Engineering Cell Microenvironment Using Nanopattern-Derived Multicellular Spheroids and Photo-Crosslinked Gelatin/Hyaluronan Hydrogels
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Synthesis of Gelatin-Phenol (Gel-Ph)
2.3. Synthesis of Hyaluronan-Phenol (HA-Ph)
2.4. Characterization of Gel-Ph and HA-Ph
2.5. Preparation of Gel-Ph/HA-Ph Hydrogels
2.6. Characterization of Gel-Ph/HA-Ph Hydrogels
2.6.1. SEM
2.6.2. Compression Test
2.6.3. Rheological Analysis
2.6.4. Swelling
2.7. Cell Culture
2.8. Cell Viability in Gel-Ph/HA-Ph Hydrogels
2.9. Formation of Multicellular Spheroids Using cSAPs
2.10. Live/Dead Assay
2.11. Dynamic Monitoring of Multicellular Spheroids’ Self-Assembly Process on cSAPs
2.12. Encapsulation of Multicellular Spheroids in the Gel-Ph/HA-Ph Hydrogels
2.13. Angiogenic/Osteogenic Differentiation In Vitro
2.13.1. Immunofluorescence Staining
2.13.2. Gene Expression Assay
2.14. In Vivo Evaluation
2.14.1. Subcutaneous Implantation in Nude Mice
2.14.2. Histological Analysis
2.14.3. Immunofluorescent Staining
2.15. Statistical Analysis
3. Results
3.1. Characterization of Gel-Ph and HA-Ph
3.2. Characterization of Gel-Ph/HA-Ph Hydrogels
3.3. Cytocompatibility of Gel-Ph/HA-Ph Hydrogels
3.4. Surface-Guided Formation of Multicellular Spheroids and Further Encapsulation in Gel-Ph/HA-Ph Hydrogels
3.5. Angiogenic/Osteogenic Differentiation of Multicellular Spheroids in Gel-Ph/HA-Ph Hydrogels In Vitro
3.6. The Effects of Multicellular Spheroids in Gel-Ph/HA-Ph Hydrogels In Vivo
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Lee, E.J.; Jain, M.; Alimperti, S. Bone Microvasculature: Stimulus for Tissue Function and Regeneration. Tissue Eng. Part B Rev. 2021, 27, 313–329. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, E.M. Hydrogel: Preparation, characterization, and applications: A review. J. Adv. Res. 2015, 6, 105–121. [Google Scholar] [CrossRef] [PubMed]
- Liu, K.; Chen, Y.Y.; Zha, X.Q.; Li, Q.M.; Pan, L.H.; Luo, J.P. Research progress on polysaccharide/protein hydrogels: Preparation method, functional property and application as delivery systems for bioactive ingredients. Food Res. Int. 2021, 147, 110542. [Google Scholar] [CrossRef] [PubMed]
- Fan, Z.; Cheng, P.; Zhang, P.; Zhang, G.; Han, J. Rheological insight of polysaccharide/protein based hydrogels in recent food and biomedical fields: A review. Int. J. Biol. Macromol. 2022, 222, 1642–1664. [Google Scholar] [CrossRef] [PubMed]
- Eglen, R.M.; Reisine, T. Human iPS Cell-Derived Patient Tissues and 3D Cell Culture Part 2: Spheroids, Organoids, and Disease Modeling. SLAS Technol. 2019, 24, 18–27. [Google Scholar] [CrossRef]
- Yabe, S.G.; Nishida, J.; Fukuda, S.; Takeda, F.; Nashiro, K.; Ibuki, M.; Okochi, H. Definitive endoderm differentiation is promoted in suspension cultured human iPS-derived spheroids more than in adherent cells. Int. J. Dev. Biol. 2019, 63, 271–280. [Google Scholar] [CrossRef] [PubMed]
- Kawaguchi, S.; Soma, Y.; Nakajima, K.; Kanazawa, H.; Tohyama, S.; Tabei, R.; Hirano, A.; Handa, N.; Yamada, Y.; Okuda, S.; et al. Intramyocardial Transplantation of Human iPS Cell-Derived Cardiac Spheroids Improves Cardiac Function in Heart Failure Animals. JACC-Basic Transl. Sci. 2021, 6, 239–254. [Google Scholar] [CrossRef]
