CRISPR/Cas9-Mediated Genome Editing of Soluble Starch Synthesis Enzyme in Rice for Low Glycemic Index

Abstract

In the present study, the selected rice (Oryza sativa cv. indica) was genetically modified to increase the amylose content in the seeds. The ‘CRISPR-Cas9’ genome-editing tool was used to knock out three isoforms of soluble starch synthase (SSS) viz. SSSII-1, SSSII-2 and SSSII-3. A genetic transformation vector designed with appropriate gRNAs, Cas9, and antibiotic resistance was used to create SSS knockout mutants to enrich the content of amylose. Putative rice mutants were developed with high amylose content in the seeds of up to 63% as compared to 23% in the wild types (control). Rice with a low Glycemic Index (GI) value and high amylose content rice is preferred to avoid a sudden rise in glucose in the bloodstream. The frequencies of bi-allelic or homozygous transgenic lines of SSSII-1, SSSII-2, and SSSII-3 in the first generation were tested via the Mendelian fashion of segregated bi-allelic lines in the T₁ generation of the putative rice mutants. The T₁ generation segregation showed a frame-shift mutation. A molecular characterization of the putative mutants successfully demonstrated the development of a Cas9-free rice mutant with a higher amount of amylose in the rice.

1. Introduction

There are many human diseases that are linked to the composition of the diet consumed. Among such diseases, diabetes is one that needs strict diet management [1,2]. Therefore, more attention is needed for a human to stay healthy, which can be managed through a restricted intake of rather harmful carbohydrates [3]. In this direction, research is being conducted to produce plants with customized safe food to reduce the risk of disease and gain wide acceptability. Dietary starch is classified into two types, viz., rapidly digested starch and slowly digested starch [4]. Resistant starch (RS) is resistant to starch digestion and reaches the colon partially digested or undigested [5,6]. Resistant starch is rich in amylose content as found in cereal grains [3]. Therefore, rapidly digestible starch subsequently leads to a high rise in blood sugar and is known as high glycemic index (GI) starch. Thus, starch with a high GI poses the threat of diabetes type II to healthy individuals and proves extremely harmful for existing patients of the same disease. If starch has a high amylose content that reduces the rapid rise in blood sugar and the promotion of short fatty acids in the colon tissue to keep it healthy [1]. The rice kernel consists of approximately 90% starch, which is in turn generally made of two polymer types of glucose, namely, amylose and amylopectin. Amylose (approximately 20–30% of starch) is composed of α-d-glucose units bonded through an α (1→4) glycosidic linkage and has an inferior degree of polymerization. Amylopectin (approximately 70–80% of starch) has a large number of branched chains with α (1→6) glycosidic linkages and a larger degree of polymerization. In cooked rice, amylose resists digestion, while amylopectin is quickly digested. Thus, rice with a high amylose content is known as resistant rice [1,7]. The amount of amylose and amylopectin in the starch of rice depends on the variety [8]. Starch synthase (EC 2.4.1.21) has three isoforms: SSSII-1, 2, and 3 [9,10,11]. The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 system (Cas9) [2] may be used to increase the amount of amylose in the starch [2] by generating knockouts of SSSII-1, 2, and 3. Thus, a high amount of amylose can be produced in rice that is generally missing in cereal crops [1]. Although many tools for targeted mutagenesis are available, Cas9 nucleases are easy, efficient, and precise players that depend upon site-specific recombinases and nuclease-free homologous recombination [1,12,13,14]. The SSS-II 1, 2, and 3 gene expression cassette was cloned into a plant transformation vector, pMDC99, employing the Gateway™ technology. The expression cassette pMDC99 was transferred into Indica rice through Agrobacterium-mediated genetic transformation. We confirmed that most knockout plants in generation T₀ had heterogeneous or homogenous bi-allelic modified genes and these modified genes could be segregated genetically to retain sgRNA and Cas9 transgenes authentically via Mendelian genetics. We confirmed that the knockouts carried specific markers, genomic primers of PCR, as also confirmed by a sequence analysis in the regenerated knockout mutant plants. The present research should benefit rice consumers, the rice community, the rice industry, and diabetic humans.

2. Results

2.1. The Digestion of EV1 and EV2 with Bsa1 Endonuclease

Both vectors EV1 and EV2 were digested with Bsa1 endonuclease to facilitate the clones’ gRNA cloning. The digested fragments were applied to 1% agarose gel. The EV1 vector provided two band sizes of ~2.5 kb and around 750 bp. The 3 kb vector was slashed from the agarose gel and purified through the Quigen kit and was subsequently utilized to clone gRNA2 in it via the Bsa1 site. In the same way, the EV2 digested through Bsa1 yielded two band sizes of ~4 kb and 350 bp. The Bsa1 digestion of the entry vectors with the usual size outcome is shown in gel (Figure 1).

