Effects of Ionized Water Addition on Soil Nitrification Activity and Nitrifier Community Structure
Abstract
1. Introduction
2. Materials and Methods
2.1. Soil Sampling
2.2. Experimental Design
2.3. Measurements and Analysis Methods
2.3.1. Determination of Soil Mineral Nitrogen Concentration
2.3.2. Soil DNA Extraction
2.3.3. Quantification of the Bacterial-amoA Gene and Archaeal-amoA Gene
2.3.4. High-Throughput Sequencing and Analysis of Nitrifying Microorganism Community
2.4. Data Processing and Statistical Analysis
3. Results
3.1. Dynamic Characteristics of Inorganic Nitrogen
3.2. Quantitative Characterization of the Dynamic Changes of the Soil NH4+-N Content
3.3. Variation Characteristics of the Ammonia-Oxidizing Microorganism Abundance
3.4. Changes in the Community Structure of Nitrifying Microorganisms
4. Discussion
4.1. The Effect of Soil Moisture Condition on Nitrification and Ammonia-Oxidizing Microorganisms
4.2. Effect of Ionized Water on Nitrification and Ammonia-Oxidizing Microorganisms
4.3. Evaluation of the Effect of Ionized Water
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Islam, M.R.; Eneji, A.E.; Ren, C.; Hu, Y.G.; Xue, X.Z. Oat-based crop-ping system for sustainable agricultural development in arid regions of northern China. Agric. Biotechnol. Ecol. 2010, 3, 1–8. [Google Scholar]
- Wei, T.; Dong, Z.; Zhang, C.; Ali, S.; Han, Q.; Zhang, F.; Jia, Z.; Zhang, P.; Ren, X. Effects of rainwater harvesting planting combined with deficiency irrigation on soil water use efficiency and winter wheat (Triticum aestivum L.) yield in a semiarid area. Field Crops Res. 2018, 218, 231–242. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Davidson, E.A.; Mauzerall, D.L.; Searchinger, T.D.; Dumas, P.; Shen, Y. Managing nitrogen for sustainable development. Nature 2015, 528, 51–59. [Google Scholar] [CrossRef] [Scilit]
- Xu, X.X.; Zhang, M.; Li, J.P.; Liu, Z.Q.; Zhao, Z.G.; Zhang, Y.H.; Zhou, S.L.; Wang, Z.M. Improving water use efficiency and grain yield of winter wheat by optimizing irrigations in the North China Plain. Field Crop Res. 2018, 221, 219–227. [Google Scholar] [CrossRef] [Scilit]
- Wang, Q.J.; Xu, Z.Y.; Shan, Y.Y.; Zhang, J.H. Effect of salinity of de-electronic brackish water on characteristics of water and salt movement in soil. Trans. Chin. Soc. Agric. Eng. 2018, 34, 125–132. (In Chinese) [Google Scholar]
- Wang, Y.H.; Zhao, G.Q.; Wang, Q.J.; Wang, L. Effects of irrigation with de-electronic water on growth and water use of winter wheat. J. Agro-Environ. Sci. 2020, 39, 953–963. (In Chinese) [Google Scholar]
- Zhu, M.; Li, B. Effects of irrigation with de-electronic water on yield, quality and water use efficiency of tomato grown in greenhouse. Water Sav. Irrig. 2020, 11, 20–24. (In Chinese) [Google Scholar]
- Yao, H.; Gao, Y.; Nicol, G.W.; Campbell, C.D.; Singh, B.K. Links between ammonia oxidizer community structure, abundance, and nitrification potential in acidic soils. Appl. Environ. Microb. 2011, 77, 4618–4625. (In Chinese) [Google Scholar] [CrossRef] [Scilit]
- Kowalchuk, G. Ammonia-oxidizing bacteria: A model for molecular microbial ecology. Annu Rev. Microbio. 2001, 55, 485–529. [Google Scholar] [CrossRef] [Scilit]
- Wu, Y.C.; Lu, L.; Wang, B.Z.; Lin, X.G.; Zhu, J.; Cai, Z.C.; Yan, X.Y.; Jia, Z.J. Long-Term Field Fertilization Significantly Alters Community Structure of Ammonia-Oxidizing Bacteria rather than Archaea in a Paddy Soil. Soil Sci. Soc. Am. J. 2011, 75, 1431–1440. [Google Scholar] [CrossRef] [Scilit]