- Hirschhaeuser, F.; Menne, H.; Dittfeld, C.; West, J.; Mueller-Klieser, W.; Kunz-Schughart, L.A. Multicellular tumor spheroids: An underestimated tool is catching up again. J. Biotechnol. 2010, 148, 3–15. [Google Scholar] [CrossRef]
- Mehta, G.; Hsiao, A.Y.; Ingram, M.; Luker, G.D.; Takayama, S. Opportunities and challenges for use of tumor spheroids as models to test drug delivery and efficacy. J. Control. Release 2012, 164, 192–204. [Google Scholar] [CrossRef]
- Nunes, A.S.; Barros, A.S.; Costa, E.C.; Moreira, A.F.; Correia, I.J. 3D tumor spheroids as in vitro models to mimic in vivo human solid tumors resistance to therapeutic drugs. Biotechnol. Bioeng. 2019, 116, 206–226. [Google Scholar] [CrossRef]
- Kim, S.J.; Kim, E.M.; Yamamoto, M.; Park, H.; Shin, H. Engineering Multi-Cellular Spheroids for Tissue Engineering and Regenerative Medicine. Adv. Healthc. Mater. 2020, 9, 2000608. [Google Scholar] [CrossRef] [PubMed]
- Kim, W.; Gwon, Y.; Park, S.; Kim, H.; Kim, J. Therapeutic strategies of three-dimensional stem cell spheroids and organoids for tissue repair and regeneration. Bioact. Mater. 2023, 19, 50–74. [Google Scholar] [CrossRef] [PubMed]
- Kang, S.M.; Kim, D.; Lee, J.H.; Takayama, S.; Park, J.Y. Engineered Microsystems for Spheroid and Organoid Studies. Adv. Healthc. Mater. 2021, 10, 2001284. [Google Scholar] [CrossRef]
- Cesarz, Z.; Tamama, K. Spheroid Culture of Mesenchymal Stem Cells. Stem Cells Int. 2016, 2016, 9176357. [Google Scholar] [CrossRef] [PubMed]
- Hsu, S.H.; Hsieh, P.S. Self-assembled adult adipose-derived stem cell spheroids combined with biomaterials promote wound healing in a rat skin repair model. Wound Repair Regen. 2015, 23, 57–64. [Google Scholar] [CrossRef]
- Murphy, K.C.; Whitehead, J.; Zhou, D.J.; Ho, S.S.; Leach, J.K. Engineering fibrin hydrogels to promote the wound healing potential of mesenchymal stem cell spheroids. Acta Biomater. 2017, 64, 176–186. [Google Scholar] [CrossRef]
- Cui, X.; Hartanto, Y.; Zhang, H. Advances in multicellular spheroids formation. J. R. Soc. Interface 2017, 14, 20160877. [Google Scholar] [CrossRef]
- Ryu, N.E.; Lee, S.H.; Park, H. Spheroid Culture System Methods and Applications for Mesenchymal Stem Cells. Cells 2019, 8, 1620. [Google Scholar] [CrossRef]
- Tekin, H.; Anaya, M.; Brigham, M.D.; Nauman, C.; Langer, R.; Khademhosseini, A. Stimuli-responsive microwells for formation and retrieval of cell aggregates. Lab A Chip 2010, 10, 2411–2418. [Google Scholar] [CrossRef]
- Jeong, G.S.; No, D.Y.; Lee, J.; Yoon, J.; Chung, S.; Lee, S.H. Viscoelastic lithography for fabricating self-organizing soft micro-honeycomb structures with ultra-high aspect ratios. Nat. Commun. 2016, 7, 11269. [Google Scholar] [CrossRef]
- Kim, S.J.; Park, J.; Byun, H.; Park, Y.W.; Major, L.G.; Lee, D.Y.; Choi, Y.S.; Shin, H. Hydrogels with an embossed surface: An all-in-one platform for mass production and culture of human adipose-derived stem cell spheroids. Biomaterials 2019, 188, 198–212. [Google Scholar] [CrossRef] [PubMed]