2.2. Confirmation of gRNAs in Recombinant Vectors EV1 and EV2 Using PCR

The recombinant vector EV1 containing the promoter U3 and the gRNA1 of every one of the three SSSII-1, SSSII-2, and SSSII-3 genes cloned in it were changed into TOP10 cells and plated on LB media containing gentamycin for the determination of transformants. The recognized changed states with EV1—SSSII-1-gRNA1 or EV2—SSSII-1-gRNA2 were screened through colony PCR to check for the presence of gRNA2 utilizing forward primers of the U6 promoter and the reverse primer of gRNA2. The PCR products from the gRNA2 transformants yielded a normal size band of ~370 bp. State PCR of both the EV1 types yielded a normal size band, which affirms the correct assemblage of the gRNA2 cassettes in both the EV2 types. In the same way, the presumed transformed DB3.1 cells containing recombinant vector EV2, namely, EV1—SSSII-1-gRNA1, EV1—SSSII-2-gRNA1, and EV1—SSSII-3-gRNA1, were confirmed to be present throughout the colony PCR, where the forward primer of the promoter U3 and the reverse primer of gRNA1 were utilized. The resulting PCR amplicon for all three types, namely, EV2—SSSII-1-gRNA2, EV2—SSSII-2-gRNA2, and EV2—SSSII-3-gRNA2, was ~750 bp. Hence, the gRNA1 was effectively cloned in EV1. All three plasmids were cut off from the transformed cells for their additional use in LR multi-round gateway cloning. In the same way, the presences of Entry Vector 1 and the Cas9 gene expression cassette were ensured with colony PCR using a specific set of primers of the maize ubiquitin promoter, Cas9 gene, and NosT. The PCR product was applied to 1% agarose gel and digitized (Figure 2).

2.3. Confirmation of Ultimate Binary Expression Vector with hpt, Cas9 Gene, and the gRNA1, gRNA2

The Colony PCR of the expression vector for SSSII-1, 2, and 3 (DV; SSSII-1, 2 and 3-gRNA1; gRNA2) harboring the hpt factor; Cas9 gene; SSSII-1, 2, and 3-gRNA1; and SSSII-1, 2, and 3-gRNA2 yielded expected size bands of hpt (~750 bp), Cas9 (~750 bp), gRNA1 (~670 bp), and gRNA2 (~370 bp), which are shown in Figure 2. The positively transformed Agrobacterium colonies were sub-cultured for a minimum of three continuous growth cycles. After that, the plasmids were isolated and subjected to PCR-based testing for the presence of complete sequences of the promoters, gRNAs, and terminators. Successful Agrobacterium cultures with construct integrity were obtained and chosen for plant transformation.

2.4. Transformation of Rice and Generation of SSSII-1, SSSII-2 and SSSII-3 Knockout Lines

A large number of calli of MTU1010 and PB1509 Indica rice cultivars were transformed with the genus Agrobacterium harboring the construct of interest. A large number of scutellum-derived embryonic calli of rice at close to 21 days were transformed with agrobacterium EHA105 cells harboring DV—SSSII-1:gRNA1:gRNA2, DV—SSSII-2:gRNA1:gRNA2, and DV—SSSII-3:gRNA1:gRNA2 constructs. The infected calli were co-cultivated in an MS medium enhanced with acetosyringone. Generally, wt calli begin to turn off-brown in color 10–12 days earlier on a selection plate. The Agro-infected calli were subjected to a few rounds of sub-culturing in a selection medium for up to at least one month (each sub-cultured once every 10–15 days); the transformed calli were distinguished as compact, orbicular, and off-white in appearance, whereas the untransformed calli turned dark and eventually dried off. Once hygromycin-resistant transformed calli were obtained, the calli from the three rounds of selection were transferred to a regeneration medium and proliferated in the dark for 9–12 days. Hair-like structures were found growing on the calli. After an interval of 5 days, the calli were transferred to light conditions and eventually started turning green. The thread structures grew very tiny plantlets after a few days. The regenerative frequency of MTU1010 Indica rice was found to be low as most of the calli died once turning brown during a consequent sub-culturing on regeneration media. The regenerative frequency of the PB1509 rice was found to be better than that of the MTU1010 rice as nearly half of the calli survived and the rest died, turning brown on a consequent sub-culturing on the regeneration media. All the steps of the plant tissue culture are shown in Figure 3. The regenerated plantlets were then detached from the entire cluster of regenerating calli and transferred into a rooting medium in glass tubes for the development of roots. Once the plantlets matured with thick, long, and healthy roots, we decided to transfer them to pots for hardening under controlled greenhouse conditions for the following studies.

