Immune Protective Effect of Chitosan Oligosaccharide on Lipopolysaccharide-Stimulated Coelomocytes of Sea Cucumber Apostichopus japonicus In Vitro
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Experimental Animals and Primary Culture Coelomocytes of Sea Cucumber
2.3. Cell Viablility Assay
2.4. Phagocytic Activity
2.5. Determination of Enzyme Activity
2.6. Respiratory Burst Activity
2.7. Total RNA Extraction and Quantitative Reverse Transcription-PCR (qRT-PCR) Analysis
2.8. Library Preparation and Sequencing
2.9. Sequencing Data Quality Control
2.10. Differential Expression Gene Analysis and Functional Enrichment Analysis
2.11. Statistical Analyses
3. Results
3.1. The Effects of COS on Cell Viability
3.2. Establishment of LPS-Stimulated Inflammation Model
3.3. The Different Protective Effects of COSe on Coelomocytes of Sea Cucumber Stimulated by LPS
3.3.1. Protective Effect of COS on LPS-Stimulated Viability of Sea Cucumber Coelomocytes
3.3.2. Effect of COS on Phagocytic Index and Respiratory Burst Viability of LPS-Stimulated Sea Cucumber Coelomocytes
3.3.3. Effect of COS on Enzyme Activity of LPS-Stimulated Sea Cucumber Coelomocytes
3.3.4. Effect of COS on the Expression of Immune Genes of the Sea Cucumber Coelomocytes Stimulated by LPS
3.4. The Result of Transcriptome Analysis
3.4.1. Assessment of Transcriptome Quality
3.4.2. Reference Sequence Alignment
3.4.3. Gene Expression Analysis
3.4.4. GO and KEGG Enrichment Analysis of DEGs
3.4.5. qPCR Verification
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Han, Q.; Keesing, J.K.; Liu, D. A Review of Sea Cucumber Aquaculture, Ranching, and Stock Enhancement in China. Rev. Fish. Sci. Aquac. 2016, 24, 326–341. [Google Scholar] [CrossRef]
- Liu, H.; Zheng, F.; Sun, X.; Hong, X.; Dong, S.; Wang, B.; Tang, X.; Wang, Y. Identification of the pathogens associated with skin ulceration and peristome tumescence in cultured sea cucumbers Apostichopus japonicus (Selenka). J. Invertebr. Pathol. 2010, 105, 236–242. [Google Scholar] [CrossRef] [PubMed]
- Eeckhaut, I.; Parmentier, E.; Becker, P.; Silva, S.G.D.; Jangoux, M. Parasites and biotic diseases in field and cultivated sea cucumbers. In Advances in Sea Cucumber Aquaculture and Management; 2004; Available online: http://hdl.handle.net/2268/12699 (accessed on 15 January 2024).
- Wang, X.; Zhou, Z.; Yang, A.; Dong, Y.; Wang, B. Molecular Characterization and Expression Analysis of Heat Shock Cognate 70 After Heat Stress and Lipopolysaccharide Challenge in Sea Cucumber (Apostichopus japonicus). Biochem. Genet. 2013, 51, 443–457. [Google Scholar] [CrossRef] [PubMed]
- Dong, Y.; Sun, H.; Zhou, Z.; Yang, A.; Chen, Z.; Guan, X.; Gao, S.; Wang, B.; Jiang, B.; Jiang, J. Expression Analysis of Immune Related Genes Identified from the Coelomocytes of Sea Cucumber (Apostichopus japonicus) in Response to LPS Challenge. Int. J. Mol. Sci. 2014, 15, 19472–19486. [Google Scholar] [CrossRef]
