A Molecular Marker Within the NLP3-B1 Gene Is Associated with Earliness in Spring Wheat (Triticum aestivum L.)
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Field Experiment
2.3. Plant Phenotyping
2.4. Exploration of NLP3-B1 Haplotypes
2.5. Evolutionary Position of Wheat NLP3-B1 Protein
2.6. DNA Extraction
2.7. KASP Marker for a Polymorphism Within NLP3-B1 Gene
2.8. PPD-D1 Marker
2.9. Statistical Analysis
3. Results
3.1. Homology of Wheat NLP3-B1 to NLP Genes of Other Species
3.2. Polymorphism and Evolution of NLP3-B1 Gene
3.3. Marker Development
3.4. Marker-Trait Association Analysis Design
3.5. The Effects of Ppd-D1 Alleles
3.6. Associations with NLP3-B1 Gene Marker
3.7. NLP3-3B Marker x Ppd-D1 Interactions
3.8. Other Earliness Gene Candidates on 3B Chromosome
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Kiseleva, A.A.; Leonova, I.N.; Ageeva, E.V.; Likhenko, I.E.; Salina, E.A. Identification of Genetic Loci for Early Maturity in Spring Bread Wheat Using the Association Analysis and Gene Dissection. PeerJ 2023, 11, e16109. [Google Scholar] [CrossRef] [PubMed]
- Iqbal, M.; Navabi, A.; Salmon, D.F.; Yang, R.-C.; Spaner, D. A Genetic Examination of Early Flowering and Maturity in Canadian Spring Wheat. Can. J. Plant Sci. 2006, 86, 995–1004. [Google Scholar] [CrossRef]
- Shavrukov, Y.; Kurishbayev, A.; Jatayev, S.; Shvidchenko, V.; Zotova, L.; Koekemoer, F.; de Groot, S.; Soole, K.; Langridge, P. Early Flowering as a Drought Escape Mechanism in Plants: How Can It Aid Wheat Production? Front. Plant Sci. 2017, 8, 1950. [Google Scholar] [CrossRef]
- McIntosh, R.A.; Dubcovsky, J.; Rogers, W.J.; Morris, C.; Appels, R.; Xia, X.C. Catalogue of Gene Symbols for Wheat. In Proceedings of the 12th International Wheat Genetics Symposium, Yokohama, Japan, 8–14 September 2013. [Google Scholar]
- Dubcovsky, J.; Loukoianov, A.; Fu, D.; Valarik, M.; Sanchez, A.; Yan, L. Effect of Photoperiod on the Regulation of Wheat Vernalization Genes VRN1 and VRN2. Plant Mol. Biol. 2006, 60, 469–480. [Google Scholar] [CrossRef]
- Wang, X.; Zhou, P.; Huang, R.; Zhang, J.; Ouyang, X. A Daylength Recognition Model of Photoperiodic Flowering. Front. Plant Sci. 2021, 12, 778515. [Google Scholar] [CrossRef]
- Cane, K.; Eagles, H.A.; Laurie, D.A.; Trevaskis, B.; Vallance, N.; Eastwood, R.F.; Gororo, N.N.; Kuchel, H.; Martin, P.J.; Cane, K.; et al. Ppd-B1 and Ppd-D1 and Their Effects in Southern Australian Wheat. Crop Pasture Sci. 2013, 64, 100–114. [Google Scholar] [CrossRef]
- Guo, Z.; Song, Y.; Zhou, R.; Ren, Z.; Jia, J. Discovery, Evaluation and Distribution of Haplotypes of the Wheat Ppd-D1 Gene. New Phytol. 2010, 185, 841–851. [Google Scholar] [CrossRef] [PubMed]
