is controlled mainly by VRN1 locus, which is a homolog to MADS-box genes APETALA 1 (AP1) in Arabidopsis [11]. Other vernalization genes in wheat are VRN3, which is an orthologue of FLOWERING LOCUS T (FT) [12], and VRN2, which encodes a zinc finger–CCT domain transcription factor (ZCCT), a dominant flowering repressor, which is not related to Arabidopsis vernalization genes. Also, VEGETATIVE TO REPRODUCTIVE TRANSITION 2 (VRT2) gene with similar action as VRN2 is known [13]. Earliness per se genes affect earliness independently on photoperiod and vernalization. For EARLINESS PER SE D1 (EPS-D1) locus in wheat, an interaction with temperatures during late reproductive phase was shown, and early allele provided more temperature-independent development. Orthologue of Arabidopsis gene EARLY FLOWERING 3 (ELF3) was proposed for EPS-D1 in wheat [14].
Generally, environmental conditions influence timing of flowering in plants by various mechanisms. These include not only photoperiod and vernalization but also non-vernalizing temperatures during plant growth, light intensity and quality, water regime, and soil nutrition [15,16]. Flowering also depends on plant age. For the model plant Arabidopsis, hundreds of genes are now known to affect flowering, and several molecular pathways of flowering regulation are distinguished. Age pathway includes interaction of SQUAMOSA PROMOTER BINDING-LIKE (SPL) transcription factors and microRNA156, which targets their mRNAs. Autonomous pathway works through vernalization-dependent epigenetic suppression of the FLOWERING LOCUS C (FLC), a transcription factor that represses flowering. The perception of photoperiod signals is connected with circadian genes and involves the regulation of the B-Box transcription factor CONSTANS (CO). Photoperiod-related signals are integrated by genes FLOWERING LOCUS T (FT) and SUPPRESSOR OF OVEREXPRESSION OF CONSTANS (SOC1) [16].
Nitrates that are present in soil serve as the main source of nitrogen for plants [17,18]. At the same time, nitrates are known to regulates multiple physiological processes in plants, including seed germination, plant growth, roots, and shoots branching, accumulation of primary and secondary metabolites, disease resistance, symbiosis with nitrogen-fixing bacteria and also transition to flowering [17,18]. Earliness thus could be connected with nitrate sensitivity. It is worth noting that for plants there is an optimal level of nitrates that promotes flowering the most. Too high or too low nitrate concentrations delay transition to flowering [19]. The level of nitrates in plants is sensed by cytosolic receptors—nodule inception (NIN)-like proteins (NLPs), that are characterized by the presence of RWP-RK and PB1 domains [20]. These proteins directly bind nitrates, which make their conformation to change and make them susceptible for phosphorylation by CALCIUM-DEPENDENT PROTEIN KINASEs (CPK). Phosphorylated NLPs are transported to nucleus, where they play role of transcription factors and activate the expression of primary nitrogen-responsive genes. In Arabidopsis, NLP6 and NLP7 together govern the expression of about a half of nitrate-responsive genes [17]. Rice gene OsNLP3 is a gene homologous to Arabidopsis NLP7. Variation in expression of OsNLP3 was positively correlated with panicle size [21], grain yield, and nitrogen use efficiency under nitrate-rich conditions [22].
In wheat, the NLP3-B1 gene on chromosome 3B (TraesCS3B02G190300) is the most similar to OsNLP3 (LOC_Os01g13540) and Arabidopsis AtNLP7 (AT4G24020) genes in the results of BLAST search in the wheat RefSeq1.0 genome, and the most polymorphic one of the three wheat homeologs; other ones are present in sub-genome A (TraesCS3A02G159600) and D (TraesCS3D02G166900). So, this gene became a target in our study, as one of the genes regulating nitrogen metabolism with a possible impact on various agronomical traits. The aim of this study is to investigate the role of the NLP3-B1 gene on chromosome 3B and its interaction with PPD-D1 in controlling the timing of heading and anthesis, as well as other important agronomic traits in spring wheat.

2. Materials and Methods

2.1. Plant Material

For the study, we used recombinant inbred lines of spring common wheat F5:6 obtained from PI-518620 x CI-17241 cross. The PI-518620 and CI-17241 (Chris Mutant) lines were kindly provided by Prof. Nobuyoshi Watanabe (University of Agriculture, Ibaraki, Japan).
Parental line PI-518620 is a near-isogenic line of the cultivar Marfed carrying Rht1 (Rht-B1b) dwarfing allele from Norin 10. It is a soft spring white wheat developed at the Washington agricultural Research Center and registered in 1989 [23]. The original mid-tall cultivar Marfed was released in 1946 by the Washington State Experimental Station (Pullman, WA, USA) [24].
The line CI-17241 (Chris Mutant) is a semidwarf line developed by Heiner and Elsayed in 1974 at the Minnesota Agricultural Experiment Station (Saint Paul, MN, USA) as a result of chemical mutagenesis applied to cultivar Chris, a hard red spring cultivar [25]. Cultivar Chris is a source of daylength insensitivity [26].

2.2. Field Experiment

A field experiment with plants was conducted in Moscow at the field experimental station of the Russian State Agrarian University named after K.A. Timiryazev (55°50′ North latitude, 37°33′ East longitude) in 2019, Moscow. The location is a part of the Central Non-Chernozem region of Russia with a temperate continental climate, which is characterized by high rainfall, moderate temperatures and sod-podzolic soils. Sowing was carried out on 23 April 2019 in single-row plots, 1 m in length, with inter-row spacing of 30 cm, and a distance between successive plots of 50 cm using the SKS-6-10 cassette row drill (All-Union Research Institute of Agricultural Mechanization, Moscow, Russia). F6 families, obtained from individual F5 plants, were sown on the plots. The weeds were pulled out manually, and the necessary pesticide treatment was carried out to protect the plants from pests. F6 plants were analyzed individually. Each plant was harvested by hand upon reaching the full ripeness phase; the final harvest day was on 23 August 2019. Seeds were threshed from the individual spikes using the MKS-1M ear thresher (MZOK company, Moscow, Russia). The weather conditions of the growing season compared to climate averages are shown in Figure 1. The weather and climate data were provided by the Hydrometeorological Research Center of the Russian Federation (https://meteoinfo.ru/, accessed on 20 November 2024).

2.3. Plant Phenotyping

The following traits of each plant were recorded after harvest and after at least two weeks of drying under room conditions: plant height, spike length (SL, cm), number of spikelets per spike (SNS), spike density (calculated as tenfold SNS divided by SL), unthreshed spike weight (SpW), main shoot straw weight (StW), grain weight in the main spike (GWS, g), number of grains per spike (GNS), grain number in spikelet, thousand grain weight (calculated as a thousandfold ratio of GWS to GNS, g), number of fruiting tillers (total with the main shoot), grain weight per plant (main shoot and all tillers), number of internodes, heading date (days after sowing), anthesis date (days after sowing), harvest index, the length of the first (peduncle), and other available internodes. All spike parameters were measured in the main shoot. The harvest index was calculated as the ratio of the GWS to the total of SpW and StW. The stages of heading and anthesis were determined visually for the entire family. The seeds were counted using the SeedCounter 2.0 application [27]. The phenotype data can be found in Supplementary Materials (Data S1).