- Cui, C.; Wang, J.X.; Qian, D.D.; Huang, J.Y.; Lin, J.; Kingshott, P.; Wang, P.Y.; Chen, M.L. Binary Colloidal Crystals Drive Spheroid Formation and Accelerate Maturation of Human-Induced Pluripotent Stem Cell-Derived Cardiomyocytes. ACS Appl. Mater. Interfaces 2019, 11, 3679–3689. [Google Scholar] [CrossRef] [PubMed]
- Deng, K.; Du, P.; Liu, K.; Tao, X.L.; Harati, J.; Jhang, J.W.; Kim, J.; Wang, P.Y. Programming Colloidal Self-Assembled Patterns (cSAPs) into Thermo-Responsible Hybrid Surfaces for Controlling Human Stem Cells and Macrophages. ACS Appl. Mater. Interfaces 2021, 13, 18563–18580. [Google Scholar] [CrossRef] [PubMed]
- Shi, Y.; Lin, J.; Tao, X.L.; Qu, J.; Liao, S.M.; Li, M.Y.; Deng, K.; Du, P.; Liu, K.; Thissen, H.; et al. Harnessing Colloidal Self-Assembled Patterns (cSAPs) to Regulate Bacterial and Human Stem Cell Response at Biointerfaces In Vitro and In Vivo. ACS Appl. Mater. Interfaces 2021, 13, 20982–20994. [Google Scholar] [CrossRef]
- Wang, P.Y.; Pingle, H.; Koegler, P.; Thissen, H.; Kingshott, P. Self-assembled binary colloidal crystal monolayers as cell culture substrates. J. Mat. Chem. B 2015, 3, 2545–2552. [Google Scholar] [CrossRef]
- Enkhbat, M.; Zhong, B.; Chang, R.; Geng, J.; Lu, L.-S.; Chen, Y.-J.; Wang, P.-Y. Harnessing Focal Adhesions to Accelerate p53 Accumulation and Anoikis of A549 Cells Using Colloidal Self-Assembled Patterns (cSAPs). ACS Appl. Bio Mater. 2022, 5, 322–333. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Ng, S.C.; Yu, J.S.; Tsai, W.B. Modification and crosslinking of gelatin-based biomaterials as tissue adhesives. Colloids Surf. B: Biointerfaces 2019, 174, 316–323. [Google Scholar] [CrossRef]
- Liu, Y.; Wong, C.W.; Chang, S.W.; Hsu, S.H. An injectable, self-healing phenol-functionalized chitosan hydrogel with fast gelling property and visible light-crosslinking capability for 3D printing. Acta Biomater. 2021, 122, 211–219. [Google Scholar] [CrossRef]
- Ying, H.Y.; Zhou, J.; Wang, M.Y.; Su, D.D.; Ma, Q.Q.; Lv, G.Z.; Chen, J.H. In situ formed collagen-hyaluronic acid hydrogel as biomimetic dressing for promoting spontaneous wound healing. Mater. Sci. Eng. C-Mater. Biol. Appl. 2019, 101, 487–498. [Google Scholar] [CrossRef]
- Sakai, S.; Hirose, K.; Taguchi, K.; Ogushi, Y.; Kawakami, K. An injectable, in situ enzymatically gellable, gelatin derivative for drug delivery and tissue engineering. Biomaterials 2009, 30, 3371–3377. [Google Scholar] [CrossRef]
- Sakai, S.; Ohi, H.; Taya, M. Gelatin/Hyaluronic Acid Content in Hydrogels Obtained through Blue Light-Induced Gelation Affects Hydrogel Properties and Adipose Stem Cell Behaviors. Biomolecules 2019, 9, 342. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.; Bae, J.W.; Oh, D.H.; Park, K.M.; Chun, Y.W.; Sung, H.J.; Park, K.D. In situ forming gelatin-based tissue adhesives and their phenolic content-driven properties. J. Mat. Chem. B 2013, 1, 2407–2414. [Google Scholar] [CrossRef] [PubMed]