- Konneke, M.; Bernhard, A.E.; Torre, D.L.; José, R.; Walker, C.B.; Waterbury, J.B.; Stahl, D.A. Isolation of an autotrophic ammonia-oxidizing marine archaeon. Nature 2005, 437, 543–546. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Norton, J.M.; Stark, J.M. Regulation and measurement of nitrification in terrestrial systems. Methods Enzymol. 2011, 486, 343–368. [Google Scholar] [PubMed]
- Li, Y.Y.; Chapman, S.J.; Nicol, G.W.; Yao, H.Y. Nitrification and nitrifiers in acidic soils. Soil Biol. Biochem. 2018, 116, 290–301. [Google Scholar] [CrossRef] [Scilit]
- Wang, P.P.; Duan, Y.H.; Xu, M.G.; Zhang, S.Q.; Wang, X.L. Nitrification potential in Fluvo-aquic soils different in fertility and its influencing factors. Acta Pedol. Sin. 2019, 56, 124–134. [Google Scholar]
- Tan, S. Study on Soil Water Amd Salt Regulation and Cotton Growth Characteristics under Film-Mulched Drip Irrigation with Brackish Water. Ph.D. Thesis, Xi’an Technological University, Xi’an, China, 2018. [Google Scholar]
- Qu, Z.; Li, M.J.; Wang, Q.J.; Sun, Y.; Su, L.J.; Li, J. Effect of micro-nano oxygenated water addition on nitrification of Xinjiang sandy loam soil under controlled conditions. Trans. Chin. Soc. Agric. Eng. 2020, 36, 189–196. (In Chinese) [Google Scholar]
- Francis, C.A.; Roberts, K.J.; Beman, J.M.; Santoro, A.E.; Oakley, B.B. Ubiquity and diversity of ammonia-oxidizing archaea in water columns and sediments of the ocean. Proc. Natl. Acad. Sci. USA 2005, 102, 14683–14688. [Google Scholar] [CrossRef] [Scilit]
- Rotthauwe, J.H.; Witzel, K.P.; Liesack, W. The ammonia monooxygenase structural gene amoA as a functional marker: Molecular fine-scale analysis of natural ammonia-oxidizing populations. Appl. Environ. Microb. 1997, 63, 4704–4716. [Google Scholar] [CrossRef] [Scilit]
- Zhang, G.Z.; Li, S.Q. Three kinds of ammonium nitrogen fertilizer on nitrification and model analysis. Agric. Res. Arid. Areas 2007, 6, 177–182+211. (In Chinese) [Google Scholar]
- Zhang, G.Z.; Huang, Z.B.; Li, S.Q.; Deng, Z.Y.; Zhang, Q.S. Effects of different exogenous nitrogen sources on nitrification in limy soil and its kinetic analysis. Plant Nutr. Fertil. Sci. 2011, 17, 1147–1155. (In Chinese) [Google Scholar]
- Jan, M.T.; Roberts, P.; Tonheim, S.K.; Jones, D.L. Protein breakdown represents a major bottleneck in nitrogen cycling in grassland soils. Soil Biol. Biochem. 2009, 41, 2272–2282. [Google Scholar] [CrossRef] [Scilit]
- Gilmour, J.T. The Effects of Soil Properties on Nitrification and Nitrification Inhibition. Soil Sci. Soc. Am. J. 1985, 49, 1262–1266. [Google Scholar] [CrossRef] [Scilit]
- Bernie, J.Z.; Thomas, A.F.; Claudia, G. Effect of soil acidification on nitrification in soil. Can. J. Soil Sci. 2015, 95, 359–363. [Google Scholar]
- Duan, P.P.; Wu, Z.; Zhang, Q.Q. Thermodynamic responses of ammonia-oxidizing archaea and bacteria explain N2O production from greenhouse vegetable soils. Soil Biol. Biochem. 2018, 120, 37–47. [Google Scholar] [CrossRef] [Scilit]
- Kits, K.D.; Sedlacek, C.J.; Lebedeva, E.V. Kinetic analysis of a complete nitrifier reveals an oligotrophic lifestyle. Nature 2017, 549, 269–272. [Google Scholar] [CrossRef] [Scilit]
- Agehara, S.; Warncke, D.D. Soil moisture and temperature effects on nitrogen release from organic nitrogen Sources. Soil Sci. Soc. Am. J. 2005, 69, 1844–1855. [Google Scholar] [CrossRef] [Scilit]