- Zhong, L.; Zhang, F.; Chang, Y. Gene cloning and function analysis of complement B factor-2 of Apostichopus japonicus. Fish Shellfish Immunol. 2012, 33, 504–513. [Google Scholar] [CrossRef]
- Wang, Z.; Fan, X.; Li, Z.; Guo, L.; Ren, Y.; Li, Q. Comparative analysis for immune response of coelomic fluid from coelom and polian vesicle in Apostichopus japonicus to Vibrio splendidus infection. Fish Shellfish Immunol. Rep. 2023, 4, 100074. [Google Scholar] [CrossRef]
- Schmid, H.P. Variation in immune defence as a question of evolutionary ecology. R. Soc. Proc. B 2003, 270, 357–366. [Google Scholar] [CrossRef]
- Gao, Q.; Liao, M.; Wang, Y.; Li, B.; Zhang, Z.; Rong, X.; Chen, G.; Wang, L. Transcriptome Analysis and Discovery of Genes Involved in Immune Pathways from Coelomocytes of Sea Cucumber (Apostichopus japonicus) after Vibrio splendidus Challenge. Int. J. Mol. Sci. 2015, 16, 16347–16377. [Google Scholar] [CrossRef]
- Russo, R.; Chiaramonte, M. The echinoderm innate humoral immune response. Ital. J. Zool. 2015, 82, 300–308. [Google Scholar] [CrossRef]
- Xue, Z.; Li, H.; Wang, X.; Li, X.; Liu, Y.; Sun, J.; Liu, C. A review of the immune molecules in the sea cucumber. Fish Shellfish Immunol. 2015, 44, 1–11. [Google Scholar] [CrossRef]
- Cirone, M. New Insights into Curcumin- and Resveratrol-Mediated Anti-Cancer Effects. Pharmaceuticals 2021, 14, 1068. [Google Scholar] [CrossRef]
- Li, J.; Zhang, Z.; Qiu, J.; Huang, X. 8-Methoxypsoralen has Anti-inflammatory and Antioxidant Roles in Osteoarthritis Through SIRT1/NF-κB Pathway. Front. Pharmacol. 2021, 12, 692424. [Google Scholar] [CrossRef]
- Yu, C.; Suh, B.; Shin, L.; Kim, E.; Kim, D.; Shin, Y.; Chang, S.; Baek, S.; Kim, H.; Bae, O. Inhibitory Effects of a Novel Chrysin-Derivative, CPD 6, on Acute and Chronic Skin Inflammation. Int. J. Mol. Sci. 2019, 20, 2607. [Google Scholar] [CrossRef] [PubMed]
- Jafari, H.; Bernaerts, B.; Dodi, G.; Shavandi, A. Chitooligosaccharides for wound healing biomaterials engineering. Mater. Sci. Eng. C 2020, 117, 111266. [Google Scholar] [CrossRef] [PubMed]
- Tamsir, N.M.; Esa, N.M.; Shafie, N.H.; Hussein, M.Z.; Hamzah, H.; Abdullah, M.A. The Acute Effects of Oral Administration of Phytic Acid-Chitosan-Magnetic Iron Oxide Nanoparticles in Mice. Int. J. Mol. Sci. 2019, 20, 4114. [Google Scholar] [CrossRef]
- Lodhi, G.; Kim, Y.; Hwang, J.; Kim, S.; Jeon, Y.; Je, J.; Ahn, C.; Moon, S.; Jeon, B.; Park, P. Chitooligosaccharide and its derivatives: Preparation and biological applications. BioMed Res. Int. 2014, 2014, 654913. [Google Scholar] [CrossRef]
- Li, X.; Wang, R.; Huang, C.; Tang, J.; Liu, J. Biodistribution of chitosan oligosaccharide labeled with fluorescein isothiocyanate in the sea cucumber, Apostichopus japonicus (Selenka, 1867). Aquac. Int. 2024, 32, 8053–8077. [Google Scholar] [CrossRef]