2.4. Exploration of NLP3-B1 Haplotypes

The sequences of NLP3-B1 were extracted from the complete genome assemblies of the Wheat 10+ genomes (wheat pangenome) project [28] using BLAST 2.15.0+ software [29] with a sequence of TraesCS3B02G190300 gene taken from RefSeq1.0 Chinese Spring bread wheat genome [30] as a query. The alignment of sequences was performed in MEGA 11 [31]. Inaccurately assembled sequences, which were present in some genomes, were edited by removing the overlapping parts. The missing parts of sequences, if present, were uniformly substituted with sequences from Chinese Spring genome (RefSeq1.0). Clipping of the alignment and translation of coding sequences to protein was performed using GeneDoc 2.7 [32]. The final sequences used for evolutionary analysis could be found in Supplementary Materials (Data S2).
Evolutionary analyses of DNA sequences were conducted in MEGA11 [31]. The evolutionary history was inferred by using the Maximum Likelihood method and Tamura-Nei model [33]. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Tamura-Nei model, and then selecting the topology with a superior log likelihood value. All positions containing gaps and missing data were eliminated (complete deletion option).

2.5. Evolutionary Position of Wheat NLP3-B1 Protein

To estimate the relationships of the wheat NLP3 protein with NLP proteins of other well-studied model plant species, we took the protein sequences of Arabidopsis thaliana from The Arabidopsis Information Resource (TAIR) database (https://www.arabidopsis.org/, accessed on 20 November 2024), rice protein sequences from NCBI Protein database (https://www.ncbi.nlm.nih.gov/protein/, accessed on 20 November 2024), and maize NLP protein sequences from a research article [34]. The sequences were aligned using MUSCLE algorithm [35]. The evolutionary analysis of proteins was conducted in MEGA11 [31] using the Maximum Likelihood method and JTT matrix-based model [36]. This analysis involved 27 amino acid sequences. All positions containing gaps and missing data were eliminated (complete deletion option). There was a total of 544 positions in the final dataset. The conserved domains of the proteins were detected using a NCBI CDD database search [37]. The picture of the phylogenetic tree, along with protein schemes showing the positions of conserved domains, was drawn in CFVisual v2.1.4 [38]. The sequences of proteins used for analysis are provided in the Supplementary Data S3 File.

2.6. DNA Extraction

To extract DNA, leaves of adult plants were collected in the field, dried at 40 °C in paper bags in a drying cabinet, placed in test tubes, and crushed with stainless steel beads using a TissueLyser II homogenizer (Qiagen, Stockach, Germany). The total genomic DNA was then extracted according to a cetrimonium bromide-based protocol [39].

2.7. KASP Marker for a Polymorphism Within NLP3-B1 Gene

The PCR mixture included 5 µL of the master mix, containing FAM, HEX, and ROX fluorescent dyes (KASP TF V4.0 2X Master Mix, KBS-1050-102, LCG Biosearch Techhnology, Teddington, UK), 5 µL of matrix DNA at a concentration of 50 ng/µL, and 0.14 µL of each primer (Table 1).
The 5′ primer extensions needed for the KASP-reaction are shown in lower case letters. The SNP-specific nucleotide is underscored. The expected PCR product length is 93 base pairs for primers without KASP-extensions. The melting temperature for primers (Tm) was calculated according to the Allawi and SantaLucia method [40].
The PCR conditions were as follows: initial denaturation at 94 °C for 15 min; 9 cycles: denaturation at 94 °C for 20 s, annealing and elongation—60 °C for 1 min, with a decrease in temperature by 0.6 °C each cycle; 35 cycles: denaturation at 94 °C for 20 s, annealing and elongation at 55 °C for 1 min; cooling to 37 °C for 1 min to read the fluorescence signal. The CFX96 amplifier device (BIO-RAD, Hercules, CA, USA) and CFX Manager version 3.1 software were used to perform reaction with this KASP (competitive allele specific PCR) marker. An example of an allele-discriminating diagram is shown in Figure 2.

2.8. PPD-D1 Marker

The PCR with primers Ppd-D1_F (ACGCCTCCCACTACACTG) combined with two reverse primers, Ppd-D1_R1 (GTTGGTTCAAACAGAGAGC) and Ppd-D1_R2 (CACTGGTGGTAGCTGAGATT) were used for detecting Ppd-D1a or Ppd-D1b alleles. The PCR conditions are described in the source article [1]. The 414 bp product was diagnostic for Ppd-D1b, while 288 bp was for the photoperiod-insensitive allele Ppd-D1a. The PCR products were separated by electrophoresis in 1.5% agarose gel with a TBE (Tris-Boric acid-EDTA) buffer, stained with ethidium bromide, and visualized under ultraviolet light.

2.9. Statistical Analysis

Only homozygous plants for PPD-D1 and NLP3-B1 markers were used for statistical analysis. Before factorial analysis of variance, the normality of distribution of each trait was accessed visually using distribution histograms. The data on each trait showing near-to-normal distribution were filtered using a three-median absolute deviation boundary. Factorial analysis of variance was conducted using Statistica 6.0 software taking PPD-D1 and NLP3-B1 genotypes and their interaction as factors, and p-values for the Fisher’s F-test were calculated. Bonferroni correction was used to establish new significance level α for multiple comparisons. After the ANOVA, the weighted means and confidence intervals were calculated for each PPD-D1, NLP3-B1 genotype. The normality of residuals was checked after the model was applied using the quantile–quantile-plots. For the ‘grain mass per plant’ trait, which does not follow normal distribution, the natural logarithm transformation was used. For the trait’s ‘number of spikelets per spike’, ‘number of fruiting tillers’, ‘number of internodes’, ‘heading date’, and ‘anthesis date’ a non-parametric χ2-test was applied to check the null hypothesis of independence of the plants occurring in different genotype and phenotype classes. Additionally, to visualize the data, box plots, combined with violin- and scatterplots were built using ‘matplotlib’ and ‘pandas’ libraries in python3 for each trait. The non-parametric Mann–Witney U test was conducted to find statistically significant differences between all genotype groups for each plot. The U-test p-values were corrected using the Benjamani–Hochberg false-discovery rate procedure [41] using statsmodels 0.15.0 library for python. The homogenous groups were marked on plots using corrected p-values at FDR = 0.05. The code used for creating plots is available at https://github.com/MikhailBazhenov/plots_with_U-test (accessed on 20 November 2024).

3. Results

3.1. Homology of Wheat NLP3-B1 to NLP Genes of Other Species

The conserved domain search using the NCBI CDD database showed that the TaNLP3 protein, similarly to all of NLP proteins in Arabidopsis, rice and maize, contained the conserved RWP-RK (pfam02042) and PB1 (cd06407 or cl02720) domains. AtNLP1, in addition, was predicted to carry the GAF domain (pfam13185). The phylogenetic analysis of NLP proteins showed that they could be clustered into three large groups. The wheat NLP3 proteins coded by the three homoeologous loci in B, A and D subgenomes all showed the greatest similarity to OsNLP3, and fell in the same large group with ZmNLP4 and ZmNLP8, AtNLP6 and AtNLP7 (Figure 3).