2.5. Analysis of Transgenic Rice Lines of T₀ Generation

A total of 22 putative transgenic plants of SSSII-1, 2, and 3 together with wild plants were screened via PCR detection of the hpt gene and Cas9 gene-specific primers to confirm the combination of those genes into the rice genome. Out of 22 plants, 4 plants of the MTU1010 line mutated with constructs SSSII-1, while 15 plants of the MTU1010 line and the PB1509 Indica rice mutated with constructs SSSII-2 and 3 plants of the MTU1010 line and PB1509 mutated with constructs SSSII-3 were found to be Cas9 positive; therefore, the frequency of Cas9 positive plants (or the mutation efficiency) was found to be 70%. To determine the gene-editing frequency for each of the genes, we sent the Cas9-positive plants for DNA sequencing. Then, exclusively the primers of the SSSII-1, 2, and 3 genes from the Cas9-positive plants were amplified with respect to each of the target sites (each comprising gRNA target sites).

These amplicons of the SSSII-1, 2, and 3 genes were sent for DNA sequencing to analyze their respective gene-editing frequencies. Figure 4, Figure 5 and Figure 6 show the PCR amplicon size of the Cas9 gene while still referencing the SSSII-1, 2, and 3 genes. The DNA sequencing results of the T₀ plants showed frequent styles of mutations within the expected region that was upstream of the PAM (5′NGG3′ or 5′CCN3′) sequence. On the other hand, most of the plants were knocked out or got deletions in the SSSII-2 gene, and other plants with the SSSII-1 and 3 genes had less frequent mutants, whose deletions ranged from base pairs 3 to 29 and whose insertions are in the range of the base pairs from 1 to 11 as in the SSSII-2 gene on the target sites. Interestingly, the deletion and insertion sequences were imitative of the expression vector expressed in this research study and in the entirety of cases (

Table 1. The results of sequencing of SSSII-1, SSSII-2, and SSSII-3 mutant lines. CRISPR/Cas9 was used for editing the SSSII-1, SSSII-2, and SSSII-3 genes. The bold nucleotides are PAM motifs, the yellow sequences are targets sequences, deletions are shown in dashes, and red nucleotides are insertions.

Soluble Starch Synthase-II Isoform-1
Target 1
Wt-SSII-1: CGCAGGCGGAGCAGGGTGAGCGGGGTTTGGTGGCACTTGTATGGTGGCA
KO-SSII-1.1: CGCAGGCGGAGCAGGGTGAGCGGGGTTTGGTGGCACTT--------TGGTGGCA
Target 2
Wt-SSII-1: AAGGATCTAGGTGTCCGCAAACGTTACAGGGTAGCTGGACAGGTAAGAAA
KO-SSII-1.2: AAGGATCTAGGTGTCCGCAA--------------------GGGTAGCTGGACAGGTAAGAAA
Soluble Starch Synthase-II Isoform-2
Target 1
Wt-SSII-2: GTGAGCGGGGTTTGGTGGCACTTGTA----------------------TGGTGGCACGGGGCT
KO-SSII-2.1: GTGAGCGGGGTTTGGTGGCACTTGTAGTTGCAGTCACTGGTGGCACGGGGCT
Target 2
Wt-SSII-2: CAGAAGCCAAGGATCTAGGTGTCCGCAAACGT-TACAGGGTAGCTGGACAGG
KO-SSII-2.2: CAGAAGCCAAGGATCTAGGTGTCCGCAAACGTTTACAGGGTAGCTGGACAGG
Soluble Starch Synthase-II Isoform-3
Wt-SSII-3: AGGCGACTAGATCTTCCCCTATTCCTGCGGTAGAAGAGGAGACGTGGGATTTCAAGAAAT
KO-SSII-3.1: AGGGGAGTGGATCTTCCCGTATTC----------------------------------------------------------------AAGAAAT

). In some of the edited plants, the total PAM sequence was deleted. All the mutations in the edited plants were monoallelic (i.e., expressing a mutation in only one of all the parental alleles) since the chromatogram peaks of those plants were overlapping at the target site, whereas the control plants had a clean and single peak.