- Shi, L.; Fang, B.; Yong, Y.; Li, X.; Gong, D.; Li, J.; Yu, T.; Gooneratne, R.; Gao, Z.; Li, S.; et al. Chitosan oligosaccharide-mediated attenuation of LPS-induced inflammation in IPEC-J2 cells is related to the TLR4/NF-κB signaling pathway. Carbohydr. Polym. 2019, 219, 269–279. [Google Scholar] [CrossRef]
- Hu, H.; Xia, H.; Zou, X.; Li, X.; Zhang, Z.; Yao, X.; Yin, M.; Tian, D.; Liu, H. N-acetyl-chitooligosaccharide attenuates inflammatory responses by suppression of NF-κB signaling, MAPK and NLRP3 inflammasome in macrophages. J. Funct. Foods 2021, 78, 104364. [Google Scholar] [CrossRef]
- Chi, Y.; Mukiibi, R.; Zhang, H. Transcriptome Analysis Reveals the Immunosuppression in Tiger Pufferfish (Takifugu rubripes) under Cryptocaryon irritans Infection. Animals 2024, 14, 2058. [Google Scholar] [CrossRef]
- Yang, C.; Wu, H.; Chen, J. Integrated transcriptomic and metabolomic analysis reveals the response of pearl oyster (Pinctada fucata martensii) to long-term hypoxia. Mar. Environ. Res. 2023, 191, 106133. [Google Scholar] [CrossRef] [PubMed]
- Antiqueo, P.; Zuloaga, R.; Bastias-Molina, M. De novo Assembly and Analysis of Tissue-Specific Transcriptomes of the Edible Red Sea Urchin Loxechinus albus Using RNA-Seq. Biology 2021, 10, 995. [Google Scholar] [CrossRef] [PubMed]
- Santos, C.A.; Andrade, S.C.S.; Teixeira, A.K. Litopenaeus vannamei Transcriptome Profile of Populations Evaluated for Growth Performance and Exposed to White Spot Syndrome Virus (WSSV). Front. Genet. 2018, 9, 120. [Google Scholar] [CrossRef] [PubMed]
- Gao, L.; He, C.; Bao, X. Transcriptome analysis of the sea cucumber (Apostichopus japonicus) with variation in individual growth. PLoS ONE 2017, 12, e0181471. [Google Scholar] [CrossRef]
- Yang, A.; Zhou, Z.; Pan, Y. RNA sequencing analysis to capture the transcriptome landscape during skin ulceration syndrome progression in sea cucumber Apostichopus japonicus. BMC Genom. 2016, 17, 459. [Google Scholar] [CrossRef]
- Tian, Y.; Shang, Y.; Guo, R. Salinity stress-induced differentially expressed miRNAs and target genes in sea cucumbers Apostichopus japonicus. Cell Stress Chaperones 2019, 24, 719–733. [Google Scholar] [CrossRef]
- Zhang, G.; Cheng, G.; Jia, P.; Jiao, S.; Feng, C.; Hu, T.; Liu, H.; Du, Y. The positivecorrelation of the enhanced immune response to PCV2 subunit vaccine by conjugation of chitosan oligosaccharide with the deacetylation degree. Mar. Drugs 2017, 15, 236. [Google Scholar] [CrossRef]
- Zheng, J.; Yuan, X.; Cheng, G.; Jiao, S.; Feng, C.; Zhao, X.; Yin, H.; Du, Y.; Liu, H. Chitosan oligosaccharides improve the disturbance in glucose metabolism and reverse the dysbiosis of gut microbiota in diabetic mice. Carbohydr. Polym. 2018, 190, 77–86. [Google Scholar] [CrossRef]
- Wu, F.; Zhou, C.; Zhou, D.; Ou, S.; Liu, Z.; Huang, H. Immune-enhancing activities of chondroitin sulfate in murine macrophage RAW 264.7 cells. Carbohydr. Polym. 2018, 198, 611–619. [Google Scholar] [CrossRef]
- Dolmatova, L.; Eliseikina, M.; Romashina, V. Antioxidant Enzymatic Activity of Coelomocytes of the Far East Sea Cucumber Eupentacta fraudatrix. J. Evol. Biochem. Physiol. 2004, 40, 126–135. [Google Scholar] [CrossRef]