3.2. Polymorphism and Evolution of NLP3-B1 Gene

For evolutionary analysis of the NLP3-B1 gene (TraesCS3B02G190300) in wheat, we extracted its sequences from the 16 complete genomic assemblies of the wheat pangenome. By aligning and comparing the sequences with each other, five distinct haplotypes of the gene, together with their surrounding regions (±700 base pairs), were observed. We enumerated the haplotypes according to their frequences among 16 wheat accessions (Table 2). The unique haplotype (NLP3-B1_h5) of the wild emmer wheat Zavitan was distant from haplotypes of common and spelt wheat and could be used here as an outgroup (Figure 4).
Among common and spelt wheat, the most evolutionary new haplotype was the NLP3-B1_h3 one. It was found in Chinese Spring, Norin 61, and a spelt wheat PI 190962. The most frequent haplotype NLP3-B1_h1 was clustered with the third one. The most near to ancestral type was the second most frequent haplotype NLP3-B1_h2 (Table 2).
Among Wheat 10+ genomes project accessions, only wild emmer wheat Zavitan possessed seven missense mutations, which made its NLP3-B1 protein different. Other accessions showed identical predicted protein sequences. At the same time, in the coding sequence, there was a synonymous mutation of NLP3-B1: c.234T>C, which differed accessions possessing haplotype Nlp3-B1_h3 (Chinese Spring, Norin 61 and the spelt wheat PI 190962, having nucleotide variant T) from all other and the majority of accessions (having variant C). All other polymorphisms, predominantly single nucleotide polymorphisms (SNPs) and additionally insertions/deletions in Zavitan, were present either in non-coding regions of the gene, or in the intergenic spaces (possible cis-regulatory sequences).

3.3. Marker Development

A single nucleotide polymorphism c.1824+137G>A was found in the fourth intron of the NLP3-B1 gene, and it was most suitable for designing a KASP marker (NLP3-B1_G1824+137A) due to opportunity to make homeolog-specific primers. However, a polymorphism like c.1824+137G>A was also present between homoeologous genes (TraesCS3A02G159600 and TraesCS3D02G166900) (Figure 5). The variant ‘A’ of the single nucleotide polymorphism NLP3-B1: c.1824+137G>A was inherent only for haplotype NLP3-B1_h2 among the cultivated wheat species, thus it could be used as a marker for this haplotype (Table 2).

3.4. Marker-Trait Association Analysis Design

The initial aim of the PI-518620 x CI-17241 cross was to study the possible difference between Rht-B1b and Rht-B1p phenotypes; however, we found that these alleles show almost no significant differences on agronomical traits. As we found F5 hybrids of this cross to segregate for alleles of NLP3-B1 gene, we repurposed it for this study.
The phenotypic differences in parental lines are shown in Table 3. The CI-17241 line was a bit shorter, mainly due to shorter the second and the third internodes, possessed fewer spikelets in the spike, and a lower 1000 kernel weight. The CI-17241 line proceeded both to heading and anthesis 2 days earlier, then PI-518620.
The F5 population of the PI-518620 x CI-17241 cross also segregated for in PPD-D1 locus of photoperiod sensitivity. As PPD-D1 is a major locus affecting earliness and many other agronomical traits, we included it in our study as an additional factor. In this study, we estimated the effects of the two molecular markers (for NLP3-B1 and Ppd-D1 genes) and their interactions on about 15 traits (Supplementary Materials, Tables S1–S36, Figures S1–S18). Thus, we calculated about 45 Fisher’s F-test p-values in the factorial analysis (ANOVA). To reduce the amount of false-positive statistically significant results (type I errors), we applied the Bonferroni correction. If we take the basal level of significance at α = 0.05, the correction will give us the new level of significance α = 0.05/45 0.001.

3.5. The Effects of Ppd-D1 Alleles

The allele Ppd-D1a, associated with photoperiodic neutrality, statistically significantly reduced the plant height by 2.2 cm (−3.7%, p < 10−6), which includes a reduction in the length of the spike by 2 mm (−3%, p < 10−6), and a reduction in length of each of the internodes. The length of the first (upper) internode was reduced by 5 mm (−2%, p = 0.004, non-significantly), the second by 2 mm (−2%, p = 0.009, non-significantly), the third by 5 mm (−5%, p < 10−6), the fourth by 3 mm (−5%, p < 10−6), and the fifth by 3 mm (−13%, p < 10−6) in homozygous plants carrying Ppd-D1a in a comparison with the plants homozygous for Ppd-D1b. The number of internodes was not statistically significantly connected with PPD-D1 alleles (χ2-test p = 0.03). In total, up to six internodes were found in the measured plants; however, the sixth internode was not consistently present in the above-ground parts of the plant cut at the soil surface. Accordingly, Ppd-D1a reduced the mass of the main culm by 0.03 g (−6%, p < 10−6) in comparison to Ppd-D1b. The number of fruiting tillers was not significantly connected with PPD-D1 (χ2-test p = 0.15).
The weight of the unthreshed main spike at maturity (p = 0.002), the number of grains in main spike (p = 0.5), and the grain yield per plant (p = 0.01) were not significantly influenced by the Ppd-D1 gene. However, in plants carrying Ppd-D1a, the main spike grain weight was statistically significantly increased by 0.07 g (+7%, p = 2 × 10−4), the grain number in the spikelet increased by 0.16 grains (+8%, p < 10−6), and so did the 1000 kernel weight by 0.9 g (+2%, p = 3 × 10−5). At the same time, the number of spikelets per spike was statistically significantly decreased (χ2-test p = 4 × 10−14), on average for 1.5 spikelets, in plants carrying Ppd-D1a against Ppd-D1b. The spike density was also decreased by 0.3 spikelets per 10 cm of spike length (−1.3%, p = 0.001) in plants with Ppd-D1a. The harvest index was increased by Ppd-D1a by 0.02 points (+3.6%, p < 10−6).
Expectedly, the Ppd-D1 gene affected the rate of development of the plants, shifting the dates of heading and anthesis (Figure 6a,b). The plants carrying Ppd-D1a proceeded to heading 4.5 days earlier (χ2-test p = 9 × 10−29) and to anthesis 4 days earlier (χ2-test p = 1 × 10−92) on average, than those carrying Ppd-D1b.

3.6. Associations with NLP3-B1 Gene Marker

An SNP marker within NLP3-B1 gene was statistically significantly associated with plant height, and variant ‘A’ (NLP3-B1_h2) was connected with height decrease by 1.3 cm (−2%, p = 4 × 10−5). The decrease in plant height included the statistically significant decrease in spike length by 3 mm (−4%, p < 10−6), decrease in the upper (first) internode length by 9 mm (−4%, p < 10−6), decrease in the second internode length by 4 mm (−3%, p = 1.5 × 10−4). The fifth internode, on the contrary, was longer by 2 mm (+8%, p = 0.001) in plants carrying marker variant ‘A’. The length of the third and the fourthth internodes were not associated significantly with the SNP marker within the NLP3-3B gene. The NLP3-B1 SNP variant ‘A’ was associated with a higher spike density (+2.1%, p < 10−6) than variant ‘G’. The number of internodes in the main shoot (χ2-test p = 0.1) and number tillers per plant (χ2-test p = 0.56) were not significantly affected by NLP3-B1.
The main culm weight and grain yield parameters (unthreshed spike weight, gain weight per spike, grain wight per plant, number of grains in spike and in spikelet, 1000 kernel weight, harvest index) were not significantly associated with the SNP marker in the NLP3-B1 gene on average. The effects in interaction with Ppd-D1 will be described below.
Most significantly, the SNP marker within the NLP3-B1 gene was associated with the dates of heading and anthesis. In plants carrying the SNP variant ‘A’, the heading date was 2 days earlier (χ2-test p = 5 × 10−36) than in plants carrying the variant ‘G’, regardless of Ppd-D1. The anthesis date was also on average 2 days earlier (χ2-test p = 5 × 10−30) in plants carrying the variant ‘A’.