- Thi, T.T.H.; Lee, J.S.; Lee, Y.; Park, K.M.; Park, K.D. Enhanced Cellular Activity in Gelatin-Poly(Ethylene Glycol) Hydrogels without Compromising Gel Stiffness. Macromol. Biosci. 2016, 16, 334–340. [Google Scholar] [CrossRef]
- Thi, P.L.; Lee, Y.; Tran, D.L.; Thi, T.T.H.; Kang, J.I.; Park, K.M.; Park, K.D. In situ forming and reactive oxygen species-scavenging gelatin hydrogels for enhancing wound healing efficacy. Acta Biomater. 2020, 103, 142–152. [Google Scholar] [CrossRef] [PubMed]
- Sakai, S.; Ohi, H.; Hotta, T.; Kamei, H.; Taya, M. Differentiation potential of human adipose stem cells bioprinted with hyaluronic acid/gelatin-based bioink through microextrusion and visible light-initiated crosslinking. Biopolymers 2018, 109, e23080. [Google Scholar] [CrossRef]
- Poveda-Reyes, S.; Moulisova, V.; Sanmartin-Masia, E.; Quintanilla-Sierra, L.; Salmeron-Sanchez, M.; Ferrer, G.G. Gelatin-Hyaluronic Acid Hydrogels with Tuned Stiffness to Counterbalance Cellular Forces and Promote Cell Differentiation. Macromol. Biosci. 2016, 16, 1311–1324. [Google Scholar] [CrossRef]
- Kolahdoozan, M.; Rahimi, T.; Taghizadeh, A.; Aghaei, H. Preparation of new hydrogels by visible light cross-linking of dextran methacrylate and poly(ethylene glycol)-maleic acid copolymer. Int. J. Biol. Macromol. 2023, 227, 1221–1233. [Google Scholar] [CrossRef]
- Wang, P.Y.; Hung, S.S.C.; Thissen, H.; Kingshott, P.; Wong, R.C.B. Binary colloidal crystals (BCCs) as a feeder-free system to generate human induced pluripotent stem cells (hiPSCs). Sci. Rep. 2016, 6, 36845. [Google Scholar] [CrossRef]
- Wang, P.Y.; Thissen, H.; Kingshott, P. Stimulation of Early Osteochondral Differentiation of Human Mesenchymal Stem Cells Using Binary Colloidal Crystals (BCCs). ACS Appl. Mater. Interfaces 2016, 8, 4477–4488. [Google Scholar] [CrossRef]
- Boden, A.; Bhave, M.; Wang, P.Y.; Jadhav, S.; Kingshott, P. Binary Colloidal Crystal Layers as Platforms for Surface Patterning of Puroindoline-Based Antimicrobial Peptides. ACS Appl. Mater. Interfaces 2018, 10, 2264–2274. [Google Scholar] [CrossRef]
- Diba, F.S.; Reynolds, N.; Thissen, H.; Wang, P.Y.; Kingshott, P. Tunable Chemical and Topographic Patterns Based on Binary Colloidal Crystals (BCCs) to Modulate MG63 Cell Growth. Adv. Funct. Mater. 2019, 29, 1904262. [Google Scholar] [CrossRef]
- Sen, A.; Kallos, M.S.; Behie, L.A. Effects of hydrodynamics on cultures of mammalian neural stem cell aggregates in suspension bioreactors. Ind. Eng. Chem. Res. 2001, 40, 5350–5357. [Google Scholar] [CrossRef]
- Lee, W.Y.; Chang, Y.H.; Yeh, Y.C.; Chen, C.H.; Lin, K.M.; Huang, C.C.; Chang, Y.; Sung, H.W. The use of injectable spherically symmetric cell aggregates self-assembled in a thermo-responsive hydrogel for enhanced cell transplantation. Biomaterials 2009, 30, 5505–5513. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.C.; Rostami, M.R.; Olaya, D.P.C.; Tzanakakis, E.S. Oxygen Transport and Stem Cell Aggregation in Stirred-Suspension Bioreactor Cultures. PLoS ONE 2014, 9, e102486. [Google Scholar] [CrossRef]
- Feng, J.W.; Mineda, K.; Wu, S.H.; Mashiko, T.; Doi, K.; Kuno, S.; Kinoshita, K.; Kanayama, K.; Asahi, R.; Sunaga, A.; et al. An injectable non-cross-linked hyaluronic-acid gel containing therapeutic spheroids of human adipose-derived stem cells. Sci. Rep. 2017, 7, 1548. [Google Scholar] [CrossRef]