- Beales, J.; Turner, A.; Griffiths, S.; Snape, J.W.; Laurie, D.A. A Pseudo-Response Regulator Is Misexpressed in the Photoperiod Insensitive Ppd-D1a Mutant of Wheat (Triticum aestivum L.). Theor. Appl. Genet. 2007, 115, 721–733. [Google Scholar] [CrossRef]
- Nemoto, Y.; Kisaka, M.; Fuse, T.; Yano, M.; Ogihara, Y. Characterization and Functional Analysis of Three Wheat Genes with Homology to the CONSTANS Flowering Time Gene in Transgenic Rice. Plant J. 2003, 36, 82–93. [Google Scholar] [CrossRef]
- Yan, L.; Loukoianov, A.; Tranquilli, G.; Helguera, M.; Fahima, T.; Dubcovsky, J. Positional Cloning of the Wheat Vernalization Gene VRN1. Proc. Natl. Acad. Sci. USA 2003, 100, 6263–6268. [Google Scholar] [CrossRef]
- Yan, L.; Fu, D.; Li, C.; Blechl, A.; Tranquilli, G.; Bonafede, M.; Sanchez, A.; Valarik, M.; Yasuda, S.; Dubcovsky, J. The Wheat and Barley Vernalization Gene VRN3 Is an Orthologue of FT. Proc. Natl. Acad. Sci. USA 2006, 103, 19581–19586. [Google Scholar] [CrossRef] [PubMed]
- Kane, N.A.; Agharbaoui, Z.; Diallo, A.O.; Adam, H.; Tominaga, Y.; Ouellet, F.; Sarhan, F. TaVRT2 Represses Transcription of the Wheat Vernalization Gene TaVRN1. Plant J. 2007, 51, 670–680. [Google Scholar] [CrossRef]
- Ochagavía, H.; Prieto, P.; Zikhali, M.; Griffiths, S.; Slafer, G.A. Earliness Per Se by Temperature Interaction on Wheat Development. Sci. Rep. 2019, 9, 2584. [Google Scholar] [CrossRef]
- Schmalenbach, I.; Zhang, L.; Reymond, M.; Jiménez-Gómez, J.M. The Relationship between Flowering Time and Growth Responses to Drought in the Arabidopsis Landsberg Erecta x Antwerp-1 Population. Front. Plant Sci. 2014, 5, 609. [Google Scholar] [CrossRef] [PubMed]
- Freytes, S.N.; Canelo, M.; Cerdán, P.D. Regulation of Flowering Time: When and Where? Curr. Opin. Plant Biol. 2021, 63, 102049. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Wang, J.; Wang, Z.; Teng, Y. Nitrate Signaling and Its Role in Regulating Flowering Time in Arabidopsis Thaliana. Int. J. Mol. Sci. 2024, 25, 5310. [Google Scholar] [CrossRef] [PubMed]
- Jia, Y.; Qin, D.; Zheng, Y.; Wang, Y. Finding Balance in Adversity: Nitrate Signaling as the Key to Plant Growth, Resilience, and Stress Response. Int. J. Mol. Sci. 2023, 24, 14406. [Google Scholar] [CrossRef] [PubMed]
- Lin, Y.-L.; Tsay, Y.-F. Influence of Differing Nitrate and Nitrogen Availability on Flowering Control in Arabidopsis. J. Exp. Bot. 2017, 68, 2603–2609. [Google Scholar] [CrossRef]
- Sámano, M.L.; Nanjareddy, K.; Arthikala, M.-K. NIN-like Proteins (NLPs) as Crucial Nitrate Sensors: An Overview of Their Roles in Nitrogen Signaling, Symbiosis, Abiotic Stress, and Beyond. Physiol. Mol. Biol. Plants 2024, 30, 1209–1223. [Google Scholar] [CrossRef]