3.7. NLP3-3B Marker x Ppd-D1 Interactions

Statistically significant interactions between factors of the SNP marker in NLP3-3B gene and Ppd-D1 gene were observed for the length of the upper (1-st) internode (p = 4.5 × 10−5), number of grains in the main spike (p = 4.1 × 10−5), number of grains in spikelet (p = 9.6 × 10−5), and the date of anthesis (p = 1.3 × 10−5).
In the presence of NLP3-B1 SNP variant ‘A’, the length of the first internode was low and equal for both PPD-D1 alleles. In the presence of variant ‘G’, plants with Ppd-D1a showed a shorter internode (by 1.2 cm, 5% of average).
For the grain number in the main spike, an antagonistic interaction of PPD-D1 and NLP3-B1 was observed. In the presence of NLP3-B1 SNP variant ‘A’, Ppd-D1a increased the number of grains (by 1.8 grains, 7% of average), while in the presence of variant ‘G’, on the contrary, Ppd-D1a decreased the number of grains (by 1.3 grain, 5% of average) in comparison to Ppd-D1b.
For the grain number per spikelet, in the presence of NLP3-B1 SNP variant ‘G’, the difference between PPD-D1 alleles was not observed, while in the presence of variant ‘A’ Ppd-D1a increased, while Ppd-D1b decreased the average number of grains in the spikelet, and the difference between genotypes reached up to 0.24 grains per spikelet (13% of average).
For the anthesis date in the presence of Ppd-D1b (long-day allele), variant ‘A’ of the SNP in NLP3-B1 accelerated the onset of anthesis only for 1 day, while in the presence of Ppd-D1a (photoperiod-neutral allele), variant ‘A’ of the SNP in NLP3-B1 accelerated the anthesis for 3 days, acting synergistically with PPD-D1.

3.8. Other Earliness Gene Candidates on 3B Chromosome

Earlier two genes, Gigantea (GI) and Luminidependens (LD) were proposed as candidates for earliness genes in the 3B chromosome of wheat [42]. The BLAST-search in the RefSeq1.0 wheat genome using GenBank protein accession AAX51265.1 as a query showed that LD gene corresponds to TraesCS3B02G493200 (chr3B:738 746 256..738 755 316), while GI (GenBank: AAF00023.1) to TraesCS3B02G135400 (chr3B:117 923 139..117 931 738). Among other genes frequently mentioned in connection to flowering time in Arabidopsis and rice, TraesCS3B02G162000 (chr3B:158 715 454..158 719 538), somewhat similar to FT gene of Arabidopsis, is the nearest to NLP3-B1 TraesCS3B02G190300 (chr3B:202 924 220..202 930 635) (Table S37).

4. Discussion

The semi-dwarfism of the Chris Mutant line is explained by a mutation designated as Rht17 (Rht-B1p), which exhibited almost the same effect on plant height, grain yield and grain protein percentage as Rht2 (Rht-D1b) [43]. The majority of the gibberellin-insensitive dwarfing mutations, Rht-B1b, Rht-B1e, Rht-D1b, and Rht-B1p, share the same feature—a premature stop codon in the sequence that codes for the DELLA domain of the protein [44]. This suggests that they have the same mechanism of action. As we did not find significant differences in plant height between plants carrying Rht-B1b and Rht-B1p alleles in PI-518620 × CI-17241 cross, we decided not to include RHT1 gene as an additional factor in this study.
The main and agronomically significant effect of the photoperiod-neutral allele Ppd-D1a was earlier heading and anthesis, which aligns with previous findings [45]. Also, it showed some side effects, like plant height reduction with a more significant reduction in lower internodes, a smaller number of spikelets in spike, but a higher 1000 kernel weight, together resulting in a slightly higher grain mass in spike, and higher harvest index. The effects of Ppd-D1a on increasing 1000 kernel weight and decreasing the spikelets number per spike align with the results of previous findings [46]. However, in our study, these side effects on plant height and yield traits were minor (Figure S19) and not of direct practical significance. These side effects of Ppd-D1a could be suggested as either direct pleiotropic effects of the gene or the result of its tight linkage with Rht8 (Reduced height 8) gene [47].
Rice OsNLP3 is a transcription factor that plays a role in regulating the development of the inflorescence meristem. In rice, this gene positively regulates grain yield increasing panicle length and the number of branches, both primary and secondary, and consequently, an increase in the number of grains per panicle under conditions of adequate nitrogen availability [21]. Rice OsNLP3 was used as a template to find the NLP3-B1 gene in wheat. Predicted protein sequence of wheat NLP3-B1, expectedly was most similar to rice OsNLP3 among other NLP proteins of rice, maize, and Arabidopsis. Similarly to NLP proteins of other species, it was characterized by the presence of conserved domains RWP-RK and PB1, which are responsible for binding to DNA and protein–protein interactions, respectively [48].
In our study, the most significant finding was that polymorphism within the NLP3-B1 gene is associated with the dates of the heading and anthesis, working in synergy with PPD-D1 to provide a faster development rate. The earlier-heading haplotype (NLP3-B1_h2, diagnostic SNP variant ‘A’) was also associated with a bit reduced height, mainly due to upper internodes, and higher spike density. No changes in yield components or tillering were associated with the NLP3-B1 genotype. As we can see, PPD-D1 and NLP3-B1 genotypes are associated with development timing; however, their ‘side effects’ are different. Thus, we can assume, that NLP3-B1 (or some other linked candidate gene) works later than PPD-D1 in development, or it has a mechanism of action different from photoperiod sensitivity, like some earliness ‘per se’ genes. We should also note that while the haplotype NLP3-B1_h2 is associated with earlier anthesis, environmental factors also play a significant role in determining the timing of development.
Our results on NLP-B1 are in partial contradiction with findings on the homologous genes effects in rice, where variation in NLP genes were strongly associated with grain yield, panicle architecture and tillering [21,22,49]. We did not observe similar changes in wheat. Different sensitivity to nitrates could theoretically alter the plant development rate [17]. However, in previous studies of NLP genes in rice and barley such effects on earliness were not reported directly [21,22,49,50,51,52]. On the other hand, the photographs of the plants in [50] support our hypothesis that NLP can regulate flowering time in barley. In those photographs, the plants with reduced NLP expression show not only reduced growth, but also a delay in development.
The differences that we observed between NLP3-B1 haplotypes were in non-coding regions or were synonymous. Thus, the observed phenotypic effects could be ascribed not only to NLP3-B1 itself, but also to some other unknown linked gene, regulating plant development. Earlier, the chromosome 3B was characterized to carry earliness genes, that appear to influence earliness ‘per se’ rather than vernalization response, and possibly interact with photoperiod response genes [53]. Also, in a genome-wide association study some marker-trait associations for earliness were found on wheat chromosome 3B, and some candidate genes were proposed—among them Gigantea (GI) and Luminidependens (LD) [42]. Also, we found a gene TraesCS3B02G162000, similar to Arabidopsis gene FT, which is 44 Mega base pairs distant from NLP3-B1, and which is the nearest among other suggested flowering time genes candidates. To confirm the role NLP3-B1 in determining earliness in wheat, further studies of gene expression in parental forms and recombinant lines will be needed.