- Shen, H.L.; Cai, S.X.; Wu, C.X.; Yang, W.G.; Yu, H.B.; Liu, L.Q. Recent Advances in Three-Dimensional Multicellular Spheroid Culture and Future Development. Micromachines 2021, 12, 96. [Google Scholar] [CrossRef]
- Verseijden, F.; Posthumus-van Sluijs, S.J.; Farrell, E.; van Neck, J.W.; Hovius, S.E.R.; Hofer, S.O.P.; van Osch, G. Prevascular Structures Promote Vascularization in Engineered Human Adipose Tissue Constructs Upon Implantation. Cell Transplant. 2010, 19, 1007–1020. [Google Scholar] [CrossRef]
- Verseijden, F.; Posthumus-van Sluijs, S.J.; Pavljasevic, P.; Hofer, S.O.P.; van Osch, G.; Farrell, E. Adult Human Bone Marrow- and Adipose Tissue-Derived Stromal Cells Support the Formation of Prevascular-like Structures from Endothelial Cells In Vitro. Tissue Eng. Part A 2010, 16, 101–114. [Google Scholar] [CrossRef]
- Bauman, E.; Feijao, T.; Carvalho, D.T.O.; Granja, P.L.; Barrias, C.C. Xeno-free pre-vascularized spheroids for therapeutic applications. Sci. Rep. 2018, 8, 230. [Google Scholar] [CrossRef]
- Chahal, A.S.; Gomez-Florit, M.; Domingues, R.M.A.; Gomes, M.E.; Tiainen, H. Human Platelet Lysate-Loaded Poly(ethylene glycol) Hydrogels Induce Stem Cell Chemotaxis In Vitro. Biomacromolecules 2021, 22, 3486–3496. [Google Scholar] [CrossRef]
- De Moor, L.; Smet, J.; Plovyt, M.; Bekaert, B.; Vercruysse, C.; Asadian, M.; De Geyter, N.; Van Vlierberghe, S.; Dubruel, P.; Declercq, H. Engineering microvasculature by 3D bioprinting of prevascularized spheroids in photo-crosslinkable gelatin. Biofabrication 2021, 13, 045021. [Google Scholar] [CrossRef] [PubMed]
- Yang, C.C.; Han, B.; Cao, C.L.; Yang, D.; Qu, X.Z.; Wang, X.Y. An injectable double-network hydrogel for the co-culture of vascular endothelial cells and bone marrow mesenchymal stem cells for simultaneously enhancing vascularization and osteogenesis. J. Mat. Chem. B 2018, 6, 7811–7821. [Google Scholar] [CrossRef] [PubMed]
- Heo, D.N.; Hospodiuk, M.; Ozbolat, I.T. Synergistic interplay between human MSCs and HUVECs in 3D spheroids laden in collagen/fibrin hydrogels for bone tissue engineering. Acta Biomater. 2019, 95, 348–356. [Google Scholar] [CrossRef] [PubMed]
- Fennema, E.; Rivron, N.; Rouwkema, J.; van Blitterswijk, C.; de Boer, J. Spheroid culture as a tool for creating 3D complex tissues. Trends Biotechnol. 2013, 31, 108–115. [Google Scholar] [CrossRef]
- Bhang, S.H.; Cho, S.W.; La, W.G.; Lee, T.J.; Yang, H.S.; Sun, A.Y.; Baek, S.H.; Rhie, J.W.; Kim, B.S. Angiogenesis in ischemic tissue produced by spheroid grafting of human adipose-derived stromal cells. Biomaterials 2011, 32, 2734–2747. [Google Scholar] [CrossRef]
- Skiles, M.L.; Sahai, S.; Rucker, L.; Blanchette, J.O. Use of Culture Geometry to Control Hypoxia-Induced Vascular Endothelial Growth Factor Secretion from Adipose-Derived Stem Cells: Optimizing a Cell-Based Approach to Drive Vascular Growth. Tissue Eng. Part A 2013, 19, 2330–2338. [Google Scholar] [CrossRef]