- Wu, J.; Sun, L.; Song, Y.; Bai, Y.; Wan, G.; Wang, J.; Xia, J.; Zhang, Z.; Zhang, Z.; Zhao, Z.; et al. The OsNLP3/4-OsRFL Module Regulates Nitrogen-promoted Panicle Architecture in Rice. New Phytol. 2023, 240, 2404–2418. [Google Scholar] [CrossRef]
- Zhang, Z.-S.; Xia, J.-Q.; Alfatih, A.; Song, Y.; Huang, Y.-J.; Sun, L.-Q.; Wan, G.-Y.; Wang, S.-M.; Wang, Y.-P.; Hu, B.-H.; et al. Rice NIN-LIKE PROTEIN 3 Modulates Nitrogen Use Efficiency and Grain Yield under Nitrate-Sufficient Conditions. Plant Cell Environ. 2022, 45, 1520–1536. [Google Scholar] [CrossRef] [PubMed]
- Allan, R.E. Registration of 16 Lines of Soft White Spring Wheat Germplasm. Crop Sci. 1989, 29, 1098–1099. [Google Scholar] [CrossRef]
- Heyne, E.G. Registration of Improved Wheat Varieties, XXIII. Agron. J. 1959, 51, 689–692. [Google Scholar] [CrossRef]
- Heiner, R.E.; Elsayed, F.A. Registration of MN6616M Wheat Germplasm1 (Reg. No. GP 36). Crop Sci. 1974, 14, 342. [Google Scholar] [CrossRef]
- Busch, R.H.; Elsayed, F.A.; Heiner, R.E. Effect of Daylength Insensitivity on Agronomic Traits and Gain Protein in Hard Spring Wheat. Crop Sci. 1984, 24, 1106–1109. [Google Scholar] [CrossRef]
- Komyshev, E.; Genaev, M.; Afonnikov, D. Evaluation of the SeedCounter, A Mobile Application for Grain Phenotyping. Front. Plant Sci. 2017, 7, 1990. [Google Scholar] [CrossRef]
- Walkowiak, S.; Gao, L.; Monat, C.; Haberer, G.; Kassa, M.T.; Brinton, J.; Ramirez-Gonzalez, R.H.; Kolodziej, M.C.; Delorean, E.; Thambugala, D.; et al. Multiple Wheat Genomes Reveal Global Variation in Modern Breeding. Nature 2020, 588, 277–283. [Google Scholar] [CrossRef]
- Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K.; Madden, T.L. BLAST+: Architecture and Applications. BMC Bioinform. 2009, 10, 421. [Google Scholar] [CrossRef]
- Alaux, M.; Rogers, J.; Letellier, T.; Flores, R.; Alfama, F.; Pommier, C.; Mohellibi, N.; Durand, S.; Kimmel, E.; Michotey, C.; et al. Linking the International Wheat Genome Sequencing Consortium Bread Wheat Reference Genome Sequence to Wheat Genetic and Phenomic Data. Genome Biol. 2018, 19, 111. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- Nicholas, K.B. GeneDoc: Analysis and Visualization of Genetic Variation. EMBnet.news 1997, 4, 14. [Google Scholar]
- Tamura, K.; Nei, M. Estimation of the Number of Nucleotide Substitutions in the Control Region of Mitochondrial DNA in Humans and Chimpanzees. Mol. Biol. Evol. 1993, 10, 512–526. [Google Scholar] [CrossRef] [PubMed]
- Ge, M.; Liu, Y.; Jiang, L.; Wang, Y.; Lv, Y.; Zhou, L.; Liang, S.; Bao, H.; Zhao, H. Genome-Wide Analysis of Maize NLP Transcription Factor Family Revealed the Roles in Nitrogen Response. Plant Growth Regul. 2018, 84, 95–105. [Google Scholar] [CrossRef]