2.6. High Level of RS, High-Amylose, and Gelatinization of Properties of Rice Starch

The changes in the amylose and amylopectin content of the starch granules show that the morphology of the granules has also changed along with the nutritional and physicochemical properties. Compared to wild-type rice, the seeds from the mutant plant lines of the three isoforms of the SSS-II lines were soft. We compared the amylose content of the grains between transgenic homozygous lines and control lines. The editing of SSSII showed an effect on the amylose content. There was a significant enhancement in the amylose content in the rice grains with mutant SSSII genes via CRISPR/Cas9 (p < 0.01), which indicates that the addition of three SSSII genes results in an enhanced AC in rice seeds. We obtained mutant rice lines with a higher amount of amylose via targeting of SSSIIs The wild-type rice had amylose content of around ~23%. The transgenic plants of India had a significantly higher amylose content compared with their control types (WT). In the transgenic lines of SSSII1–3, the maximum enhanced apparent amylose content was 63%, measured with the Megazyme Kit K-AMYL, which is much higher compared with wild types ((~23%) (Figure 7). The ConA ppt method has been used with different types of assays showing an amylose content in mutant seed grains of 63% [1]. The outcomes of the determination via several methods recognized that the resistant starch was significantly higher in AC mutant seeds of rice than in the control seeds. In rice, starch granules of amylo-rice differ from control-type granules with respect to their condition solubility in urea reagents. To determine the concentration effect of the urea on the gelatinization properties of rice starch, we prepared a powder consisting of seed flour of the starch from the normal type and SSII-1-3 mutant mixed with a urea solution at a 4 m concentration (Supplementary Figure S3). The maturation of the endosperm of the transgenic rice and control rice starch was allowed to take place in order for it to gelatinize in a 4 M urea solution. We observed a biphasic response of both the preparations characterized by the swelling of the starch with the increase in the urea concentration. These outcomes show that the initial urea concentration for the endosperm of the gelatinized starch grains is based on the amylopectin structure and to a certain extent on the amylose structure.

2.7. Analysis and Confirmation of Cas9-Free Edited Lines

Our study reports the successful development of Cas9-free knockout mutants, along with molecularly confirmed mutant lines. A molecular confirmation of the putative transgenic plants was carried out to obtain proof of the targeted editing of the OsSSSII-1-, OsSSSII-2-, and OsSSSII-3-encoding genes in rice by PCR and was confirmed by the sequencing of the PCR product (Figure 8). Segregation was allowed for the edited T₀ lines (plants raised from transformed callus) in order to develop a Cas9-free homozygous stable line leaving OsSSSII genes knocked out. More than 120 edited transgenic plants of SSSII-1, 2, and 3 together with wt plants were screened by PCR with Cas9 gene-specific primers to confirm Cas9-free knockout transgenic lines (Figure 9). After the screening of the first-generation transgenic lines for Cas9-free knock-out mutant lines, we selected 31 Cas9-free plants from 120 edited plants, 2 plants for SSSII-1, 19 for SSSII-2, and 10 plants for SSSII-3 (

Table 2. Sequencing analysis for Cas9-free plant lines mutated (knocked out—KO) at SSII-1, SSII-2, and SSII-3 genes. The results of sequencing of SSSII-1, SSSII-2, and SSSII-3 mutant lines. The sequences in yellow are target nucleotide sequences, deletions are shown in dashes, and red nucleotides are insertions.