5. Conclusions

In this study, we found a new marker linked to earliness within the NLP3-B1 gene, coding a nitrate receptor protein, in wheat. The causal connection between NLP3-B1 variation and earliness is yet to be established. Nevertheless, our marker is ready to be used in wheat breeding. The SNP marker variant ‘A’, associated with the NLP3-B1_h2 haplotype, interacts positively with the Ppd-D1a allele, accelerating flowering time. These findings could be used to breed new early maturing wheat varieties that are better adapted to climate change.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy14122888/s1, Data S1: The genotypes and phenotypes of the wheat plants in F6 of PI-518620 × CI-17241 cross used in this study; Data S2: The sequences of the NLP3-B1 gene extracted from wheat genome assemblies of the wheat pangenome project used for phylogenetic tree construction; Data S3: The sequences of NLP proteins in Arabidopsis, rice, maize, along with TaNLP3 protein of wheat used for the phylogenetic tree construction; Supplementary Tables S1–S36: The results of the factorial analysis of variance for each trait and the group means; Figures S1–S18: Means with confidence intervals for each trait (a); quantile-quantile plots showing normality of residuals (b); Figure S19: The diagrams of agronomical traits in plants F6 of PI-518620 × CI-17241 spring wheat cross having different homozygous genotypes for the Ppd-D1 and NLP3-B1 genes; Table S37: The search for candidate genes for earliness on chromosome 3B in wheat.

Author Contributions

Conceptualization, G.K. and M.D.; methodology, A.K. and P.K.; software, M.B.; formal analysis, M.B.; investigation, L.N., T.M., O.P. and A.C.; resources, A.K.; writing—original draft preparation, M.B., L.N., T.M. and O.P.; writing—review and editing, A.C., A.K., P.K., G.K. and M.D.; visualization, M.B. and A.C.; supervision, G.K.; project administration, M.D.; funding acquisition, G.K. and M.D. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Ministry of Science and Higher Education of the Russian Federation, state assignment FGUM-2022-0001.