- Edgar, R.C. MUSCLE: Multiple Sequence Alignment with High Accuracy and High Throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef] [PubMed]
- Jones, D.T.; Taylor, W.R.; Thornton, J.M. The Rapid Generation of Mutation Data Matrices from Protein Sequences. Comput. Appl. Biosci. CABIOS 1992, 8, 275–282. [Google Scholar] [CrossRef]
- Wang, J.; Chitsaz, F.; Derbyshire, M.K.; Gonzales, N.R.; Gwadz, M.; Lu, S.; Marchler, G.H.; Song, J.S.; Thanki, N.; Yamashita, R.A.; et al. The Conserved Domain Database in 2023. Nucleic Acids Res. 2023, 51, D384–D388. [Google Scholar] [CrossRef]
- Chen, H.; Song, X.; Shang, Q.; Feng, S.; Ge, W. CFVisual: An Interactive Desktop Platform for Drawing Gene Structure and Protein Architecture. BMC Bioinform. 2022, 23, 178. [Google Scholar] [CrossRef]
- Rogers, S.O.; Bendich, A.J. Extraction of Total Cellular DNA from Plants, Algae and Fungi. In Plant Molecular Biology Manual; Gelvin, S.B., Schilperoort, R.A., Eds.; Springer: Dordrecht, The Netherlands, 1994; pp. 183–190. ISBN 978-94-011-7654-5. [Google Scholar]
- Allawi, H.T.; SantaLucia, J. Thermodynamics and NMR of Internal G.T Mismatches DNA. Biochemistry 1997, 36, 10581–10594. [Google Scholar] [CrossRef]
- Benjamini, Y.; Hochberg, Y. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. J. R. Stat. Soc. Ser. B Stat. Methodol. 1995, 57, 289–300. [Google Scholar] [CrossRef]
- Le Gouis, J.; Bordes, J.; Ravel, C.; Heumez, E.; Faure, S.; Praud, S.; Galic, N.; Remoué, C.; Balfourier, F.; Allard, V.; et al. Genome-Wide Association Analysis to Identify Chromosomal Regions Determining Components of Earliness in Wheat. Theor. Appl. Genet. 2012, 124, 597–611. [Google Scholar] [CrossRef]
- Pepe, J.F.; Heiner, R.E. Influence of Two Different Dwarfing Sources on Yield and Protein Percentage in Semidwarf Wheat1. Crop Sci. 1975, 15, 637. [Google Scholar] [CrossRef]
- Bazhenov, M.S.; Divashuk, M.G.; Amagai, Y.; Watanabe, N.; Karlov, G.I. Isolation of the Dwarfing Rht-B1p (Rht17) Gene from Wheat and the Development of an Allele-Specific PCR Marker. Mol. Breed. 2015, 35, 213. [Google Scholar] [CrossRef]
- Balashova, I.; Fait, V. Allele Frequencies of Ppd-D1a, Ppd-B1a, and Ppd-B1c of Photoperiodic Sensitivity Genes in Spring Bread Wheat Varieties (Triticum aestivum L.) of Various Origin. Agric. Sci. Pract. 2021, 8, 3–13. [Google Scholar] [CrossRef]
- Arjona, J.M.; Royo, C.; Dreisigacker, S.; Ammar, K.; Villegas, D. Effect of Ppd-A1 and Ppd-B1 Allelic Variants on Grain Number and Thousand Kernel Weight of Durum Wheat and Their Impact on Final Grain Yield. Front. Plant Sci. 2018, 9, 888. [Google Scholar] [CrossRef] [PubMed]