Soluble Starch Synthase II-1
Ct-SSS-II-1:ACTTGGGCAGTGCCGAGGAGGAGCAGGTTGGAGTGGGGGC-GTGTGGAGGCTCAGAA-TT
KO-SSS-II-1.1:ACTTGGGCAGTGCCGAGGAGGAGCAGGTTGGAGTGGGGGCGGTGTGGAGGCTCAGAATT
Soluble Starch Synthase II-2
Target 1
Ct-SSS-II-2:GAGCGGGGTTTGGTGGCACTTGTATGGTGGCACGGGGCTGCGGTTGCATTGGGAGCGGCG
KO-SSS-II-2.1: GAGCGGGGTTTGGTGGCAC-------ATGGTGGCACGGGGCTGCGGTTGCATTGGGAGCGGCG
Target 2
Ct-SSS-II-2:TTATGGTTGTGATACCAAGATACGGAGAATATGCAGAAGCCAAGGATCTAGGTGTCCGCA
KO-SSS-II-2.1: TTA-GGTTGTGATACCAAGATATGGAGAATATGCAGAAGCCAAGGATCTAGGTGTCCGCA
Target 1
Ct-SSS-II-2: GAGCGGGGTTTGGTGGCACTTGTATGGTGGCACGGGGCTGCGGTTGCATTGGGAGCGGCG
KO-SSS-II-2.2:GAGCGGGGTTTGGTGGCACTTGGATGGCGGC------GGGCTGCTGCTGCTTTGTTGGCAGCG
Target 2
Ct-SSS-II-2: TTATGGTTGTGATACCAAGATACGGAGAATATGCAGAAGCCAAGGATCTAGGTGTCCGCA
KO-SSS-II-2.2:TTA-GGTTGTGATACCAAGATACGGAGAATATGCAGAAGCCAAGGATCTAGGTGTCCGCA
Target 1
Ct-SSS-II-2: GGGTTTGGTTCGGGACGGAGCCGTCGTGTGCTCGGCGTCGGCCGCCGGTGGTGAGGATGG
KO-SSS-II-2.3:GGG-----GGTTGTGCACGAAGCCGCCGTGTGGTCCGCGGCGGCCGCCGGTGGTGAGGATGG
Target 2
Ct-SSS-II-2: TTATGGTTGTGATACCAAGATACGGAGAATATGCAGAAGCCAAGGATCTAGGTGTCCGCA
KO-SSS-II-2.3:TTA-GGTTGTGATACCAAGATACGGAGAATATGCAGAAGCCAAGGATCTAGGTGTCCGCA
Target 1
Ct-SSS-II-2: GGATGGCGTCGCGAAGGCGAAGACGAAGTCAGCGGGGAGCTC-GAAGGCGGTCGC-TGTG
KO-SSS-II-2.4: GGATGCCTCCCCGAAGGCAAAGGCAAA-TCCGCGGGGAACTCCGAGGGCG-TCGCCTGTG
Target 2
Ct-SSS-II-2: TTATGGTTGTGATACCAAGATACGGAGAATATGCAGAAGCCAAGGATCTAGGTGTCCGCA
KO-SSS-II-2.4: TTA-GGTTGTGATACCAAGATATGGAGAATATGCAGAAGCCAAGGATCTAGGTGTCCGCA
Target 1
Ct-SSS-II-2: GAGCGGGGTTTGGTGGCACTTGTATGGTGGCACGGGGCTGCGGTTGCATTGGGAGCGGCG
KO-SSS-II-2.5: GAGCGGGGTTTGGTGGCACTTGTATGGGGGC—GGGGCTCTGGTTGTGCTGTGAGCGCCG
Target 2
Ct-SSS-II-2: TTATGGTTGTGATACCAAGATACGGAGAATATGCAGAAGCCAAGGATCTAGGTGTCCGCA
KO-SSS-II-2.5: TTA-GGTTGTGATACCAAGATATGGAGAATATGCAGAAGCCAAGGATCTAGGTGTCCGCA
Soluble Starch Synthase II-3
Target 1
Ct-SSS-II-3: TCCGCTCCTCTCCCCAAGCCTGACAATTCGGAATTTGCAGAGGATAAGAGCGCAAAAGTT
KO-SSS-II-3.1: TCCGCTCCTCTCCCCT--GCCTGAC--ATTCGAAATTTGCAAAGGATAAGAGCGCAG—AGTT
Target 2
Ct-SSS-II-3: CTCCGAAGCCAAAGGCGACTAGATCTTCCCCTATTC-CTGCGGTAGAAGAGGAGACGTGG
KO-SSS-II-3.1: CTCCGAAGCCAAAGGCGACTAGATCTTCCCCTATTCTCTGCGGTAGAAGAGGAGACGTGG
Target 1
Ct-SSS-II-3: GAAGCTCCCAGCGCCGGACTCCCCCGTGATCCTTCCATCCGTAGACAAGCCGCAGCCGGA
KO-SSS-II-3.2: GAAGCTCCCAGCGCCGGACTCCCCCGTGATCCTTCCATCCATA--AC--AGCCGCAGCCTGA
Target 2
Ct-SSS-II-3: CAAAGGCGACTAGATCTTCCCCTATTC-CTGCGGTAGAAGAGGAGACGTGGGATTTCAAG
Ct-SSS-II-3.2: CAAAGGCGACTAGATCTTCCCCTATTCTCTGCGGTAGAAGAGGAGACGTGGGATTTCAAG

). The segregated Cas9-free knockout outlines were confirmed by PCR using gene sequence-specific primers. After that, all the screen samples of OsSSSII-1, OsSSSII-2, and OsSSSII-3 of higher generation were sent for DNA sequencing of rice mutants.

2.8. Sequencing Analysis for Cas9-Free Plants

DNA sequencing precisely explains the type of mutation with respect to heterozygosity or homozygosity. The frequencies required the assessment of the bi-allelic or homozygous transgenic lines in SSSII-1, SSSII-2, and SSSII-3 in the second and further advanced generation and the use of the Mendelian-style segregated bi-allelic lines in the T₁ generation of the mutant plants. The PCR products were sequenced. The result of the sequencing yielded a chromatogram that comprehensively describes the sequence of nucleotides in the emergence of the peak (Table 2). In support of the homozygous mutation is an apparent lone apex for each nucleotide whereas in the case of the heterozygous mutations it yields an apex extending beyond. Furthermore, the polyploidy further demonstrates the greater apex of overlapping.

2.9. Size of Rice Grains and Starch Structure

SEM scanning showed that the edited SSSII-1’s size increased compared to the control, growing from 28 mm to 30.5 mm (Figure 10). In the case of the PB 1509 grains, no change was observed. Molecular studies of the starch showed a slight difference in the molecular packing of starch in the Cas9-free rice grains and wild-type rice grains (Figure 11).