- Kaigler, D.; Krebsbach, P.H.; West, E.R.; Horger, K.; Huang, Y.C.; Mooney, D.J. Endothelial cell modulation of bone marrow stromal cell osteogenic potential. FASEB J. 2005, 19, 1–26. [Google Scholar] [CrossRef]
- Rouwkema, J.; De Boer, J.; Van Blitterswijk, C.A. Endothelial cells assemble into a 3-dimensional prevascular network in a bone tissue engineering construct. Tissue Eng. 2006, 12, 2685–2693. [Google Scholar] [CrossRef]
- Kim, J.; Kim, H.N.; Lim, K.T.; Kim, Y.; Pandey, S.; Garg, P.; Choung, Y.H.; Choung, P.H.; Suh, K.Y.; Chung, J.H. Synergistic effects of nanotopography and co-culture with endothelial cells on osteogenesis of mesenchymal stem cells. Biomaterials 2013, 34, 7257–7268. [Google Scholar] [CrossRef]
- Bohrnsen, F.; Schliephake, H. Supportive angiogenic and osteogenic differentiation of mesenchymal stromal cells and endothelial cells in monolayer and co-cultures. Int. J. Oral Sci. 2016, 8, 223–230. [Google Scholar] [CrossRef]
- Guillotin, B.; Bareille, R.; Bourget, C.; Bordenave, L.; Amedee, J. Interaction between human umbilical vein endothelial cells and human osteoprogenitors triggers pleiotropic effect that may support osteoblastic, function. Bone 2008, 42, 1080–1091. [Google Scholar] [CrossRef] [PubMed]
- Saleh, F.A.; Whyte, M.; Genever, P.G. Effects of endothelial cells on human mesenchymal stem cell activity in a three-dimensional in vitro model. Eur. Cells Mater. 2011, 22, 242–257. [Google Scholar] [CrossRef] [PubMed]
- Stoppato, M.; Stevens, H.Y.; Carletti, E.; Migliaresi, C.; Motta, A.; Guldberg, R.E. Influence of scaffold properties on the inter-relationship between human bone marrow derived stromal cells and endothelial cells in pro-osteogenic conditions. Acta Biomater. 2015, 25, 16–23. [Google Scholar] [CrossRef] [PubMed]
- Fuchs, S.; Jiang, X.; Schmidt, H.; Dohle, E.; Ghanaati, S.; Orth, C.; Hofmann, A.; Motta, A.; Migliaresi, C.; Kirkpatrick, C.J. Dynamic processes involved in the pre-vascularization of silk fibroin constructs for bone regeneration using outgrowth endothelial cells. Biomaterials 2009, 30, 1329–1338. [Google Scholar] [CrossRef] [PubMed]
- Sorrell, J.M.; Baber, M.A.; Caplan, A.I. Influence of Adult Mesenchymal Stem Cells on In Vitro Vascular Formation. Tissue Eng. Part A 2009, 15, 1751–1761. [Google Scholar] [CrossRef] [PubMed]
- Ghajar, C.M.; Kachgal, S.; Kniazeva, E.; Mori, H.; Costes, S.V.; George, S.C.; Putnam, A.J. Mesenchymal cells stimulate capillary morphogenesis via distinct proteolytic mechanisms. Exp. Cell Res. 2010, 316, 813–825. [Google Scholar] [CrossRef] [PubMed]
- Kuss, M.A.; Wu, S.H.; Wang, Y.; Untrauer, J.B.; Li, W.L.; Lim, J.Y.; Duan, B. Prevascularization of 3D printed bone scaffolds by bioactive hydrogels and cell co-culture. J. Biomed. Mater. Res. Part B 2018, 106, 1788–1798. [Google Scholar] [CrossRef]
- Mayer, H.; Bertram, H.; Lindenmaier, W.; Korff, T.; Weber, H.; Weich, H. Vascular endothelial growth factor (VEGF-A) expression in human mesenchymal stem cells: Autocrine and paracrine role on osteoblastic and endothelial differentiation. J. Cell. Biochem. 2005, 95, 827–839. [Google Scholar] [CrossRef]