- Wang, R.; Li, X.; Tang, J.; Liu, J.; Yin, H.; Li, R.; Ye, S. Dietary effect chitosan nanoparticles on growth performance, immunity and resistance against Vibrio splendidus in the sea cucumber Apostichopus japonicas. Aquac. Rep. 2023, 30, 101625. [Google Scholar] [CrossRef]
- Liang, H.; Sathavarodom, N.; Colmenares, C.; Gelfond, J.; Espinoza, S.E.; Ganapathy, V.; Musi, N. Effect of acute TLR4 inhibition on insulin resistance in human subjects. J. Clin. Investig. 2022, 132, e162291. [Google Scholar] [CrossRef] [PubMed]
- Hao, W.; Li, K.; Ge, X.; Yang, H.; Xu, C.; Liu, S.; Yu, H.; Li, P.; Xing, R. The Effect of N-Acetylation on the Anti-Inflammatory Activity of Chitooligosaccharides and Its Potential for Relieving Endotoxemia. Int. J. Mol. Sci. 2022, 23, 8205. [Google Scholar] [CrossRef] [PubMed]
- Kang, X.; Li, P.; Zhang, C.; Zhao, Y.; Wen, G. The TLR4/ERK/PDL1 axis may contribute to NSCLC initiation. Int. J. Oncol. 2020, 57, 456–465. [Google Scholar] [CrossRef]
- Tan, C.; Gu, J.; Li, T.; Chen, H.; Liu, K.; Liu, M.; Zhang, H.; Xiao, X. Inhibition of aerobic glycolysis alleviates sepsis-induced acute kidney injury by promoting lactate/Sirtuin 3/AMPK-regulated autophagy. Int. J. Mol. Med. 2021, 47, 19. [Google Scholar] [CrossRef]
- Ma, P.; Liu, H.T.; Wei, P.; Xu, Q.S.; Bai, X.; Du, Y.; Yu, C. Chitosan oligosaccharides inhibit LPS-induced over-expression of IL-6 and TNF-α in RAW264.7 macrophage cells through blockade of mitogen-activated protein kinase (MAPK) and PI3K/Akt signaling pathways. Carbohydr. Polym. 2011, 84, 1391–1398. [Google Scholar] [CrossRef]
- Jitprasertwong, P.; Khamphio, M.; Petsrichuang, P.; Eijsink, V.G.; Poolsri, W.; Muanprasat, C.; Rangnoi, K.; Yamabhai, M. Anti-inflammatory activity of soluble chito-oligosaccharides (CHOS) on VitD3-induced human THP-1 monocytes. PLoS ONE 2021, 16, e0246381. [Google Scholar] [CrossRef]
- Gliński, Z.D.; Jarosz, J. Immune phenomena in echinoderms. Arch. Immunol. Ther. Exp. 2000, 48, 189–193. [Google Scholar]
- Eliseikina, M.G.; Magarlamov, T.Y. Coelomocyte Morphology in the Holothurians Apostichopus japonicus (Aspidochirota: Stichopodidae) and Cucumaria japonica (Dendrochirota: Cucumariidae). Russ. J. Mar. Biol. 2002, 28, 197–202. [Google Scholar] [CrossRef]
- Liu, Z.; Ma, Y.; Yang, Z.; Li, M.; Liu, J.; Bao, P. Immune responses and disease resistance of the juvenile sea cucumber Apostichopus japonicus induced by Metschnikowia sp. C14. Aquaculture 2012, 368–369, 10–18. [Google Scholar] [CrossRef]
- Ma, Y.; Liu, Z.; Yang, Z.; Li, M.; Liu, J.; Song, J. Effects of dietary live yeast Hanseniaspora opuntiae C21 on the immune and disease resistance against Vibrio splendidus infection in juvenile sea cucumber Apostichopus japonicus. Fish Shellfish Immunol. 2013, 34, 66–73. [Google Scholar] [CrossRef] [PubMed]