- Worland, A.J.; Korzun, V.; Röder, M.S.; Ganal, M.W.; Law, C.N. Genetic Analysis of the Dwarfing Gene Rht8 in Wheat. Part II. The Distribution and Adaptive Significance of Allelic Variants at the Rht8 Locus of Wheat as Revealed by Microsatellite Screening. Theor. Appl. Genet. 1998, 96, 1110–1120. [Google Scholar] [CrossRef]
- Yan, D.; Nambara, E. Conserved and Unique Functions of NIN-like Proteins in Nitrate Sensing and Signaling. Plant Sci. 2023, 336, 111842. [Google Scholar] [CrossRef]
- Song, Y.; Wan, G.-Y.; Wang, J.-X.; Yu, L.-H.; Wu, J.; Xiang, C.-B. OsNLP4-OsD3 Module Integrates Nitrogen-Iron Nutrient Signals to Promote Rice Tillering by Repressing Strigolactone Signaling. bioRxiv 2023, 2023.02.28.530551. [Google Scholar] [CrossRef]
- Gao, Y.; Quan, S.; Lyu, B.; Tian, T.; Liu, Z.; Nie, Z.; Qi, S.; Jia, J.; Shu, J.; Groot, E.; et al. Barley Transcription Factor HvNLP2 Mediates Nitrate Signaling and Affects Nitrogen Use Efficiency. J. Exp. Bot. 2021, 73, 770–783. [Google Scholar] [CrossRef]
- Wu, J.; Zhang, Z.-S.; Xia, J.; Xia, J.-Q.; Alfatih, A.; Song, Y.; Yu, L.H.; Xiang, C.B. Rice NIN-LIKE PROTEIN 4 Plays a Pivotal Role in Nitrogen Use Efficiency. Plant Biotechnol. J. 2020, 19, 448–461. [Google Scholar] [CrossRef]
- Alfatih, A.; Wu, J.; Zhang, Z.-S.; Xia, J.-Q.; Jan, S.U.; Yu, L.H.; Xiang, C.B. Rice NIN-LIKE PROTEIN 1 Rapidly Responds to Nitrogen Deficiency and Improves Yield and Nitrogen Use Efficiency. J. Exp. Bot. 2020, 71, 6032–6042. [Google Scholar] [CrossRef]
- Košner, J.; Pánková, K. The Effect of Chromosome 3B Gene/s of Česká Přesívka on Vernalization Response, Photoperiod Sensitivity and Earliness of Wheat. Czech J. Genet. Plant Breed. 2002, 38, 41–49. [Google Scholar] [CrossRef]






| Primer | Sequence (5′->3′) | Tm, °C |
|---|---|---|
| NLP3-B1_F1 | gaaggtcggagtcaacggattCTAGTCCTCTTGAATATGGATATCAG | 61.2 |
| NLP3-B1_F2 | gaaggtgaccaagttcatgctCTAGTCCTCTTGAATATGGATATCAA | 60.9 |
| NLP3-B1_R | ACATTTTGTTGCCATTTAAGCCC | 63.9 |
| Accession Name | Species | Country of Origin | Habit | NLP3-B1 Gene Haplotype | NLP3-B1 c.1824+137G>A SNP |
|---|---|---|---|---|---|
| Cadenza | Triticum aestivum L. | UK | spring | h1 | G |
| Jagger | Triticum aestivum L. | USA | winter | h1 | G |
| Kronos | Triticum durum Desf. | USA | spring | h1 | G |
| Mace | Triticum aestivum L. | Australia | winter | h1 | G |
| Paragon | Triticum aestivum L. | UK | spring | h1 | G |
| Robigus | Triticum aestivum L. | UK | winter | h1 | G |
| Julius | Triticum aestivum L. | Germany | winter | h2 | A |
| Lancer | Triticum aestivum L. | Australia | spring | h2 | A |
| CDC Landmark | Triticum aestivum L. | Canada | spring | h2 | A |
| CDC Stanley | Triticum aestivum L. | Canada | spring | h2 | A |
| SY Mattis | Triticum aestivum L. | France | winter | h2 | A |
| Chinese Spring | Triticum aestivum L. | China | spring | h3 | G |