- Li, H.Y.; Daculsi, R.; Grellier, M.; Bareille, R.; Bourget, C.; Remy, M.; Amedee, J. The Role of Vascular Actors in Two Dimensional Dialogue of Human Bone Marrow Stromal Cell and Endothelial Cell for Inducing Self-Assembled Network. PLoS ONE 2011, 6, e16767. [Google Scholar] [CrossRef]
- Tang, J.; Peng, R.; Ding, J.D. The regulation of stem cell differentiation by cell-cell contact on micropatterned material surfaces. Biomaterials 2010, 31, 2470–2476. [Google Scholar] [CrossRef]
- Babaie, A.; Lumicisi, J.; Thissen, H.; Wang, P.Y.; Sumer, H.; Kingshott, P. Binary Colloidal Crystal (BCC) Substrates for Controlling the Fate of Mouse Embryonic Stem Cells. Colloids Surf. B Biointerfaces 2020, 194, 111133. [Google Scholar] [CrossRef] [PubMed]
- Lee, B.H.; Kim, M.H.; Lee, J.H.; Seliktar, D.; Cho, N.J.; Tan, L.P. Modulation of Huh7.5 Spheroid Formation and Functionality Using Modified PEG-Based Hydrogels of Different Stiffness. PLoS ONE 2015, 10, e0118123. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Kievit, F.M.; Florczyk, S.J.; Stephen, Z.R.; Zhang, M.Q. 3D Porous Chitosan-Alginate Scaffolds as an In Vitro Model for Evaluating Nanoparticle-Mediated Tumor Targeting and Gene Delivery to Prostate Cancer. Biomacromolecules 2015, 16, 3362–3372. [Google Scholar] [CrossRef] [PubMed]
- Camci-Unal, G.; Cuttica, D.; Annabi, N.; Demarchi, D.; Khademhosseini, A. Synthesis and Characterization of Hybrid Hyaluronic Acid-Gelatin Hydrogels. Biomacromolecules 2013, 14, 1085–1092. [Google Scholar] [CrossRef]
- Moulisova, V.; Poveda-Reyes, S.; Sanmartin-Masia, E.; Quintanilla-Sierra, L.; Salmeron-Sanchez, M.; Ferrer, G.G. Hybrid Protein-Glycosaminoglycan Hydrogels Promote Chondrogenic Stem Cell Differentiation. ACS Omega 2017, 2, 7609–7620. [Google Scholar] [CrossRef]
- Broderick, E.P.; O’Halloran, D.M.; Rochev, Y.A.; Griffin, M.; Collighan, R.J.; Pandit, A.S. Enzymatic stabilization of gelatin-based scaffolds. J. Biomed. Mater. Res. Part B 2005, 72B, 37–42. [Google Scholar] [CrossRef]
- Sakai, S.; Hashimoto, I.; Kawakami, K. Agarose-gelatin conjugate membrane enhances proliferation of adherent cells enclosed in hollow-core microcapsules. J. Biomater. Sci. Polym. Ed. 2008, 19, 937–944. [Google Scholar] [CrossRef]
- Yang, G.; Xiao, Z.H.; Ren, X.M.; Long, H.Y.; Qian, H.; Ma, K.L.; Guo, Y.Q. Enzymatically crosslinked gelatin hydrogel promotes the proliferation of adipose tissue-derived stromal cells. PeerJ 2016, 4, e2497. [Google Scholar] [CrossRef]
- Ramirez, M.A.; Pericuesta, E.; Yanez-Mo, M.; Palasz, A.; Gutierrez-Adan, A. Effect of long-term culture of mouse embryonic stem cells under low oxygen concentration as well as on glycosaminoglycan hyaluronan on cell proliferation and differentiation. Cell Prolif. 2011, 44, 75–85. [Google Scholar] [CrossRef]
- Mineda, K.; Feng, J.; Ishimine, H.; Takada, H.; Doi, K.; Kuno, S.; Kinoshita, K.; Kanayama, K.; Kato, H.; Mashiko, T.; et al. Therapeutic Potential of Human Adipose-Derived Stem/Stromal Cell Microspheroids Prepared by Three-Dimensional Culture in Non-Cross-Linked Hyaluronic Acid Gel. Stem Cells Transl. Med. 2015, 4, 1511–1522. [Google Scholar] [CrossRef]