3. Discussion

CRISPR-Cas9-targeted mutagenesis has recently been used for creating various mutations in rice [15,16]. In this research, we produced some genome-edited rice knockout mutants with enhanced amylose content using the CRISPR/Cas9 technique. In the site-specific mutagenesis, isoforms of SSSII-1, SSSII-2, and SSSII-3 were targeted. We effectively designed gRNA that targeted SSSII-1, SSSII-2, and SSSII-3 in the Indica rice and generated transgene-free lines of homozygous SSSII mutants with an enhanced resistant starch and amylose content. CRISPR/Cas9-mediated genome-edited technology has a major edge over other mutagenesis techniques due to its high precision [17].

We used two selected varieties of Indica rice, namely, MTU-1010 and Pusa Basmati (PB 1509), and used appropriate gRNA-targeted mutagenesis in the insoluble starch synthase (SSS), viz., SSSII-1, SSSII-2, and SSSII-3. Among the transgenic lines of SSSII-1, SSSII-2, and SSSII-3, the maximum enhanced apparent amylose content was 63% whereas for the wild types this value was only 23%. The ConA ppt method [1] showed clear changes in the amylose content. Importantly, Cas9-free knockout transgenic lines were also obtained successfully. The frequencies required for bi-allelic or homozygous transgenic lines in SSSII1, SSSII2, and SSSII3 in a second and further advanced generation were obtained and determined following the Mendelian fashion of analyzing the segregated bi-allelic lines in the T₁ generation of the mutant plants. A molecular analysis of the putative transgenic plants was carried out for the proof of the successfully targeted editing of the OsSSSII-1, OsSSSII-2, and OsSSSII-3 genes. This was confirmed by PCR and the sequencing of the PCR product.

Segregation was allowed for the edited T₀ lines to develop a Cas9-free homozygous stable line leaving knocked-out OsSSSII genes. More than 120 edited transgenic plants of SSSII-1, 2, and 3 together with wt plants were screened by PCR with Cas9 gene-specific primers to confirm Cas9-free knockout transgenic lines. After screening the first-generation transgenic lines for Cas9-free knock-out mutant lines, we screened 31 Cas9-free plants from 120 edited plants, 2 plants for SSSII-1, 19 for SSSII-2, and 10 plants for SSSII-3. The type of mutations that transpired were determined by the nucleotide sequencing. Due to the mutations, the morphology of the grain sizes also altered: wild-type MTU1010/28.0 mm (40×), SSSII-1 MTU/ 30.5 mm (40×), wild-type PB1509/ 36.5 mm (27×), SSSII-2 PB/36.5 mm (27×), and SSSII-2 PB/36.5 mm (27×) could be linked to the absence of SSS. However, this could be correlated to the fact that the activity or absence of SSS had a lesser impact on the sizes of the rice grains. This research has proven that knockout mutations in the genes of soluble starch synthase can improve the quality of rice. The rice developed had a low glycemic index and thus offers a good substitute for traditional rice for diabetics and patients suffering from other diseases. Cas9-free SSS mutant rice can help in controlling diabetes, coronary heart disease, rectal cancers, and certain colon cancers, and might offer health benefits for people worldwide.

4. Materials and Methods

Sequence search using BLAST: Various DNA and protein sequence databases (NCBI, PDB, TAIR, Swissport, Rice Genome Annotation Project at MSU, etc.) are used for sequence searches using BLASTN and BLASTX programs [18]. The rate likenesses among DNA and protein sequences were acquired utilizing MacVector programming (Acceleris, GmbH, Germany) and Bioedit programming (variant 7.25)(Roseau, Dominica). (

Table 3. List of the genes encoding Soluble Starch Synthases (SSS) that have been targeted in the present study using gRNA and CRISPR-Cas9 tools to create knockout mutants.

Target Genes Encoding for Various Isoforms		Gene	Localization on Chromosome
Soluble Starch Synthase (SSS)	SSSI	SSSI	Chr 6
	SSSII	SSSII-1	Chr 10
		SSSII-2	Chr 2
		SSSII-3	Chr 6
	SSSIII	SSSIII-1	Chr 4
		SSSIII-2	Chr 8
		SSSIV-1	Chr 1
		SSSIV-2	Chr 5

)

Aligning DNA sequences: Alignments of the DNA sequences were completed using the Bioedit software (version 7.25) (Roseau, Dominica) and ClustalW (version 2.0) (Dublin, Ireland) program at EMBL [18].