| Norin 61 | Triticum aestivum L. | Japan | winter | h3 | G |
| PI 190962 | Triticum spelta L. | Spain | n/d | h3 | G |
| ArinaLrFor | Triticum aestivum L. | Switzerland | winter | h4 | G |
| Zavitan | Triticum dicoccoides (Körn. Ex Asch. and Graebn.) Schweinf. | Israel | n/d | h5 | A |
| Trait | PI-518620 | CI-17241 | t-Test p-Values |
|---|---|---|---|
| Plant height, cm | 57 ± 1 | 50 ± 1 | 0.018 |
| Spike length, cm | 7.1 ± 0.2 | 6.6 ± 0.2 | 0.027 |
| Spikelets in spike | 15.0 ± 0.4 | 12.8 ± 0.4 | <0.001 |
| Tiller number | 2.0 ± 0.4 | 2.3 ± 0.4 | 0.194 |
| Internode number | 4.8 ± 0.2 | 4.7 ± 0.2 | 0.261 |
| Internode 1, cm | 19 ± 1 | 20 ± 1 | 0.418 |
| Internode 2, cm | 14.4 ± 0.5 | 10.8 ± 0.5 | 0.005 |
| Internode 3, cm | 8.9 ± 0.6 | 6.5 ± 0.6 | <0.001 |
| Internode 4, cm | 5.2 ± 0.3 | 4.3 ± 0.3 | 0.020 |
| Internode 5, cm | 2.1 ± 0.2 | 2.0 ± 0.2 | 0.820 |
| Whole spike weight, g | 1.4 ± 0.1 | 1.2 ± 0.1 | 0.237 |
| Culm weight, g | 0.53 ± 0.03 | 0.45 ± 0.03 | 0.080 |
| Grain number in spike | 22 ± 4 | 20 ± 4 | 0.397 |
| Grain weight in spike, g | 0.9 ± 0.1 | 0.7 ± 0.1 | 0.116 |
| Plant grain weight, g | 1.4 ± 0.2 | 1.3 ± 0.2 | 0.845 |
| 1000 kernel weight, g | 38 ± 1 | 34 ± 1 | 0.003 |
| Spike density, spikelets/10 cm | 21 ± 1 | 20 ± 1 | 0.033 |
| Harvest index | 0.4 ± 0.1 | 0.4 ± 0.1 | 0.105 |
| Time of heading, days | 57 ± 2 | 55 ± 2 | 0.046 |
| Time of anthesis, days | 62 ± 0 | 60 ± 0 | <0.001 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bazhenov, M.; Nazarova, L.; Mokhov, T.; Pukhova, O.; Chernook, A.; Kocheshkova, A.; Kroupin, P.; Karlov, G.; Divashuk, M. A Molecular Marker Within the NLP3-B1 Gene Is Associated with Earliness in Spring Wheat (Triticum aestivum L.). Agronomy 2024, 14, 2888. https://doi.org/10.3390/agronomy14122888
Bazhenov M, Nazarova L, Mokhov T, Pukhova O, Chernook A, Kocheshkova A, Kroupin P, Karlov G, Divashuk M. A Molecular Marker Within the NLP3-B1 Gene Is Associated with Earliness in Spring Wheat (Triticum aestivum L.). Agronomy. 2024; 14(12):2888. https://doi.org/10.3390/agronomy14122888
Chicago/Turabian StyleBazhenov, Mikhail, Lyubov Nazarova, Timofey Mokhov, Olga Pukhova, Anastasiya Chernook, Alina Kocheshkova, Pavel Kroupin, Gennady Karlov, and Mikhail Divashuk. 2024. "A Molecular Marker Within the NLP3-B1 Gene Is Associated with Earliness in Spring Wheat (Triticum aestivum L.)" Agronomy 14, no. 12: 2888. https://doi.org/10.3390/agronomy14122888
APA StyleBazhenov, M., Nazarova, L., Mokhov, T., Pukhova, O., Chernook, A., Kocheshkova, A., Kroupin, P., Karlov, G., & Divashuk, M. (2024). A Molecular Marker Within the NLP3-B1 Gene Is Associated with Earliness in Spring Wheat (Triticum aestivum L.). Agronomy, 14(12), 2888. https://doi.org/10.3390/agronomy14122888