- Eke, G.; Mangir, N.; Hasirci, N.; MacNeil, S.; Hasirci, V. Development of a UV crosslinked biodegradable hydrogel containing adipose derived stem cells to promote vascularization for skin wounds and tissue engineering. Biomaterials 2017, 129, 188–198. [Google Scholar] [CrossRef] [PubMed]
- Shi, W.; Fang, F.; Kong, Y.F.; Greer, S.E.; Kuss, M.; Liu, B.; Xue, W.; Jiang, X.P.; Lovell, P.; Mohs, A.M.; et al. Dynamic hyaluronic acid hydrogel with covalent linked gelatin as an anti-oxidative bioink for cartilage tissue engineering. Biofabrication 2022, 14, 014107. [Google Scholar] [CrossRef] [PubMed]
- Dahle, J.; Kvam, E.; Stokke, T. Bystander effects in UV-induced genomic instability: Antioxidants inhibit delayed mutagenesis induced by ultraviolet A and B radiation. J. Carcinog. 2005, 4, 11. [Google Scholar] [CrossRef] [PubMed]
- Caspersen, M.B.; Roubroeks, J.P.; Qun, L.; Shan, H.; Fogh, J.; RuiDong, Z.; Tommeraas, K. Thermal degradation and stability of sodium hyaluronate in solid state. Carbohydr. Polym. 2014, 107, 25–30. [Google Scholar] [CrossRef]
- Baker, B.M.; Chen, C.S. Deconstructing the third dimension—How 3D culture microenvironments alter cellular cues. J. Cell Sci. 2012, 125, 3015–3024. [Google Scholar] [CrossRef]
Gene Name | Primer Sequences (5′ → 3′) |
---|---|
GAPDH | F: TCGGAGTCAACGGATTTGGT |
R: TTCCCGTTCTCAGCCTTGAC | |
Runx2 | F: CCGCCTCAGTGATTTAGGGC |
R: GGGTCTGTAATCTGACTCTGTCC | |
ALP | F: AACATCAGGGACATTGACGTG |
R: GTATCTCGGTTTGAAGCTCTTCC | |
Col lα1 | F: GTCACCCACCGACCAAGAAACC |
R: AAGTCCAGGCTGTCCAGGGATG | |
OCN | F: CTCACACTCCTCGCCCTATT |
R: TTGATACAGGTAGCGCCTGG | |
OPN | F: GCCGAGGTGATAGTGTGGTT |
R: AACGGGGATGGCCTTGTATG | |
vWF | F: AGAACAGATGTGTGGCCCTG |
R: CTTCCGGTCCTGACAGACAC | |
PECAM1 | F: CCAAGGTGGGATCGTGAGG |
R: TCGGAAGGATAAAACGCGGTC | |
VEGF-A | F: GGCCTCCGAAACCATGAACT |
R: GGTCTCGATTGGATGGCAGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Z.; Liu, Y.; Tao, X.; Du, P.; Enkhbat, M.; Lim, K.S.; Wang, H.; Wang, P.-Y. Engineering Cell Microenvironment Using Nanopattern-Derived Multicellular Spheroids and Photo-Crosslinked Gelatin/Hyaluronan Hydrogels. Polymers 2023, 15, 1925. https://doi.org/10.3390/polym15081925
Zhang Z, Liu Y, Tao X, Du P, Enkhbat M, Lim KS, Wang H, Wang P-Y. Engineering Cell Microenvironment Using Nanopattern-Derived Multicellular Spheroids and Photo-Crosslinked Gelatin/Hyaluronan Hydrogels. Polymers. 2023; 15(8):1925. https://doi.org/10.3390/polym15081925
Chicago/Turabian StyleZhang, Zhen, Yi Liu, Xuelian Tao, Ping Du, Myagmartsend Enkhbat, Khoon S. Lim, Huaiyu Wang, and Peng-Yuan Wang. 2023. "Engineering Cell Microenvironment Using Nanopattern-Derived Multicellular Spheroids and Photo-Crosslinked Gelatin/Hyaluronan Hydrogels" Polymers 15, no. 8: 1925. https://doi.org/10.3390/polym15081925
APA StyleZhang, Z., Liu, Y., Tao, X., Du, P., Enkhbat, M., Lim, K. S., Wang, H., & Wang, P.-Y. (2023). Engineering Cell Microenvironment Using Nanopattern-Derived Multicellular Spheroids and Photo-Crosslinked Gelatin/Hyaluronan Hydrogels. Polymers, 15(8), 1925. https://doi.org/10.3390/polym15081925