Data Availability Statement

The original contributions presented in the study are included in the article/Supplementary Material; further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Kiseleva, A.A.; Leonova, I.N.; Ageeva, E.V.; Likhenko, I.E.; Salina, E.A. Identification of Genetic Loci for Early Maturity in Spring Bread Wheat Using the Association Analysis and Gene Dissection. PeerJ 2023, 11, e16109. [Google Scholar] [CrossRef] [PubMed]
  2. Iqbal, M.; Navabi, A.; Salmon, D.F.; Yang, R.-C.; Spaner, D. A Genetic Examination of Early Flowering and Maturity in Canadian Spring Wheat. Can. J. Plant Sci. 2006, 86, 995–1004. [Google Scholar] [CrossRef]
  3. Shavrukov, Y.; Kurishbayev, A.; Jatayev, S.; Shvidchenko, V.; Zotova, L.; Koekemoer, F.; de Groot, S.; Soole, K.; Langridge, P. Early Flowering as a Drought Escape Mechanism in Plants: How Can It Aid Wheat Production? Front. Plant Sci. 2017, 8, 1950. [Google Scholar] [CrossRef]
  4. McIntosh, R.A.; Dubcovsky, J.; Rogers, W.J.; Morris, C.; Appels, R.; Xia, X.C. Catalogue of Gene Symbols for Wheat. In Proceedings of the 12th International Wheat Genetics Symposium, Yokohama, Japan, 8–14 September 2013. [Google Scholar]
  5. Dubcovsky, J.; Loukoianov, A.; Fu, D.; Valarik, M.; Sanchez, A.; Yan, L. Effect of Photoperiod on the Regulation of Wheat Vernalization Genes VRN1 and VRN2. Plant Mol. Biol. 2006, 60, 469–480. [Google Scholar] [CrossRef]
  6. Wang, X.; Zhou, P.; Huang, R.; Zhang, J.; Ouyang, X. A Daylength Recognition Model of Photoperiodic Flowering. Front. Plant Sci. 2021, 12, 778515. [Google Scholar] [CrossRef]
  7. Cane, K.; Eagles, H.A.; Laurie, D.A.; Trevaskis, B.; Vallance, N.; Eastwood, R.F.; Gororo, N.N.; Kuchel, H.; Martin, P.J.; Cane, K.; et al. Ppd-B1 and Ppd-D1 and Their Effects in Southern Australian Wheat. Crop Pasture Sci. 2013, 64, 100–114. [Google Scholar] [CrossRef]
  8. Guo, Z.; Song, Y.; Zhou, R.; Ren, Z.; Jia, J. Discovery, Evaluation and Distribution of Haplotypes of the Wheat Ppd-D1 Gene. New Phytol. 2010, 185, 841–851. [Google Scholar] [CrossRef] [PubMed]
  9. Beales, J.; Turner, A.; Griffiths, S.; Snape, J.W.; Laurie, D.A. A Pseudo-Response Regulator Is Misexpressed in the Photoperiod Insensitive Ppd-D1a Mutant of Wheat (Triticum aestivum L.). Theor. Appl. Genet. 2007, 115, 721–733. [Google Scholar] [CrossRef]
  10. Nemoto, Y.; Kisaka, M.; Fuse, T.; Yano, M.; Ogihara, Y. Characterization and Functional Analysis of Three Wheat Genes with Homology to the CONSTANS Flowering Time Gene in Transgenic Rice. Plant J. 2003, 36, 82–93. [Google Scholar] [CrossRef]
  11. Yan, L.; Loukoianov, A.; Tranquilli, G.; Helguera, M.; Fahima, T.; Dubcovsky, J. Positional Cloning of the Wheat Vernalization Gene VRN1. Proc. Natl. Acad. Sci. USA 2003, 100, 6263–6268. [Google Scholar] [CrossRef]
  12. Yan, L.; Fu, D.; Li, C.; Blechl, A.; Tranquilli, G.; Bonafede, M.; Sanchez, A.; Valarik, M.; Yasuda, S.; Dubcovsky, J. The Wheat and Barley Vernalization Gene VRN3 Is an Orthologue of FT. Proc. Natl. Acad. Sci. USA 2006, 103, 19581–19586. [Google Scholar] [CrossRef] [PubMed]
  13. Kane, N.A.; Agharbaoui, Z.; Diallo, A.O.; Adam, H.; Tominaga, Y.; Ouellet, F.; Sarhan, F. TaVRT2 Represses Transcription of the Wheat Vernalization Gene TaVRN1. Plant J. 2007, 51, 670–680. [Google Scholar] [CrossRef]
  14. Ochagavía, H.; Prieto, P.; Zikhali, M.; Griffiths, S.; Slafer, G.A. Earliness Per Se by Temperature Interaction on Wheat Development. Sci. Rep. 2019, 9, 2584. [Google Scholar] [CrossRef]
  15. Schmalenbach, I.; Zhang, L.; Reymond, M.; Jiménez-Gómez, J.M. The Relationship between Flowering Time and Growth Responses to Drought in the Arabidopsis Landsberg Erecta x Antwerp-1 Population. Front. Plant Sci. 2014, 5, 609. [Google Scholar] [CrossRef] [PubMed]
  16. Freytes, S.N.; Canelo, M.; Cerdán, P.D. Regulation of Flowering Time: When and Where? Curr. Opin. Plant Biol. 2021, 63, 102049. [Google Scholar] [CrossRef] [PubMed]
  17. Wang, M.; Wang, J.; Wang, Z.; Teng, Y. Nitrate Signaling and Its Role in Regulating Flowering Time in Arabidopsis Thaliana. Int. J. Mol. Sci. 2024, 25, 5310. [Google Scholar] [CrossRef] [PubMed]
  18. Jia, Y.; Qin, D.; Zheng, Y.; Wang, Y. Finding Balance in Adversity: Nitrate Signaling as the Key to Plant Growth, Resilience, and Stress Response. Int. J. Mol. Sci. 2023, 24, 14406. [Google Scholar] [CrossRef] [PubMed]
  19. Lin, Y.-L.; Tsay, Y.-F. Influence of Differing Nitrate and Nitrogen Availability on Flowering Control in Arabidopsis. J. Exp. Bot. 2017, 68, 2603–2609. [Google Scholar] [CrossRef]
  20. Sámano, M.L.; Nanjareddy, K.; Arthikala, M.-K. NIN-like Proteins (NLPs) as Crucial Nitrate Sensors: An Overview of Their Roles in Nitrogen Signaling, Symbiosis, Abiotic Stress, and Beyond. Physiol. Mol. Biol. Plants 2024, 30, 1209–1223. [Google Scholar] [CrossRef]
  21. Wu, J.; Sun, L.; Song, Y.; Bai, Y.; Wan, G.; Wang, J.; Xia, J.; Zhang, Z.; Zhang, Z.; Zhao, Z.; et al. The OsNLP3/4-OsRFL Module Regulates Nitrogen-promoted Panicle Architecture in Rice. New Phytol. 2023, 240, 2404–2418. [Google Scholar] [CrossRef]
  22. Zhang, Z.-S.; Xia, J.-Q.; Alfatih, A.; Song, Y.; Huang, Y.-J.; Sun, L.-Q.; Wan, G.-Y.; Wang, S.-M.; Wang, Y.-P.; Hu, B.-H.; et al. Rice NIN-LIKE PROTEIN 3 Modulates Nitrogen Use Efficiency and Grain Yield under Nitrate-Sufficient Conditions. Plant Cell Environ. 2022, 45, 1520–1536. [Google Scholar] [CrossRef] [PubMed]
  23. Allan, R.E. Registration of 16 Lines of Soft White Spring Wheat Germplasm. Crop Sci. 1989, 29, 1098–1099. [Google Scholar] [CrossRef]
  24. Heyne, E.G. Registration of Improved Wheat Varieties, XXIII. Agron. J. 1959, 51, 689–692. [Google Scholar] [CrossRef]
  25. Heiner, R.E.; Elsayed, F.A. Registration of MN6616M Wheat Germplasm1 (Reg. No. GP 36). Crop Sci. 1974, 14, 342. [Google Scholar] [CrossRef]
  26. Busch, R.H.; Elsayed, F.A.; Heiner, R.E. Effect of Daylength Insensitivity on Agronomic Traits and Gain Protein in Hard Spring Wheat. Crop Sci. 1984, 24, 1106–1109. [Google Scholar] [CrossRef]
  27. Komyshev, E.; Genaev, M.; Afonnikov, D. Evaluation of the SeedCounter, A Mobile Application for Grain Phenotyping. Front. Plant Sci. 2017, 7, 1990. [Google Scholar] [CrossRef]
  28. Walkowiak, S.; Gao, L.; Monat, C.; Haberer, G.; Kassa, M.T.; Brinton, J.; Ramirez-Gonzalez, R.H.; Kolodziej, M.C.; Delorean, E.; Thambugala, D.; et al. Multiple Wheat Genomes Reveal Global Variation in Modern Breeding. Nature 2020, 588, 277–283. [Google Scholar] [CrossRef]
  29. Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K.; Madden, T.L. BLAST+: Architecture and Applications. BMC Bioinform. 2009, 10, 421. [Google Scholar] [CrossRef]
  30. Alaux, M.; Rogers, J.; Letellier, T.; Flores, R.; Alfama, F.; Pommier, C.; Mohellibi, N.; Durand, S.; Kimmel, E.; Michotey, C.; et al. Linking the International Wheat Genome Sequencing Consortium Bread Wheat Reference Genome Sequence to Wheat Genetic and Phenomic Data. Genome Biol. 2018, 19, 111. [Google Scholar] [CrossRef]
  31. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
  32. Nicholas, K.B. GeneDoc: Analysis and Visualization of Genetic Variation. EMBnet.news 1997, 4, 14. [Google Scholar]
  33. Tamura, K.; Nei, M. Estimation of the Number of Nucleotide Substitutions in the Control Region of Mitochondrial DNA in Humans and Chimpanzees. Mol. Biol. Evol. 1993, 10, 512–526. [Google Scholar] [CrossRef] [PubMed]
  34. Ge, M.; Liu, Y.; Jiang, L.; Wang, Y.; Lv, Y.; Zhou, L.; Liang, S.; Bao, H.; Zhao, H. Genome-Wide Analysis of Maize NLP Transcription Factor Family Revealed the Roles in Nitrogen Response. Plant Growth Regul. 2018, 84, 95–105. [Google Scholar] [CrossRef]
  35. Edgar, R.C. MUSCLE: Multiple Sequence Alignment with High Accuracy and High Throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef] [PubMed]
  36. Jones, D.T.; Taylor, W.R.; Thornton, J.M. The Rapid Generation of Mutation Data Matrices from Protein Sequences. Comput. Appl. Biosci. CABIOS 1992, 8, 275–282. [Google Scholar] [CrossRef]
  37. Wang, J.; Chitsaz, F.; Derbyshire, M.K.; Gonzales, N.R.; Gwadz, M.; Lu, S.; Marchler, G.H.; Song, J.S.; Thanki, N.; Yamashita, R.A.; et al. The Conserved Domain Database in 2023. Nucleic Acids Res. 2023, 51, D384–D388. [Google Scholar] [CrossRef]
  38. Chen, H.; Song, X.; Shang, Q.; Feng, S.; Ge, W. CFVisual: An Interactive Desktop Platform for Drawing Gene Structure and Protein Architecture. BMC Bioinform. 2022, 23, 178. [Google Scholar] [CrossRef]
  39. Rogers, S.O.; Bendich, A.J. Extraction of Total Cellular DNA from Plants, Algae and Fungi. In Plant Molecular Biology Manual; Gelvin, S.B., Schilperoort, R.A., Eds.; Springer: Dordrecht, The Netherlands, 1994; pp. 183–190. ISBN 978-94-011-7654-5. [Google Scholar]
  40. Allawi, H.T.; SantaLucia, J. Thermodynamics and NMR of Internal G.T Mismatches DNA. Biochemistry 1997, 36, 10581–10594. [Google Scholar] [CrossRef]
  41. Benjamini, Y.; Hochberg, Y. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. J. R. Stat. Soc. Ser. B Stat. Methodol. 1995, 57, 289–300. [Google Scholar] [CrossRef]
  42. Le Gouis, J.; Bordes, J.; Ravel, C.; Heumez, E.; Faure, S.; Praud, S.; Galic, N.; Remoué, C.; Balfourier, F.; Allard, V.; et al. Genome-Wide Association Analysis to Identify Chromosomal Regions Determining Components of Earliness in Wheat. Theor. Appl. Genet. 2012, 124, 597–611. [Google Scholar] [CrossRef]
  43. Pepe, J.F.; Heiner, R.E. Influence of Two Different Dwarfing Sources on Yield and Protein Percentage in Semidwarf Wheat1. Crop Sci. 1975, 15, 637. [Google Scholar] [CrossRef]
  44. Bazhenov, M.S.; Divashuk, M.G.; Amagai, Y.; Watanabe, N.; Karlov, G.I. Isolation of the Dwarfing Rht-B1p (Rht17) Gene from Wheat and the Development of an Allele-Specific PCR Marker. Mol. Breed. 2015, 35, 213. [Google Scholar] [CrossRef]
  45. Balashova, I.; Fait, V. Allele Frequencies of Ppd-D1a, Ppd-B1a, and Ppd-B1c of Photoperiodic Sensitivity Genes in Spring Bread Wheat Varieties (Triticum aestivum L.) of Various Origin. Agric. Sci. Pract. 2021, 8, 3–13. [Google Scholar] [CrossRef]
  46. Arjona, J.M.; Royo, C.; Dreisigacker, S.; Ammar, K.; Villegas, D. Effect of Ppd-A1 and Ppd-B1 Allelic Variants on Grain Number and Thousand Kernel Weight of Durum Wheat and Their Impact on Final Grain Yield. Front. Plant Sci. 2018, 9, 888. [Google Scholar] [CrossRef] [PubMed]
  47. Worland, A.J.; Korzun, V.; Röder, M.S.; Ganal, M.W.; Law, C.N. Genetic Analysis of the Dwarfing Gene Rht8 in Wheat. Part II. The Distribution and Adaptive Significance of Allelic Variants at the Rht8 Locus of Wheat as Revealed by Microsatellite Screening. Theor. Appl. Genet. 1998, 96, 1110–1120. [Google Scholar] [CrossRef]