- Liu, R.X.; He, J.Z.; Zhang, L.M. Response of nitrification/denitrification and their associated microbes to soil moisture change in paddy soil. Environ. Sci. 2014, 35, 4275–4283. (In Chinese) [Google Scholar]
- Wang, J.; Li, G.; Lai, X.; Song, X.L.; Zhao, J.N.; Yang, D.L. Effects of nitrogen and water addition on the community structure of soil ammonium oxidizing microorganisms in Stipa Baikal Steppe. J. Resour. Ecol. 2015, 6, 1–11. [Google Scholar]
- Ke, X.B.; Lu, Y.H. Adaptation of ammonia-oxidizing microorganisms to environment shift of paddy field soil. Fems Microbiol. Ecol. 2012, 80, 87–97. [Google Scholar] [CrossRef] [Scilit]
- Gleeson, D.B.; Müller, C.; Banerjee, S.; Ma, W.; Siciliano, S.D.; Murphy, D.V. Response of ammonia oxidizing archaea and bacteria to changing water filled pore space. Soil Biol. Biochem. 2010, 42, 1888–1891. [Google Scholar] [CrossRef] [Scilit]
- Szukics, U.; Hackl, E.; Zechmeister-Boltenstern, S.; Sessitsch, A. Rapid and dissimilar response of ammonia oxidising archaea and bacteria to nitrogen and water amendment in two temperate forest soils. Microbiol. Res. 2012, 167, 103–109. [Google Scholar] [CrossRef] [Scilit]
- Bustamante, M.; Verdejo, V.; Zúniga, C.; Espinosa, F.; Orlando, J.; Carú, M. Comparison of water availability effect on ammonia-oxidizing bacteria and archaea in microcosms of a Chilean semiarid soil. Front. Microbiol. 2012, 282, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, S.L.; Yang, X.Y.; Lv, D.Q.; Tong, Y.A. Effect of soil moisture, temperature and different nitrogen fertilizers on nitrification. Acta Ecol. Sin. 2002, 22, 2147–2153. [Google Scholar]
- Linn, D.M.; Doran, J.W. Effect of water-filled pore space on carbon dioxide and nitrous oxide production in tilled and nontilled soils. Soil Sci. Soc. Am. J. 1984, 48, 1267–1272. [Google Scholar] [CrossRef] [Scilit]
- Li, C.H.; Jia, Z.J.; Tang, L.S.; Wu, Y.C.; Li, Y. Effect of model of fertilization on microbial abundance and enzyme activities in oasis farmland soil. Acta Pedol. Sin. 2012, 49, 567–574. (In Chinese) [Google Scholar]
- Ma, L.J.; Zhang, H.M.; Hou, Z.A.; Min, W. Effects of long-term saline water drip irrigation on the abundance and community structure of ammonia oxidizers. J. Agro-Environ. Sci. 2019, 38, 2797–2807. (In Chinese) [Google Scholar]
- He, J.Z.; Hu, H.W.; Zhang, L.M. Current insights into the autotrophic thaumarchaeal ammonia oxidation in acidic soils. Soil Biol. Biochem. 2012, 55, 146–154. [Google Scholar] [CrossRef] [Scilit]
- Nicol, G.W.; Leininger, S.; Schleper, C. The influence of soil pH on the diversity, abundance and transcriptional activity of ammonia oxidizing archaea and bacteria. Environ. Microbiol. 2008, 10, 2966–2978. [Google Scholar] [CrossRef] [Scilit]
- Goloran, J.B.; Chen, C.R.; Phillips, I.R.; Liu, X.C. Pathways of different forms of nitrogen and role of ammonia-oxidizing bacteria in alkaline residue sand from bauxite processing. Eur. J. Soil Sci. 2015, 66, 942–950. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Zhu, G.; Song, L.; Wang, S.; Yin, C. Manure fertilization alters the population of ammonia-oxidizing bacteria rather than ammonia-oxidizing archaea in a paddy soil. J. Basic Microb. 2014, 54, 190–197. [Google Scholar] [CrossRef] [Scilit]
- Wang, Q.J.; Zhang, J.H.; Men, Q.; Tan, S.; Zhou, L.W.; Liu, X.Y. Experiment on physical and chemical characteristics of activated brackish water by magnetization or ionization. Trans. Chin. Soc. Agric. Eng. 2016, 32, 60–66. (In Chinese) [Google Scholar]