- Vanderkelen, L.; Herreweghe, J.M.V.; Michiels, C.W. Lysozyme Inhibitors as Tools for Lysozyme Profiling: Identification and Antibacterial Function of Lysozymes in the Hemolymph of the Blue Mussel. Molecules 2023, 28, 7071. [Google Scholar] [CrossRef] [PubMed]
- Diego, d.S.C.; Jader, P.; Hyago, G.; Adriana, R.P.; Sílvia, S.G.; Machado, R.E.S.P.; Aurelio, M.M.; Regina, F.S.; Andressa, B. Pequi (Caryocar brasiliense Cambess)-Loaded Nanoemulsion, Orally Delivered, Modulates Inflammation in LPS-Induced Acute Lung Injury in Mice. Pharmaceutics 2020, 12, 1075. [Google Scholar] [CrossRef]
- Xin, R.; Yi, F.; Zhang, R.; Xu, T.; Xuan, P.; Liu, R.; Jia, J.; Chen, J. Expression and Immunoprotective Analysis of Iron-Cofactored Superoxide Dismutase from Vibrio harveyi. Acta Hydrobiol. Sin. 2012, 36, 212–219. [Google Scholar]
- Hollingsworth, S.A.; Holden, J.K.; Li, H.; Poulos, T.L. Elucidating nitric oxide synthase domain interactions by molecular dynamics. Protein Sci. Publ. Protein Soc. 2016, 25, 374–382. [Google Scholar] [CrossRef]
- Zhao, S.; Yuan, C.; Wan, L.; Chen, W.; Liu, J. Effect of COS on Phagocytic Activity of Coelomic Cell of Tropical Sea Cucumber(Holothuria scabra). Genom. Appl. Biol. 2017, 36, 3237–3240. [Google Scholar] [CrossRef]
- Wu, F.; Wang, Y.; Shang, Y.; Yan, G.; Kong, H.; Hu, M.; Lu, W.; Wang, Y. Current progress of research on classification and immunity of hemocytes in aquatic invertebrates:a review. J. Dalian Ocean Univ. 2016, 31, 696–704. [Google Scholar] [CrossRef]
- Chen, J.; Yang, Y.; Xu, Z.; Li, F.; Yang, M.; Shi, F.; Lin, L.; Qin, Z. Characterization of effects of chitooligosaccharide monomer addition on immunomodulatory activity in macrophages. Food Res. Int. 2023, 163, 112268. [Google Scholar] [CrossRef]
- Ji, D.; Zhong, X.; Huang, P.; Kang, P.; Leng, K.; Zheng, W.; Wang, Z.; Xu, Y.; Cui, Y. Deoxyelephantopin induces apoptosis via oxidative stress and enhances gemcitabine sensitivity in vitro and in vivo through targeting the NF-κB signaling pathway in pancreatic cancer. Aging 2020, 12, 11116–11138. [Google Scholar] [CrossRef]
- Carmen, G.; Elena, C.; Alberto, C. Identification and Regulation of Interleukin-17 (IL-17) Family Ligands in the Teleost Fish European Sea Bass. Int. J. Mol. Sci. 2020, 21, 2439. [Google Scholar] [CrossRef]
- Yoon, H.J.; Moon, M.E.; Park, H.S.; Im, S.Y.; Kim, Y.H. Chitosan oligosaccharide (COS) inhibits LPS-induced inflammatory effects in RAW 264.7 macrophage cells. Biochem. Biophys. Res. Commun. 2007, 358, 954–959. [Google Scholar] [CrossRef]
- Jiang, J.; Qi, L.; Lv, Z.; Jin, S.; Wei, X.; Shi, F. Dietary Stevioside Supplementation Alleviates Lipopolysaccharide-Induced Intestinal Mucosal Damage through Anti-Inflammatory and Antioxidant Effects in Broiler Chickens. Antioxidants 2019, 8, 575. [Google Scholar] [CrossRef] [PubMed]
- Tang, Q.; Chi, F.; Liu, H.; Zhang, H.; Song, Y. Single-Molecule Real-Time and Illumina Sequencing to Analyze Transcriptional Regulation of Flavonoid Synthesis in Blueberry. Front. Plant Sci. 2021, 12, 754325. [Google Scholar] [CrossRef] [PubMed]