Primer design: The primers were designed using Mac-Vector (Acceleris, GmbH), Snap Gene (form 1.1.3), or using electronic programming, for example, Primer blast (http://www.ncbi.nlm.nih.gov/instruments/ groundwork impact/list) (accessed on 18 August 2021) and Primer 3 plus (https://primer3plus.com/) (accessed on 18 August 2021) with default values. Oligo-analyzer programming (http://www.idtdna.com) (accessed on 18 August 2021) was used to check for the probability of self or hetero-dimer development in the planned set of primers. The uniqueness of these primers was confirmed using BLASTN on the NCBI database. The primers were further combined using IDT, Germany, or Sigma-Aldrich, India [18].

gRNA synthesis: The target site to be knocked out was selected in the exonic region involved in gene expression. Thus, the selection of the target sites in the cDNA sequence of the gene of interest was employed. Both the forward and reverse single-stranded oligos of 20 ntds synthesized at IDT (Coralville, IA, USA) were used [18].

To predict imminent gRNAs for both the genes, the cDNA succession of all three OsSSSII-1, OsSSSII-2, and OsSSSII-3 genes was taken from online CRISPR-direct programming. Checking sense and antisense strands of both the cDNAs, the CRISPR direct programming anticipated a few imminent target sites that were promptly adjoining PAM sequences. Consequently, the target sequence to be mutated resembled 5′-N (20)- NGG-3′ or 5′-CCN-N (20)- 3′. Our target sequence, which was 20 ntds, was available only nearby the PAM sequence, which was 5’NGG3’.

Designing of Construct

The cloning technique included the utilization of three gateway cloning viable vectors, i.e., entry vector1 (EV1), entry vector2 (EV2), and a destination vector (DV), called an expression vector (Supplementary Figure S1). At the very beginning, the gRNA1 and gRNA2 were cloned into the Bsa1 site of EV1 and EV2 entry vectors, separately. At that point, both the gRNAs from these entry vectors were cloned into the destination Vector (previously containing Cas9 gene cassette) individually through gateway cloning utilizing LR clonase mixture. The final construct was introduced into Agrobacterium EHA105 cells through the electroporation technique.

CRISPR/Cas9 gene cloning into Entry Vectors

The gRNA1 for OsSSSII-1, OsSSSII-2, and OsSSSII-3 genes was ligated in EV1 vectors independently within the ligase buffer and ligase catalyst overnight at 16 °C. The ligation product was changed into TOP10 cells and plated on LB media containing gentamycin. The colonies that delivered resistance were screened with colony PCR for the presence of gRNA utilizing forward primers of promoter U3 and gRNA1 reverse primer. The gRNA2 OsSSSII-1, OsSSSII-2, and OsSSSII-3 genes were cloned in the EV2 vector independently at the Bsa1 site, which was flanked by scaffold and rice U6 Promoter on either edge. The ligation result of EV2 containing gRNA2 was transferred into DB3.1 cells and exposed on an LB plate supplied with gentamycin and chloramphenicol. The resistant colonies were screened with PCR for the presence of gRNA1 utilizing the forward primer of U3 advertiser and the opposite primer of gRNA2. The following strategies were adopted to target OsSSSII-1, OsSSSII-2, and OsSSSII-3 genes.

Multi-round Gateway cloning

The multi-round Gateway cloning was performed as mentioned by Buntru [19]. The Multi Round Gateway cloning technology considered the in vitro gene pyramiding/stacking of various genes into a solitary plant’s change vector through a series of recombination responses. LR reactions with three rounds were completed between the pMDC99 vector and the recombinant section vectors EV-1 and EV-2 for stacking the Cas9 gene and both the gRNAs. The ultimate expression vector had a gRNA expression cassette, sequence of screening primers of hygromycin, Cas9 genes, and gRNAs of all three OsSSSII-1, OsSSSII-2 and OsSSSII-3 expression is presented in Supplementary Figure S2. Agrobacterium competent cells endured electroporation at 2.5 kV, 25 µF, and 200 Ω for around 5 ms (BTX Electroporator, USA) and processed further as per standard protocol. When incubated for around 2–3 h, the remodeled cells (50 μL) were plated on a YEM plate containing rifampicin (10 mg/L) and streptomycin (25 mg/L); thus, various antibiotics for cellular inclusion were chosen to select the transformed cells. This plate was incubated at 28 °C overnight followed by liquid media containing appropriate antibiotics for isolation of plasmid.

Agrobacterium-mediated transformation of embryogenic rice calli

Frame-shift mutation within the OsSSSII-1, OsSSSII-2, and OsSSSII-3 genes that negatively controls grain yield was performed in MTU1010 and PB1509 rice varieties. The seeds were de-husked manually to boost scutellum-derived calli for Agrobacterium-mediated transformation. For each OsSSSII-1, OsSSSII-2, and OsSSSII-3 mutant plant, the protocol of the rice transformation mentioned in Hiei and Komari, 2008 [20], and Manna, 2016 [21], was followed. Many steps within the following section are quoted essentially from Manna, 2016 [21]. For all the steps from induction callus to pre-regeneration, the incubation was performed under dark conditions at 25 °C.