- Fabian, B.; Hans, M.; Tom, B. Nitrification in agricultural soils: Impact, actors and mitigation. Curr. Opin. Biotech. 2018, 50, 166–173. [Google Scholar]
- Pate, J.S. Uptake, assimilation and transport of nitrogen compounds by plants. Soil Biol. Biochem. 1973, 5, 109–119. [Google Scholar] [CrossRef] [Scilit]
- Marschner, P. Marschner’s mineral nutrition of higher plants. Sci. Press Beijing 2013, 50, 71–84. [Google Scholar]
- Wei, K.; Zhang, J.H.; Wang, Q.J.; Guo, Y.; Mu, W.Y. Irrigation with ionized brackish water affects cotton yield and water use efficiency. Ind. Crop. Prod. 2022, 175, 114244. [Google Scholar] [CrossRef] [Scilit]





| Treatments | Irrigated Water Type | Moisture Content |
|---|---|---|
| CK1 | Ordinary water | 30%θFC |
| CK2 | Ordinary water | 60%θFC |
| CK3 | Ordinary water | 100%θFC |
| CK4 | Ordinary water | 175%θFC |
| DE1 | Ionized water | 30%θFC |
| DE2 | Ionized water | 60%θFC |
| DE3 | Ionized water | 100%θFC |
| DE4 | Ionized water | 175%θFC |
| Target Prokaryote | Target Gene | Sequence (5′-3′) of Primer Pairs | Thermal Program | Reference |
|---|---|---|---|---|
| AOA | Archaeal -amoA | Forward: STAATGGTCTGGCTTAGACG Reverse: GCGGCCATCCATCTGTATGT | Three minutes at 95 °C, followed by 40 cycles of 20 s at 95 °C, 30 s at 59 °C and 45 s at 72 °C | [17] |
| AOB | Bacterial -amoA | Forward: GGGGTTTCTACTGGTGGT Reverse: CCCCTCKGSAAAGCCTTCTTC | Three minutes at 95 °C, followed by 40 cycles of 20 s at 95 °C, 30 s at 57 °C and 45 s at 72 °C | [18] |
| Treatments | Initial Consumption Rate V0 | Maximum Consumption Rate Vmax | Time to Reach Maximum Consumption Rate TVmax | NH4+-N Transformation Model Fitting Equation | R2 |
|---|---|---|---|---|---|
| (mg·kg−1·d−1) | (mg·kg−1·d−1) | (day) | |||
| CK1 | 4.2 | 8.8 | 6.7 | Nt = 200–128/(1 + e(1.842–0.2762t)) | 0.97 |
| DE1 | 3.0 | 12.3 | 6.0 | Nt = 200–110.5/(1 + e(2.656–0.446t)) | 0.96 |
| CK2 | 6.1 | 14.3 | 6.4 | Nt = 200–184.3/(1 + e(1.983–0.3107t)) | 0.99 |
| DE2 | 5.2 | 15.4 | 6.8 | Nt = 200–184.9/(1 + e(2.271–0.3324t)) | 0.99 |
| CK3 | 4.6 | 22.8 | 6.0 | Nt = 200–189.8/(1 + e(2.87–0.4811t)) | 0.99 |
| DE3 | 8.7 | 19.4 | 4.8 | Nt = 200–195.5/(1 + e(1.912–0.3961t)) | 0.99 |
| CK4 | 3.9 | 14.0 | 9.6 | Nt = 200–215.3/(1 + e(2.502–0.2604t)) | 0.98 |
| DE4 | 6.2 | 16.2 | 6.7 | Nt = 200–204.6/(1 + e(2.125–0.3174t)) | 0.96 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qu, Z.; Li, M.; Wang, Q.; Sun, Y.; Wang, Y.; Li, J. Effects of Ionized Water Addition on Soil Nitrification Activity and Nitrifier Community Structure. Agronomy 2022, 12, 1399. https://doi.org/10.3390/agronomy12061399
Qu Z, Li M, Wang Q, Sun Y, Wang Y, Li J. Effects of Ionized Water Addition on Soil Nitrification Activity and Nitrifier Community Structure. Agronomy. 2022; 12(6):1399. https://doi.org/10.3390/agronomy12061399
Chicago/Turabian StyleQu, Zhi, Mingjiang Li, Quanjiu Wang, Yan Sun, Yichen Wang, and Jian Li. 2022. "Effects of Ionized Water Addition on Soil Nitrification Activity and Nitrifier Community Structure" Agronomy 12, no. 6: 1399. https://doi.org/10.3390/agronomy12061399
APA StyleQu, Z., Li, M., Wang, Q., Sun, Y., Wang, Y., & Li, J. (2022). Effects of Ionized Water Addition on Soil Nitrification Activity and Nitrifier Community Structure. Agronomy, 12(6), 1399. https://doi.org/10.3390/agronomy12061399