- Gunasekara, D.B.; Siegel, J.M.; Caruso, G.; Hulvey, M.K.; Lunte, S.M. Microchip electrophoresis with amperometric detection method for profiling cellular nitrosative stress markers. Analyst 2014, 139, 3265–3273. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Wang, K.; Wang, P.; Li, X.; Chen, J.; Zhou, B.; Lu, A. A Novel Network Pharmacology Strategy to Decode Mechanism of Lang Chuang Wan in Treating Systemic Lupus Erythematosus. Front. Pharmacol. 2020, 11, 512877. [Google Scholar] [CrossRef]
- Cheng, H.; Xu, M.; Zou, J.; Xu, J. Mechanisms of matrix metalloproteinase 16 in development and cancer. Gene 2025, 965, 149657. [Google Scholar] [CrossRef]
- Li, S.; Yang, A.; Dong, Y.; Gao, S.; Chen, Z.; Sun, H.; Zou, Z. Cloning and expression analysis of MMP-16 gene from sea cucumber (Apostichopus japonicus). J. Fish. China 2019, 43, 389–399. [Google Scholar] [CrossRef]











| Primer Name | Primer Sequence (5′-3′) |
|---|---|
| Aj-β-actin F | TGGCGTGAGGAAGAGCAT |
| Aj-β-actin R | CATTCAACCCTAAAGCCAACA |
| Aj-NOS F | GTAGAAGGAAAGGAGAGCGAGTC |
| Aj-NOS R | CATCGTGTCTCGTCGCATAGTGT |
| Aj-IL-17 F | GTTTGTGGTGCTGTTCTCTGTGA |
| Aj-IL-17 F | GGACTTCGATCGGGTCTTTTG |
| Aj-i-Lys F | CCTTACCAAATCAAACTAGGCTACTGG |
| Aj-i-Lys R | TAGGTTGCGTACCGTGCCATATAAC |
| Aj-TNF-α F | ACCCGACTCAACAACCAGAC |
| Aj-TNF-α R | ACACTGGACATTAGCAGGGC |
| Aj-Rel F | TGAAGGTGGTATGCGTCTGG |
| Aj-Rel R | TTGGGCTGCTCGGTTATG |
| Aj-P105 F | TCCTATCGGTCTGAATCTTCCAA |
| Aj-P105 R | TTTCTTCCCTTTCTGGCTATGTTC |
| HAO1 F | TAGAGGAAGTCGCAGAGGCT |
| HAO1 R | GGGTATCGACCGTCAGGAAC |
| MRP4 F | TCGGTCTGTTGCTCTCTTCG |
| MRP4 R | GATCCCTTGTAGGGCCAACC |
| COMP F | GCGGTCTACAACCCTCAACA |
| COMP R | GGGTTGTAATGGAAGGGGCA |
| MMP16 F | TGGCATGGGTTGGATAGACG |
| MMP16 R | CCGGAGACGATTCCAGTTCC |
| NOS F | TCAGACCTCATACCAGGGGG |
| NOS R | GCACAAGAACGCAAGGTGAG |
| MAP3K15 F | GGAGCCAGTATCCTTCGCTG |
| MAP3K15 R | CCGAGCTGTTATTCTCCGCC |
| Sample Name | Average Read Length (bp) | Raw Reads (n) | Raw Bases (G) | Clean Reads (n) | Clean Bases (G) | Q20 (%) | Q30 (%) | GC (%) |
|---|---|---|---|---|---|---|---|---|
| LPS1 | 149.48 | 57,217,954 | 6.84 | 57,009,954 | 6.21 | 98.55 | 96.09 | 41.23 |
| LPS2 | 149.55 | 83,362,358 | 7.73 | 83,041,080 | 6.09 | 98.62 | 96.26 | 41.02 |
| LPS3 | 149.56 | 53,115,034 | 6.08 | 52,902,128 | 6.32 | 98.67 | 96.17 | 40.83 |
| EG1 | 149.37 | 76,442,714 | 7.67 | 76,203,248 | 7.41 | 98.73 | 96.68 | 41.28 |
| EG2 | 149.44 | 79,620,204 | 7.82 | 79,306,896 | 7.38 | 98.50 | 95.84 | 41.26 |
| EG3 | 149.43 | 78,948,374 | 7.72 | 78,694,839 | 7.29 | 98.49 | 96.28 | 41.27 |
| Sample | Total Reads | Total Mapped | Uniquely Mapped | Mutiple Mapped | Non-Splice Read |
|---|---|---|---|---|---|
| LPS1 | 57,009,954 | 39,609,282 (69.75%) | 35,394,962 (62.33%) | 4,214,320 (7.42%) | 22,029,746 (38.80%) |
| LPS2 | 83,041,080 | 57,725,743 (69.72%) | 51,467,320 (62.17%) | 6,258,423 (7.56%) | 32,287,292 (39.00%) |