  48. Yan, D.; Nambara, E. Conserved and Unique Functions of NIN-like Proteins in Nitrate Sensing and Signaling. Plant Sci. 2023, 336, 111842. [Google Scholar] [CrossRef]
  49. Song, Y.; Wan, G.-Y.; Wang, J.-X.; Yu, L.-H.; Wu, J.; Xiang, C.-B. OsNLP4-OsD3 Module Integrates Nitrogen-Iron Nutrient Signals to Promote Rice Tillering by Repressing Strigolactone Signaling. bioRxiv 2023, 2023.02.28.530551. [Google Scholar] [CrossRef]
  50. Gao, Y.; Quan, S.; Lyu, B.; Tian, T.; Liu, Z.; Nie, Z.; Qi, S.; Jia, J.; Shu, J.; Groot, E.; et al. Barley Transcription Factor HvNLP2 Mediates Nitrate Signaling and Affects Nitrogen Use Efficiency. J. Exp. Bot. 2021, 73, 770–783. [Google Scholar] [CrossRef]
  51. Wu, J.; Zhang, Z.-S.; Xia, J.; Xia, J.-Q.; Alfatih, A.; Song, Y.; Yu, L.H.; Xiang, C.B. Rice NIN-LIKE PROTEIN 4 Plays a Pivotal Role in Nitrogen Use Efficiency. Plant Biotechnol. J. 2020, 19, 448–461. [Google Scholar] [CrossRef]
  52. Alfatih, A.; Wu, J.; Zhang, Z.-S.; Xia, J.-Q.; Jan, S.U.; Yu, L.H.; Xiang, C.B. Rice NIN-LIKE PROTEIN 1 Rapidly Responds to Nitrogen Deficiency and Improves Yield and Nitrogen Use Efficiency. J. Exp. Bot. 2020, 71, 6032–6042. [Google Scholar] [CrossRef]
  53. Košner, J.; Pánková, K. The Effect of Chromosome 3B Gene/s of Česká Přesívka on Vernalization Response, Photoperiod Sensitivity and Earliness of Wheat. Czech J. Genet. Plant Breed. 2002, 38, 41–49. [Google Scholar] [CrossRef]
Figure 1. Weather conditions of the field experiments in 2019 and climate averages (1961–1990) in Moscow (data provided by the Hydrometeorological Research Center of the Russian Federation).
Figure 1. Weather conditions of the field experiments in 2019 and climate averages (1961–1990) in Moscow (data provided by the Hydrometeorological Research Center of the Russian Federation).
Agronomy 14 02888 g001
Figure 2. An example of a visualization of the PCR results using a KASP marker. The samples located on the hexachlorofluorescein (HEX) axis (blue squares) contain the allele with nucleotide G, and the samples located on the 5(6)-carboxyfluorescein (FAM) axis (orange circles) contain allele with nucleotide A. Heterozygotes (green triangles) are located between them. The black diamond represents the no-template control. The RFU stands for Relative Fluorescence Units.
Figure 2. An example of a visualization of the PCR results using a KASP marker. The samples located on the hexachlorofluorescein (HEX) axis (blue squares) contain the allele with nucleotide G, and the samples located on the 5(6)-carboxyfluorescein (FAM) axis (orange circles) contain allele with nucleotide A. Heterozygotes (green triangles) are located between them. The black diamond represents the no-template control. The RFU stands for Relative Fluorescence Units.
Agronomy 14 02888 g002
Figure 3. The phylogenetic tree of NLP proteins in thale cress (Arabidopsis thaliana L., AtNLP), rice (Oryza sativa L. subsp. japonica, OsNLP), maize (Zea mays L., ZmNLP), and wheat (Triticum aestivum L., TaNLP3 group of homologs only). The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The percentage of trees in which the associated taxa clustered together is shown above the branches.
Figure 3. The phylogenetic tree of NLP proteins in thale cress (Arabidopsis thaliana L., AtNLP), rice (Oryza sativa L. subsp. japonica, OsNLP), maize (Zea mays L., ZmNLP), and wheat (Triticum aestivum L., TaNLP3 group of homologs only). The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The percentage of trees in which the associated taxa clustered together is shown above the branches.
Agronomy 14 02888 g003
Figure 4. Evolutionary analysis of wheat NLP3-B1 haplotypes by the Maximum Likelihood method. The tree with the highest log likelihood (−11,769.26) is shown. The percentage of trees in which the associated taxa clustered together is shown above the branches. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site.
Figure 4. Evolutionary analysis of wheat NLP3-B1 haplotypes by the Maximum Likelihood method. The tree with the highest log likelihood (−11,769.26) is shown. The percentage of trees in which the associated taxa clustered together is shown above the branches. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site.
Agronomy 14 02888 g004
Figure 5. The alignment of NLP3-B1 homeologs on chromosomes 3B, 3A, and 3D—the sequences complementary to the primers of the KASP marker NLP3-B1_G1824+137A are highlighted in green. The numbers over the sequences designate positions in the alignment, and asterisks (*) represent intermediate positions at each tenth nucleotide (a). The scheme of the gene showing exons (all boxes) and introns (lines), protein-coding sequences (thick orange boxes), and untranslated regions (thin blue boxes); the arrow shows the 3′ end direction of coded RNA. The position of the polymorphism used for a marker is indicated as vertical black line (b).
Figure 5. The alignment of NLP3-B1 homeologs on chromosomes 3B, 3A, and 3D—the sequences complementary to the primers of the KASP marker NLP3-B1_G1824+137A are highlighted in green. The numbers over the sequences designate positions in the alignment, and asterisks (*) represent intermediate positions at each tenth nucleotide (a). The scheme of the gene showing exons (all boxes) and introns (lines), protein-coding sequences (thick orange boxes), and untranslated regions (thin blue boxes); the arrow shows the 3′ end direction of coded RNA. The position of the polymorphism used for a marker is indicated as vertical black line (b).
Agronomy 14 02888 g005
Figure 6. The time between the dates of sowing and heading (a), sowing and anthesis (b) in wheat plants F5:6 of the of PI-518620 x CI-17241 intercross having different homozygous genotypes of the Ppd-D1 gene and an SNP marker within the NLP3-B1 gene. The boxes of the box plots extend from the first quartile (Q1) to the third quartile (Q3) of the data, with a line and notches at the median. The whiskers extend from the box to the farthest data point lying within 1.5 × the inter-quartile range (IQR = Q3 − Q1) from the box. The means are shown as black filled circles. Filtered (outlier) data points are represented as hollow circles. The violin plots represent the distribution form. All individual data are shown as small gray points. The groups that are significantly different from each other, as determined by the Mann–Whitney U-test with a false-discovery rate of 0.05, are indicated by different letters above the plots.
Figure 6. The time between the dates of sowing and heading (a), sowing and anthesis (b) in wheat plants F5:6 of the of PI-518620 x CI-17241 intercross having different homozygous genotypes of the Ppd-D1 gene and an SNP marker within the NLP3-B1 gene. The boxes of the box plots extend from the first quartile (Q1) to the third quartile (Q3) of the data, with a line and notches at the median. The whiskers extend from the box to the farthest data point lying within 1.5 × the inter-quartile range (IQR = Q3 − Q1) from the box. The means are shown as black filled circles. Filtered (outlier) data points are represented as hollow circles. The violin plots represent the distribution form. All individual data are shown as small gray points. The groups that are significantly different from each other, as determined by the Mann–Whitney U-test with a false-discovery rate of 0.05, are indicated by different letters above the plots.
Agronomy 14 02888 g006
Table 1. The KASP primers for detecting variants of the NLP3-B1 c.1824+137G>A polymorphism.
Table 1. The KASP primers for detecting variants of the NLP3-B1 c.1824+137G>A polymorphism.
PrimerSequence (5′->3′)Tm, °C
NLP3-B1_F1gaaggtcggagtcaacggattCTAGTCCTCTTGAATATGGATATCAG61.2
NLP3-B1_F2gaaggtgaccaagttcatgctCTAGTCCTCTTGAATATGGATATCAA60.9
NLP3-B1_RACATTTTGTTGCCATTTAAGCCC63.9
Table 2. NLP3-B1 gene haplotypes and state of an NLP3-B1 c.1824+137G>A SNP in accessions of the Wheat pangenome project.
Table 2. NLP3-B1 gene haplotypes and state of an NLP3-B1 c.1824+137G>A SNP in accessions of the Wheat pangenome project.
Accession NameSpeciesCountry of OriginHabitNLP3-B1 Gene HaplotypeNLP3-B1 c.1824+137G>A SNP
CadenzaTriticum aestivum L.UKspringh1G
JaggerTriticum aestivum L.USAwinterh1G
KronosTriticum durum Desf.USAspringh1G
MaceTriticum aestivum L.Australiawinterh1G
ParagonTriticum aestivum L.UKspringh1G
RobigusTriticum aestivum L.UKwinterh1G
JuliusTriticum aestivum L.Germanywinterh2A
LancerTriticum aestivum L.Australiaspringh2A
CDC LandmarkTriticum aestivum L.Canadaspringh2A
CDC StanleyTriticum aestivum L.Canadaspringh2A
SY MattisTriticum aestivum L.Francewinterh2A
Chinese SpringTriticum aestivum L.Chinaspringh3G
Norin 61Triticum aestivum L.Japanwinterh3G
PI 190962Triticum spelta L.Spainn/dh3G
ArinaLrForTriticum aestivum L.Switzerlandwinterh4G
ZavitanTriticum dicoccoides (Körn. Ex Asch. and Graebn.) Schweinf.Israeln/dh5A
The “n/d” means “no data”.
Table 3. The phenotypes of the parental lines PI-518620 and CI-17241 in 2019.
Table 3. The phenotypes of the parental lines PI-518620 and CI-17241 in 2019.
TraitPI-518620CI-17241t-Test p-Values
Plant height, cm57 ± 150 ± 10.018
Spike length, cm7.1 ± 0.26.6 ± 0.20.027
Spikelets in spike15.0 ± 0.412.8 ± 0.4<0.001
Tiller number2.0 ± 0.42.3 ± 0.40.194
Internode number4.8 ± 0.24.7 ± 0.20.261
Internode 1, cm19 ± 120 ± 10.418
Internode 2, cm14.4 ± 0.510.8 ± 0.50.005
Internode 3, cm8.9 ± 0.66.5 ± 0.6<0.001
Internode 4, cm5.2 ± 0.34.3 ± 0.30.020
Internode 5, cm2.1 ± 0.22.0 ± 0.20.820
Whole spike weight, g1.4 ± 0.11.2 ± 0.10.237
Culm weight, g0.53 ± 0.030.45 ± 0.030.080
Grain number in spike22 ± 420 ± 40.397
Grain weight in spike, g0.9 ± 0.10.7 ± 0.10.116
Plant grain weight, g1.4 ± 0.21.3 ± 0.20.845
1000 kernel weight, g38 ± 134 ± 10.003
Spike density, spikelets/10 cm21 ± 120 ± 10.033
Harvest index0.4 ± 0.10.4 ± 0.10.105
Time of heading, days57 ± 255 ± 20.046
Time of anthesis, days62 ± 060 ± 0<0.001
The 95% confidence intervals are provided for each mean value.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Bazhenov, M.; Nazarova, L.; Mokhov, T.; Pukhova, O.; Chernook, A.; Kocheshkova, A.; Kroupin, P.; Karlov, G.; Divashuk, M. A Molecular Marker Within the NLP3-B1 Gene Is Associated with Earliness in Spring Wheat (Triticum aestivum L.). Agronomy 2024, 14, 2888. https://doi.org/10.3390/agronomy14122888