Screening of first-generation transgenic plants (T₀)

Genomic deoxyribonucleic acid (DNA) was extracted from all the plants physically with Cetyl trimethyl ammonium bromide (CTAB) buffer approach and exposed to PCR amplification by gene-specific primers. First, the hygromycin gene-recovered plants were screened by PCR using hygromycin phosphotransferase (hpt) and Cas9 gene-specific primers. The reaction mixture (50 µL) was placed in a thermocycler (Bio-Rad, Hercules, California, USA) with denaturing time of 5 min at 95 °C (1 cycle), followed by 30 cycles of denaturation for 50 s at 95 °C, annealing at 56 to 58 °C for 50 s, extension for 50 s at 72 °C, and then the last extension for 10 min at 72 °C. The PCR products were employed on 0.8% agarose gel, stained with ethidium bromide (1µg/mL), and were photographed Gel-Doc (Bio-Rad, Hercules, California, USA) under UV light. From that point onward, all Cas9-positive plants were chosen to amplify the partial region of OsSSSII-1, OsSSSII-2, and OsSSSII-3 genes each having targets for specific primers. PCR products, amplified from OsSSSII-1, OsSSSII-2, and OsSSSII-3 genes, were sent for DNA sequencing (Macrogen, Korea).

Germination of first-generation seed lines (T₀) to get second-generation plants (T₁)

First-generation knock-out (KO) plants of OsSSSII-1, OsSSSII-2, and OsSSSII-3 showing frame-shift mutation were germinated on germination paper in Petri plates for 7–10 days and then transferred to the pots, containing soil (Soilrite^®, Bengaluru, India), for further growth. Then, DNA was isolated from these second-generation plants to observe the gene-editing frequency. The T₁ generation plants from these knockout lines were checked for the presence of a Cas9 gene using PCR. However, the PCR products from all OsSSSII-1-, OsSSSII-2-, and OsSSSII-3-edited plants were sent for DNA sequencing to determine the sort of mutation in an advanced generation.

Determination of amylose content in transgenic plants

Thermostable α-amylase hydrolyses starch into soluble branched and unbranching maltodextrins. Where necessary, resistant starch within the sample is pre-dissolved by stirring the sample with 2M KOH at 4 °C, followed by neutralization with sodium acetate buffer and hydrolysis with α-amylase. Amyloglucosidase (AMG) quantitatively hydrolyses maltodextrins to D-glucose. D-Glucose is changed to D-gluconate with the discharge of 1 mole of hydrogen peroxide (H₂O₂), which is quantitatively measured in a very colorimetric reaction using peroxidase and the production of a quinone imine dye. Samples containing high levels of glucose and maltodextrins were washed with aqueous ethanol (80% v/v) before analysis. Analyses of samples were performed at intervals of 70 min. A total of 20 samples were analyzed at intervals of 2 h. For this assay, the Megazyme kit (K-AMYL 06/18, Bray, Ireland) was used following the instruction as per the user’s guide.

Measurement of Gelatinization properties of transgenic plants

The gelatinization and swelling modes of endosperm starch of rice in variable concentrations of urea were calculated as represented antecedently by Nishi, 2001 [22]. The solubility of starch granules in urea solution was articulated in terms of the absorbance of the iodine–starch test; supernatant in 4 M urea. The thermal gelatinization properties of starch were analyzed by using a differential scanning calorimeter.

DNA sequencing of transgenic lines of rice

DNA Sequencing is the most dependable methodology for the screening of mutants. It exactly describes the insights concerning the sort of mutation, for example, whether it is a homozygous or heterozygous mutation. PCR products were sequenced through Next-Generation sequencing (NGS).

Structure determination of molecular starch using Scanning Electron Microscope (SEM)

These rice seeds collected from each group of rice plants were halved vertically by a razor and used to study the structure of starch molecules. The starch granules were hulled and studied by SEM (Critical Point Drying, CPD 3000, Leica, Wetzlar, Germany).

5. Conclusions

The present study was successful in developing many knockout mutants of SSSII-1, 2, and 3. Furthermore, Cas9-free mutants were also found. One Cas9-free mutant was found to have a 63% amylose content and highly resistant starch in the starch grains. The grains of this rice could be tested in further experiments for the safety and suitability of the health of animal models and could later be considered for human consumption after passing through the necessary experiments, trials, and safety standards as per the guidelines prescribed in the relevant laws and regulations.