| LPS3 | 52,902,128 | 36,627,260 (69.46%) | 32,775,596 (62.15%) | 3,851,664 (7.30%) | 20,872,019 (39.58%) |
| EG1 | 76,203,248 | 52,224,656 (68.75%) | 46,160,824 (60.76%) | 6,063,832 (7.98%) | 28,569,948 (37.61%) |
| EG2 | 79,306,896 | 55,560,044 (70.25%) | 49,481,416 (62.56%) | 6,078,628 (7.69%) | 30,666,025 (38.77%) |
| EG3 | 98,759,504 | 67,936,435 (69.05%) | 60,532,903 (61.52%) | 7,403,532 (7.52%) | 37,309,273 (37.92%) |
| Gene ID | Gene Name | Gene Description | Fold Change |
|---|---|---|---|
| Peroxisome | |||
| BSL78_06822 | HAO1 | putative hydroxyacid oxidase 1 | −0.395 |
| BSL78_14742 | HAO1 | putative hydroxyacid oxidase 1 | −0.394 |
| Lysosome | |||
| BSL78_08883 | BSL78_08883 | hypothetical protein | −2.769 |
| BSL78_10452 | BSL78_10452 | hypothetical protein | −0.322 |
| PI3K-Akt signaling pathway | |||
| BSL78_19875 | BSL78_19875 | putative tenascin isoform X1 | −10.977 |
| BSL78_21813 | PP2A | putative serine/threonine-protein phosphatase 2A regulatory subunit B″ subunit gamma | −12.589 |
| BSL78_01699 | COMP | putative cartilage oligomeric matrix protein | 0.429 |
| BSL78_06396 | BSL78_06396 | hypothetical protein | 0.326 |
| cAMP signaling pathway | |||
| BSL78_27675 | MRP4 | putative multidrug resistance-associated protein 4-like | −0.441 |
| BSL78_21913 | BSL78_21913 | hypothetical protein | −0.839 |
| TNF signaling pathway | |||
| BSL78_15356 | MMP16 | Matrix metalloproteinase-16 | 0.557 |
| BSL78_04534 | MAP3K15 | putative mitogen-activated protein kinase kinase kinase 15-like | −0.406 |
| Phagosome | |||
| BSL78_26181 | NOS | putative nitric oxide synthase, brain isoform X2 | 0.387 |
| BSL78_01699 | COMP | putative cartilage oligomeric matrix protein | 0.429 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, R.; Nie, X.; Li, X.; Tang, J.; Huang, C.; Liu, J. Immune Protective Effect of Chitosan Oligosaccharide on Lipopolysaccharide-Stimulated Coelomocytes of Sea Cucumber Apostichopus japonicus In Vitro. Polymers 2025, 17, 2752. https://doi.org/10.3390/polym17202752
Wang R, Nie X, Li X, Tang J, Huang C, Liu J. Immune Protective Effect of Chitosan Oligosaccharide on Lipopolysaccharide-Stimulated Coelomocytes of Sea Cucumber Apostichopus japonicus In Vitro. Polymers. 2025; 17(20):2752. https://doi.org/10.3390/polym17202752
Chicago/Turabian StyleWang, Rongyue, Xiaoyu Nie, Xiaofan Li, Jinwei Tang, Chong Huang, and Juan Liu. 2025. "Immune Protective Effect of Chitosan Oligosaccharide on Lipopolysaccharide-Stimulated Coelomocytes of Sea Cucumber Apostichopus japonicus In Vitro" Polymers 17, no. 20: 2752. https://doi.org/10.3390/polym17202752
APA StyleWang, R., Nie, X., Li, X., Tang, J., Huang, C., & Liu, J. (2025). Immune Protective Effect of Chitosan Oligosaccharide on Lipopolysaccharide-Stimulated Coelomocytes of Sea Cucumber Apostichopus japonicus In Vitro. Polymers, 17(20), 2752. https://doi.org/10.3390/polym17202752