AMA Style

Bazhenov M, Nazarova L, Mokhov T, Pukhova O, Chernook A, Kocheshkova A, Kroupin P, Karlov G, Divashuk M. A Molecular Marker Within the NLP3-B1 Gene Is Associated with Earliness in Spring Wheat (Triticum aestivum L.). Agronomy. 2024; 14(12):2888. https://doi.org/10.3390/agronomy14122888

Chicago/Turabian Style

Bazhenov, Mikhail, Lyubov Nazarova, Timofey Mokhov, Olga Pukhova, Anastasiya Chernook, Alina Kocheshkova, Pavel Kroupin, Gennady Karlov, and Mikhail Divashuk. 2024. "A Molecular Marker Within the NLP3-B1 Gene Is Associated with Earliness in Spring Wheat (Triticum aestivum L.)" Agronomy 14, no. 12: 2888. https://doi.org/10.3390/agronomy14122888

APA Style

Bazhenov, M., Nazarova, L., Mokhov, T., Pukhova, O., Chernook, A., Kocheshkova, A., Kroupin, P., Karlov, G., & Divashuk, M. (2024). A Molecular Marker Within the NLP3-B1 Gene Is Associated with Earliness in Spring Wheat (Triticum aestivum L.). Agronomy, 14(12), 2888. https://doi.org/10.3390/agronomy14122888

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop