Next Article in Journal
ZnO-Based Photocatalysts: Synergistic Effects of Material Modifications and Machine Learning Optimization
Previous Article in Journal
Metal-Modified Zeolites for Catalytic Dehydration of Bioethanol to Ethylene: Mechanisms, Preparation, and Performance
Previous Article in Special Issue
Strategies and Recent Trends in Engineering Thermostable GH11 Xylanases
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Catalysts
Volume 15
Issue 8
10.3390/catal15080792
catalysts-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Enhancing the Production of Thermostable Mangrovibacter plantisponsor Xylanase for Application in Breadmaking

by
Wafa A. Alshehri
1,
Ebtihal M. Alharbi
1,
Bilel Hadrich
2,
Ashjan F. Khalel
3,
Fatimah S. Alqahtani
4,
Yaaser Q. Almulaiky
5 and
Adel Sayari
1,*
1
Department of Biological Sciences, College of Science, University of Jeddah, Jeddah 23890, Saudi Arabia
2
Department of Chemical Engineering, College of Engineering, Imam Mohammad Ibn Saud Islamic University (IMSIU), Riyadh 11432, Saudi Arabia
3
Department of Biology, University Collage of Aldarb, Jazan University, Jazan 45142, Saudi Arabia
4
Department of Biology, Faculty of Science, University of Bisha, Bisha 61922, Saudi Arabia
5
The Applied College, University of Jeddah, Jeddah 23890, Saudi Arabia
*
Author to whom correspondence should be addressed.
Catalysts 2025, 15(8), 792; https://doi.org/10.3390/catal15080792 (registering DOI)
Submission received: 27 June 2025 / Revised: 11 August 2025 / Accepted: 18 August 2025 / Published: 20 August 2025
(This article belongs to the Special Issue New Trends in Industrial Biocatalysis, 2nd Edition)
Browse Figures
Versions Notes

Abstract

Xylanase was isolated from a newly isolated Mangrovibacter plantisponsor UMTKB-3 strain. The response surface methodology was employed to optimize extracellular xylanase production; the best experimental value (25 ± 0.12 U/mL) was obtained when using 16 g/L of tryptone, 15 g/L of yeast extract, 15 g/L of NaCl, and an initial optical density of 0.2 at 600 nm. The optimized xylanase production was enhanced by five-fold compared to the pre-optimized conditions. Maximum xylanase activity was measured at 50 °C and pH 6, using xylan as the substrate. The enzyme maintained more than 98.9% of its initial activity at temperatures ranging from 45 to 60 °C. Xylanase exhibited a higher stability in the presence of metal ions: residual activities of 190%, 97.1%, and 81.1% were measured in the presence of MnCl2, FeSO4, and NiCl2, respectively. Moreover, the application of M. plantisponsor xylanase to improve bread quality was investigated. The rate of increase in firmness during storage was lower in xylanase-supplemented bread compared with control bread. Supplementing the bread with xylanase resulted in increased elasticity and extensibility, as well as an increase in volume and a decrease in density. These findings suggest that our enzyme is a promising candidate for food industry applications, particularly in the baking industry, for promoting human health.

Graphical Abstract

1. Introduction

In today’s modern society, consumers’ food needs and preferences have undergone substantial changes. To produce more wholesome and fiber-rich foods, the baking industry is shifting toward creating healthy bread with reduced chemical use. However, the production of such bread poses specific technological difficulties [1].
To improve consumers’ acceptance of whole-wheat bread with enhanced body, texture, flavor, and other desirable properties, appropriate technological advancements are needed. Microbial enzymes can help to overcome these problems and can be added as processing aids or additives [2]. Chemical improvers have been used as a standard method of compensating for flour quality for many years. However, in the last few decades, many chemicals have been linked to health hazards; for example, azodicarbonamide may cause allergic reactions, and semicarbazide, produced from azodicarbonamide and potassium bromate, may be associated with specific forms of cancer [3]. The replacement of chemical dough improvers with enzymes allows the production of safe products.
These enzymes also change the dough structure and improve bread quality. However, they are Generally Recognized as Safe (GRAS) and do not remain active in the final product after baking [4]. One of the most common methods for improving dough and bread characteristics in breadmaking is the use of processing aids, such as enzymes, especially microbial enzymes, because they have no adverse effects on humans [5,6,7,8].
Xylanase enzymes have garnered significant attention, primarily because they play a crucial role in cellular metabolism and the biotechnology industry. Interest in xylanolytic enzymes has received considerable attention due to their potential applications in various industrial processes, including biopulping in paper production, bread and beverage manufacturing, fermentation and biofuel production, animal feed preparation, leather treatment, bioremediation, and the pharmaceutical industry [9]. Xylanases are a group of ubiquitous enzymes that hydrolyze the β-1,4-glycosidic bonds of xylan to yield xylooligosaccharides and xylose.
Xylanases can improve the handling characteristics of dough and bread. Among hemicellulases, xylanases and pentosanases are the two key enzymes responsible for hydrolyzing the significant components of hemicellulose, namely, xylans and pentosans [10]. Xylanase modifies the structure and function of arabinoxylan by attacking the arabinoxylan backbone and reducing the degree of polymerization, thereby enhancing bread quality [6]. Previous studies have shown that some xylanases increase the softness and specific volume of wheat bread and retard its staling during storage. Different xylanase families have particular effects on arabinoxylans, influencing their breaking points and reaction products, which, in turn, exert distinct effects on breadmaking [6,11,12].
This paper focuses on screening xylanolytic bacteria from extreme biotopes in Saudi Arabia. The response surface methodology was employed to optimize enzyme production and determine the corresponding growth conditions. The isolated xylanase was characterized and utilized to enhance bread quality.

2. Results and Discussion

2.1. Screening and Molecular Identification of the Xylanase-Producing Strain

Isolates from different Saudi Arabian biotopes were examined for their ability to produce xylanase. Among the positive strains, only one was retained based on its attractive positive zone, as observed in the presence of Congo red indicators. The 16S rRNA gene of the retained strain was amplified, sequenced, and subjected to NCBI BLAST analysis. The obtained sequence (GenBank Access Number PV759790) showed 99.78% identity with Mangrovibacter plantisponsor strain UMTKB-3. This result was confirmed by the phylogenetic tree analysis (Figure 1).

2.2. Growth and Xylanase Activity Characteristics of Mangrovibacter plantisponsor

The effect of cultural conditions was studied to maximize the production of the enzyme. The highest growth of M. plantisponsor was at pH 6 with a suitable temperature of 45 °C and 230 rpm. With an increase in the incubation period, enzyme production increased and then decreased. The cells’ dynamic growth condition and xylanase activity in the fermentation medium were reflected by the absorbance value. The growth phase of M. plantisponsor started quickly after culturing in a fermentation medium for 3 h and lasted for approximately 20 h. Slow growth was observed from 14 to 20 h, after which the strain entered a stationary phase and then a dead phase from 22 to 24 h. This growth decline may be attributed to the depletion of nutrients in the fermentation medium and a low metabolic level during the aging phase of growth. Additionally, xylanase activity was detected from the start of bacterial growth, with a peak (5.091 ± 0.13 U/mL) after 12 h of cultivation, indicating that this time point was optimal for enzyme production.

2.3. Optimization of M. plantisponsor Xylanase Production

M. plantisponsor xylanase production was optimized using the Box–Behnken design to select the most influential factors and their interactions.
Table 1 presents the experimental results for xylanase activity, which range from 8.221 ± 0.171 U/mL (run 25, center point) to 18.683 ± 0.474 U/mL (run 12) under conditions of 16 g/L tryptone, 10 g/L yeast extract, 10 g/L NaCl, and an initial optical density (OD) of 0.20. The independent repetitions for each experiment demonstrated high accuracy, as indicated by the low standard deviation values in Table 1, ranging from 0.155 to 0.755 U/mL. Additionally, the coefficient of variation (CV = standard deviation/mean) remained low, ranging from 1.03% to 5.36%.
Equation (1) presents the determined model for M. plantisponsor xylanase production as a function of four factors and their interactions in quadratic form.
y ^ k = 16.290 + 0.592 · x 1 k − 0.044 · x 2 k + 0.192 · x 3 k + 0.929 · x 4 k + 0.369 · x 1 k · x 2 k                                                           + 1.159 · x 1 k · x 3 k + 1.119 · x 1 k · x 4 k + 0.460 · x 2 k · x 3 k + 0.523 · x 2 k · x 4 k                                                                   + 0.194 · x 3 k · x 4 k − 1.977 · x 1 k 2 − 0.785 · x 2 k 2 − 1.470 · x 3 k 2 − 1.819 · x 4 k 2
where x 1 k , x 2 k , x 3 k , and x 4 k represent the centered and reduced levels (−1, 0, or +1) of tryptone (in g/L), yeast extract (in g/L), NaCl (in g/L), and the initial OD, respectively, for the kth experiment.
With R2 = 69.09% and RMSE = 5.690 U/mL, the identified model has an acceptable fitting quality for describing xylanase production as a function of the four factors.
Table 2 presents the results of Student’s t-test, indicating the significance level of each term in the model (Equation (1)) [13,14]. Among the four factors, three have an exclusively significant quadratic effect on xylanase production (p < 0.05), as the studied factors do not influence the response either linearly or through interaction (p > 0.05). The most significant influence was observed for the tryptone concentration, with a coefficient a11 = −1.977 (p = 0.002 < 0.01). The second-most significant influence was observed for the initial OD, with a coefficient a44 = −1.819 (p = 0.004 < 0.01). The least significant, but still notable, influence was observed for the NaCl concentration, with a coefficient a33 = −1.470 (p = 0.015 < 0.05).
Figure 2 supports all the interpretations mentioned above. The tryptone concentration, initial optical density (OD), and NaCl concentration influence xylanase production in a quadratic manner, while the yeast extract concentration has a minimal effect. The variations in the three significant factors generate considerable parabolic curves of the response (xylanase production), except for those involving the yeast extract concentration. Therefore, the center of the chosen experimental field represents the minimum response. This condition should not be selected if the goal is to maximize xylanase activity.
Using the identified model (Equation (2)) and the optimization tool of STATISTICA 12.0 Software, the optimal conditions for maximizing xylanase activity were determined (Figure 3).
By using the maximum levels of the four tested factors—tryptone concentration of 16 g/L, yeast extract concentration of 15 g/L, NaCl concentration of 15 g/L, and initial OD of 0.2—the maximum xylanase production of 25.82 ± 0.12 U/mL can be achieved.
In conclusion, the excellent correspondence between the predicted values and experimental results confirms the presence of an optimal point and the validity of the response model. For this reason, a confirmation experiment was conducted three times, yielding xylanase production values of 25.82 ± 0.12 U/mL (experimental value), 8.221 ± 0.171 U/mL (run 25, center point), and 18.683 ± 0.474 U/mL (run 12) under the identified conditions.

2.4. Effect of Temperature and pH on M. plantisponsor Xylanase Activity and Stability

Thermal stability is advantageous for biotechnological applications and industrial processes. In this study, we determined the effect of temperature on xylanase activity and stability. Xylanase activity was investigated at temperatures ranging from 40 to 80 °C (Figure 4A) at pH 6, using xylan as the substrate. Our results showed that xylanase is significantly active in this temperature interval, with a maximum activity recorded at 50 °C (Figure 4A).
The suitable temperature of M. plantisponsor xylanase corresponds with that of the xylanases produced by A. niger and B. licheniformis, showing a maximum activity at 50 °C [15,16]. Bacillus halodurans and Thermomyces lanuginosus were found to have the highest xylanase activity at 70 °C and 75 °C, respectively [17,18]. The highest activity of xylanase from Bacillus licheniformis was obtained at 35 °C [19], whereas Joshi et al. (2020) found the highest xylanase activity at 80 °C [20].
Regarding the thermal stability profile of xylanase, our results shown in Figure 4A indicate that the enzyme exhibits thermostability. Xylanase maintained 98.9% to around 73% of its initial activity at 45 °C and 60 °C, respectively, after 15 min of incubation using xylan as the substrate. Meanwhile, xylanase maintained 95% and 50% of its activity at 25 °C and 4 °C after 24 h of incubation using xylan as the substrate. These results align with previously reported findings [19,21] and contrast with those of Zhang et al. (2023), who reported a reduction of 48.56% and 45.97% in Bacillus cereus L-1 xylanase activity at 30 °C and 40 °C, respectively [22]. This remarkable stability makes M. plantisponsor xylanase a potential candidate for industrial applications.
The effect of pH on xylanase activity and stability was investigated. As shown in Figure 4B, xylanase exhibits an optimum activity at pH 6. Joshi et al. (2022) reported similar results [23]. However, Chauhan et al. (2023) found that Bacillus sp. had optimum xylanase activity at pH 4 [24], and the optimum activity of Bacillus subtilis xylanase was measured at pH 8 [25]. The pH stability of xylanase was examined by incubating the enzyme for 60 min at 25 °C, covering a wide pH range from 3 to 12. Our results showed that M. plantisponsor xylanase was stable over an extensive pH range. It retained 93% of its activity at pH 6, 68% at pH 5, and 79% at pH values between 5 and 5.5 (Figure 4B).
The pH range of optimum action has typically been recorded between pH 3.0 and 6.0 [26]. Ameen et al. (2023) reported that the optimal activity of Aspergillus fumigatus xylanase was measured at pH 6 [27]. Other researchers found that the maximum activity of xylanase from Bacillus subtilis was obtained at pH 9, while it showed good activity retentions of 66% and 56% at pH 10 and 11, respectively [28]. Other researchers found that Bacillus pumilus produced a considerable amount of the xylanase enzyme, retaining 92–100% of its activity within a pH range of 8–10 [29]. Moreover, Malhotra et al. (2020) demonstrated that Bacillus licheniformis xylanase remained stable over a pH range of 6.5–9 [19].

2.5. Effect of Substrate Concentration and Incubation Time on M. plantisponsor Xylanase

Substrate concentration plays a notable role in enzymatic activity variation, including xylanase. The present study measured xylanase activity in increasing concentrations of a xylan solution under optimal assay conditions at 50 °C and pH 6. The results show that the xylanase activity was zero up to a concentration of 0.1% of the substrate (xylan), after which the enzyme activity gradually increased. The optimum xylanase activity (100%) was reached at a substrate concentration of 0.8%. A similar result was reported previously [30]. Beyond this value, the xylanase activity remained constant. As reported previously, the activity of xylanase increases gradually with increasing substrate concentration until it reaches its optimum activity, after which it remains in a steady state [31].
The effect of incubation time on xylanase activity was examined between 5 and 25 min. The maximum xylanase activity was obtained at approximately 15 min, a result similar to that reported previously [32,33].

2.6. Effect of Metal Ions on M. plantisponsor Xylanase Activity

In the present study, of the eight metal ions screened, MnCl2 positively influenced the xylanase activity. Some of the other metal ions, such as NiCl2, FeSO4, KCl, CaCl2, and CoCl2, decreased the enzyme activity, but to a significantly lesser extent, ranging from 97% to 64%. With 5 mM MgSO4 or NaCl, the enzyme activity was reduced by approximately half. Finally, the enzyme was strongly inhibited by 5 mM HgCl2, with a 16% residual activity. In contrast, the xylanase activity was enhanced in the presence of 10.5 mM MnCl2, increasing the activity to 227% compared to the control (Table 3). HgCl2 was previously reported to completely inhibit the activity of xylanase from different sources [34]. Conversely, as reported earlier [35], MnCl2 caused a 50% reduction in enzyme activity.

2.7. Effect of Inhibitors and Organic Solvents on M. plantisponsor Xylanase

The effect of various inhibitors on the xylanase activity was determined. A residual enzyme activity of 53.5 ± 0.4%, 41.0 ± 0.5%, and 32.1 ± 0.2% was obtained with 0.1% H2O2, polyethylene glycol, and sodium azide, respectively (Table 4).
SDS, β-mercaptoethanol, DDT, EDTA, and surfactants (Tween 20 and Tween 80) significantly inhibited the enzyme activity (Table 4). The sudden decrease in the enzyme activity was due to the synthetic and anionic surfactant nature of SDS, which causes conformational changes in enzymes that lead to the inactivation and denaturation of proteins. The hydrophobic tail of SDS strongly binds to the polypeptide chain of the protein, denaturing it.
Many studies have demonstrated that the action of xylanase from Trichoderma inhamatum was strongly reduced by the addition of SDS detergent [36]. Abdella et al. (2021) reported that SDS and EDTA inhibited the activity of xylanase purified from the Paecilomyces genus [37]. In contrast, other studies have reported that various inhibitors, including dithiothreitol (DTT), Tween-20, urea, and β-mercaptoethanol, enhanced enzyme activity similarly [38,39].
The effect of organic solvents, such as chloroform, ethanol, isopropanol, and acetone, reduced the enzyme activity by half, ranging from 60% to 43% (Table 4). Similar results were observed with xylanase from Bacillus licheniformis by [40]. Some other works reported that different organic solvents did not significantly affect some xylanase enzymes, showing residual activities of 94–70% [41]. However, enhanced Bacillus subtilis xylanase activity in the presence of some organic solvents was reported [42,43]. In contrast, Rajabi et al. (2022) completely inhibited the activity of xylanase from B. subtilis when they added organic solvents [44].

2.8. Effects of Adding M. plantisponsor Xylanase on Breadmaking

The most crucial determinant of bread quality is its final volume. Loaf volume measurements were taken 2 h after the baking step. As shown in Figure 5A, the specific volumes of the white bread samples increased significantly when the amount of xylanase added was increased. Indeed, a 45.53% increase in the white bread volume was obtained with the addition of 125 units of xylanase (Figure 5A). However, with 150 units of xylanase, the white bread volume decreased slightly (Figure 5A).
On the other hand, a 24.7% increase in the whole-wheat bread volume was obtained with 50 units of xylanase (Figure 5B). The whole-wheat bread volume tends to be lower than bread made from white flour due to the lower hydration of gluten in the presence of insoluble arabinoxylans. These results are consistent with previous reports [45,46].
This effect can be explained by the redistribution of water from the pentosan phase to the gluten phase. The increase in gluten volume provides greater extensibility, ultimately resulting in improved oven spring [45,47]. The pore quantity of bread slices contributed to the enhanced bread volume. The preparation of xylanase has been applied to breadmaking, and several reports have shown positive effects [47,48]. The hydrolysis of non-starch polysaccharides by xylanase will result in high digestibility and chewability of bread and xylooligosaccharides as the hydrolysis product. The presence of xylooligosaccharides in bread would help improve human health.
The white bread mass was determined after baking. Our results show that the white bread mass decreased significantly when the amount of xylanase added was increased (Figure 6A). The bread mass decreased from 188 g in the absence of xylanase to 120 g in the presence of 125 units of xylanase (Figure 6A).
The maximum decrease in the whole-wheat bread mass was detected with 50 units of xylanase (Figure 6B). Based on Figure 6, the bread with the highest volume (50 units of xylanase) showed a decreasing mass. This might be explained by the numerous pores that formed. These results correlate with previous findings [45,46].
Bread pores are essential indicators for evaluating bread. In this study, cross-section or apparent porosity was determined digitally using a digital camera. The bread treated with xylanase had a larger stoma than the control group (Figure 7).
The pore quantity of bread slices contributes to the enhanced volume of bread [45,49].

3. Materials and Methods

3.1. Chemicals

Beechwood xylan, Congo red dye, dinitrosalicylic acid (DNS), potassium sodium tartrate tetrahydrate, Rochelle salt, phenol crystal ACS reagent, and all other chemicals were from Sigma Chemical (St. Louis, MO, USA).

3.2. Source of Strains

Different bacterial strains were isolated from extreme biotopes in the Rabigh coastal sabkha, the Kingdom of Saudi Arabia. Soil was collected from a mixture of clay soil and olive pomace. The soil samples showed the highest electrical conductivity (EC) of 82,400 µS/cm. Examination of the soil granules showed variation between particle size and shape among the studied sites. The sandy and olive pomace levels in the soil were 1.3% and 1.7%, respectively. The percentage of clay in the soil was estimated to be 7.3%. The mixtures were incubated at room temperature in Rabigh, the Kingdom of Saudi Arabia, for a week. The soil layer below was collected in sterile plastic bags and stored at 4 °C until use. Seventy-five strains were isolated from the soil and olive pomace mixtures. These strains were screened for their capacity to hydrolyze xylan.

3.3. Screening of Xylanase-Producing Bacteria

The initial screening for xylanolytic bacteria was performed using xylan–agar plates. Selected bacterial isolates were grown in 15 mL of nutrient broth at pH 7 and 45 °C until an absorbance of 0.5 at 600 nm was reached. Then, 10 µL of the grown cultures were inoculated onto the xylan agar medium with 0.5% oat xylan. The medium contained the following (g/L): yeast extract, 3.0; peptone, 1.5; NaCl, 3.5; NaNO3, 1.0; KH2PO4, 1.0; MgSO4.7H2O, 0.3; and agar, 20. After incubation, the plates were stained with 0.5% Congo red dye for 30 min and then distained with 1 M NaCl. Colonies with clear halo zones around them were considered presumptive xylanase producers [50]. The precise zone diameters were measured after 24 h of incubation at 45 °C by flooding the plates with a mercuric chloride solution [51]. The bacterial strain with the larger halo was considered the more effective xylanase producer and was chosen for further studies.

3.4. Identification of the Selected Strain

The extraction of genomic DNA from the selected strain was performed by centrifuging the bacterial culture at 6000 rpm for 15 min. DNA was extracted using a Gene JET Genomic DNA Purification kit (Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer’s instructions.
For species identification, 16S rDNA universal oligonucleotide primers were used as described previously [52]. An internal part of the 16S rRNA gene was amplified using genomic DNA as a template and the universal forward (5′GCAACGAAGTATGGAACTGC3′) and reverse (5′TTAATAAATCGCCTTATTAAAGG3′) primers.
The DNA sequence of the 16S rRNA gene was amplified using a thermal cycler PCR machine (Bibby Scientific, Stone, UK) in a reaction mixture (25 μL) containing 2 μL of DNA, 1 μL of each primer (10 μM), 12.5 μL master mix (2×), and 9.5 μL H2O. Sanger sequencing was performed at the Beijing Genomic Institute (BGI), Hong Kong, China. The sequence was compared to the NCBI database using BLAST software (Blast+ 2.16.0). The obtained sequences were aligned using Ugene (version 52.1) [53] with the T-Coffee algorithm (https://www.ebi.ac.uk/, accessed on 13 January 2023, EMBL-EBI, Cambridge, UK).

3.5. Growth of Xylanase-Producing Bacteria

The selected xylanase-producing bacteria were precultured in a 250 mL Erlenmeyer flask containing 25 mL of unstimulated nutrient broth medium, pH 8. The 12 h overnight preculture was inoculated into another Erlenmeyer flask containing 25 mL of the same production medium with an initial absorbance at 600 nm of 0.1. The flask was then incubated on a shaker at 45 °C and 230 rpm. Growth was monitored by determining the culture absorbance at 600 nm every 2 h. The tested culture was centrifuged at 6000 rpm for 15 min, and the supernatant was used for the xylanase activity assay.

3.6. Xylanase Activity Measurement

Xylanase activity was determined as described previously [54] with slight modifications, using 1.0% (w/v) xylan in 0.05 M Na citrate buffer (pH 6) after a 15 min reaction time. The assay mixture (1.8 mL of substrate solution and 0.2 mL of culture filtrate) was incubated at 50 °C for 15 min, and the reaction was stopped by adding 3.0 mL of dinitrosalicylic acid (DNS) reagent. The mixture was then heated at 90 °C for 10 min to terminate the enzyme reaction, followed by measuring the absorbance at 540 nm. The amount of reducing sugar liberated was determined using xylose from Sigma Chemical (St. Louis, MO, USA) as a standard. One unit (U) of xylanase activity was defined as the amount of enzyme required to liberate 1 μmol of xylose per minute under the assay conditions [55].
Unit / mL   E n z y m e = O D × V / F a c t o r 15 × 0.2
where V is the total volume (in milliliters) of the assay; 15 is the time of the assay (in minutes), as per the unit definition; and 0.2 is the volume of the enzyme (in milliliters) used.

3.7. Optimization of Mangrovibacter plantisponsor Xylanase Production

The one-factor-at-a-time method was employed to identify suitable carbon and nitrogen sources and to assess the impact of agitation, temperature, and incubation time on xylanase production.
In this context, different cultural media were tested. Samples were taken every two hours to monitor the enzyme production. The experiments were performed in 250 mL culture flasks. The culture (50 mL) was inoculated from a 12 h preculture. The culture medium was calibrated to pH 8 and then incubated aerobically on a rotary shaker set at 45 °C and 230 rpm for 12 h.
The response surface methodology was employed to optimize Mangrovibacter plantisponsor xylanase production by identifying the optimal culture conditions, including tryptone (8–16 g/L), yeast extract (5–15 g/L), and NaCl (5–15 g/L) concentrations, as well as the initial optical density (OD = 0.1–0.2). This methodology also allowed us to evaluate the effects of each variable.
The Box–Behnken design (BBD) used in this study comprised 25 experiments that covered all possible combinations of the four independent factors, each at three levels: low, center, and high. Each experiment was conducted in triplicate, and xylanase production (as the dependent variable y ) was reported as the mean ± standard error.
According to the following mathematical multivariable polynomial quadratic model [56], the dependent response ( y ^ k ) can be expressed in terms of coded variables (xi):
y ^ k = β 0 + ∑ i = 1 n β i · x i k + ∑ i = 1 n β i i · x i k 2 + ∑ i = 1 n ∑ j > i n β i j · x i k · x j k
where y ^ k denotes the predicted xylanase production (U/mL) for the kth experiment; the terms β 0 , β i , β i j , and β i i correspond to the model’s intercepts, linear, interactions, and quadratic coefficients, respectively; x i k represents the centered and reduced levels of factor I in the kth experiment, taking values of −1, 0, or +1; and the variable n denotes the total number of factors considered in the model.

3.8. Effect of Temperature and pH on Crude Mangrovibacter plantisponsor Xylanase Activity and Stability

The optimal temperature was determined by measuring xylanase activity at various temperatures (25–80 °C), at pH 6, using xylan as the substrate. The thermal stability of the enzyme was evaluated by measuring the residual activities after incubating the enzyme solution for 15 min at various temperatures (40–80 °C). The remaining enzyme activity was measured using the standard xylan method and expressed as a percentage of the initial activity, which was set at 100%.
The optimal pH was determined by measuring xylanase activity at pH levels ranging from 3 to 10 at 50 °C. The pH stability of the isolated xylanase was examined by incubating the culture filtrate in various buffer solutions at 0.1 M: Na citrate buffer (pH 3.0–6.0), phosphate buffer (pH 6.5–7.5), Tris-HCl (pH 8.0–8.5), and sodium carbonate buffer (pH 9.0–10.0).
After 1 h of incubation at 4 °C, 0.2 mL of the culture filtrate was used for residual xylanase activity measurement. The reaction mixture (1.8 mL of substrate solution and 0.2 mL of culture filtrate) was incubated under standard conditions (50 °C and pH 6) for 15 min, using xylan as the substrate [22,57].

3.9. Effect of Incubation Time and Substrate Concentration on Xylanase Activity

The effect of incubation time on xylanase activity was studied by measuring enzyme activity under standard conditions (50 °C, pH 6) for various incubation times (5–25 min). Xylan was used as a substrate.
The optimal substrate concentration was determined by measuring xylanase activity under optimal conditions (50 °C, pH 6, and 15 min) using various xylan concentrations (0–20 mg mL−1).

3.10. Effect of Metal Ions, Enzyme Inhibitors, and Surfactants on Mangrovibacter plantisponsor Xylanase

The effects of metal ions, inhibitors, and surfactants on the crude xylanase activity were investigated. The enzyme was incubated with 5–12.5 mM of various metal ions (NaCl2, CaCl2, NiCl2, KCl, MnCl2, MgSO4, FeSO4, and HgCl2) for 60 min. The residual activity was measured under standard conditions.
The enzyme was incubated with 0.1% of inhibitors (ethylenediaminetetraacetic acid (EDTA), dithiothreitol (DTT), β-mercaptoethanol (BME), sodium dodecyl sulfate (SDS), H2O2, sodium azide, and polyethylene glycol) and surfactants (Tween 20 and Tween 80) at room temperature for 1 h. The xylanase activity without the addition of metal ions, inhibitors, or surfactants was defined as 100%, and the relative activity was determined by comparison with the control. The experiments were performed as described above, using xylan as the substrate [42].

3.11. Effect of Organic Solvents on Mangrovibacter plantisponsor Xylanase

The effect of various organic solvents (ethanol, isopropanol, acetone, and chloroform) on xylanase activity was also investigated. The crude enzyme was incubated in 0.1% of the organic solvents for 1 h at 37 °C. Residual activity was measured under standard conditions using xylan as the substrate. The xylanase activity without any organic solvent was considered as 100% [38].

3.12. Effects of the Addition of M. plantisponsor Xylanase in Breadmaking

Two types of flour were examined in this study: white flour and whole-wheat flour. The initial dough was prepared according to a previously described method [45]. White flour/whole-wheat flour (250 g) was mixed with dry yeast (1.5 g), salt (2 g), sugar (3 g), vegetable oil (30 mL), water, and the crude enzyme (0, 25, 50, 75, 100, and 125 units). The ingredients were mixed for 10 min. The final dough was placed at 50 °C for 45 min and then baked at 200 °C for 45 min. The resulting loaves were cooled for 2 h at room temperature and then sliced. Loaf volume and mass measurements were taken 2 h after the baking step. The bread volume was determined using the seed displacement method [58], and the specific volume (mL/g) was defined as the ratio of bread volume (mL) to mass (g).

3.13. Statistical Analysis

STATISTICA 12 (Copyright © StatSoft, Inc., Tulsa, OK, USA, 1984–2014) was used to design the experiments, determine the model coefficients, conduct the statistical analyses (including ANOVA, Student’s t-tests, statistical coefficients, and significance tests), generate the graphs, and complete the optimization.
The model coefficients were estimated using the least-squares method. ANOVA and Student’s t-tests were performed to evaluate the significance of the model, the tested factors, and their interactions at a 95% confidence level (p < 0.05). The model’s fitting quality was evaluated using the following statistical coefficients: the coefficient of determination (R2) and the root mean square error (RMSE).

4. Conclusions

In this study, thermostable xylanase derived from a novel strain of Mangrovibacter plantisponsor was employed in breadmaking and demonstrated effectiveness in enhancing several bread characteristics. All enzymatic treatments resulted in a significant increase in reducing sugars within the dough, thereby promoting fermentation and improving gas retention. Additionally, a notable increase in bread volume and a decrease in density were observed. Furthermore, bread firmness was significantly reduced compared to the control, resulting in a softer texture.

Author Contributions

W.A.A.: Conceptualization and supervision. E.M.A.: Data curation, formal analysis, investigation, methodology, and writing—original draft. B.H.: Investigation, methodology, and writing—review and editing. A.F.K., F.S.A. and Y.Q.A.: Writing—review and editing. A.S.: Conceptualization, writing—review and editing, supervision, and project administration. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the University of Jeddah grant number UJ-24-FR-2817-1.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

This research did not involve human participants or animal experiments.

Data Availability Statement

All the relevant data are provided in the manuscript.

Acknowledgments

This work was funded by the University of Jeddah, Jeddah, Saudi Arabia, under grant No. UJ-24-FR-2817-1. Therefore, the authors thank the University of Jeddah for its technical and financial support.

Conflicts of Interest

This research received no external funding.

References

  1. Ammar, I.; Sebii, H.; Aloui, T.; Attia, H.; Hadrich, B.; Felfoul, I. Optimization of a Novel, Gluten-Free Bread’s Formulation Based on Chickpea, Carob and Rice Flours Using Response Surface Design. Heliyon 2022, 8, e12164. [Google Scholar] [CrossRef]
  2. Dahiya, S.; Rapoport, A.; Singh, B. Biotechnological Potential of Lignocellulosic Biomass as Substrates for Fungal Xylanases and Its Bioconversion into Useful Products: A Review. Fermentation 2024, 10, 82. [Google Scholar] [CrossRef]
  3. Kostyuchenko, M.; Martirosyan, V.; Nosova, M.; Dremucheva, G.; Nevskaya, E.; Savkina, O. Effects of α-Amylase, Endo-Xylanase and Exoprotease Combination on Dough Properties and Bread Quality. Agron. Res. 2021, 19. [Google Scholar] [CrossRef]
  4. Kumar, R.; Verma, D.; Sharma, S.; Satyanarayana, T. Applicability of Fungal Xylanases in Food Biotechnology. In Fungi and Fungal Products in Human Welfare and Biotechnology; Satyanarayana, T., Deshmukh, S.K., Eds.; Springer: Singapore, 2023. [Google Scholar]
  5. Lensky, N.; Saidov, A.; Kalitka, D.; Eseeva, G.; Balguzhinova, Z. Study of Industrial Enzyme Improvers of the Rheological Properties of Baking Flour and the Quality of Finished Products. BIO Web Conf. 2024, 82, 02018. [Google Scholar] [CrossRef]
  6. Liu, W.; Brennan, M.; Tu, D.; Brennan, C. Influence of α-Amylase, Xylanase and Cellulase on the Rheological Properties of Bread Dough Enriched with Oat Bran. Sci. Rep. 2023, 13, 4543. [Google Scholar] [CrossRef]
  7. Mabrouk, S.B.; Hmida, B.B.H.; Sebii, H.; Fendri, A.; Sayari, A. Production of an Amylase from Newly Bacillus Strain: Optimization by Response-Surface Methodology, Characterization and Application with a Fungal Lipase in Bread Making. Int. J. Biol. Macromol. 2024, 285, 138147. [Google Scholar] [CrossRef]
  8. Salem, K.; Elgharbi, F.; Ben Hlima, H.; Alghamdi, O.A.; Perduca, M.; Sayari, A.; Hmida-Sayari, A. His-Tag Effect on Biochemical Properties of B. subtilis US572 α-Amylase Produced in E. coli: Application of the Recombinant Enzyme in Breadmaking. Food Biotechnol. 2024, 38, 134–158. [Google Scholar] [CrossRef]
  9. Dhevagi, P.; Ramya, A.; Priyatharshini, S.; Geetha Thanuja, K.; Ambreetha, S.; Nivetha, A. Industrially Important Fungal Enzymes: Productions and Applications. In Recent Trends in Mycological Research. Fungal Biology; Yadav, A.N., Ed.; Springer: Cham, Switzerland, 2021; pp. 263–309. [Google Scholar]
  10. Chauhan, J.; Bishoyi, A.; Gohel, R.; Sanghvi, G. Purification and Characterization of Acidophilic Xylanase from Bacillus sp. with Potential Application as Fruit Juice Clarifier. Emir. J. Food Agric. 2023, 35, 620–630. [Google Scholar] [CrossRef]
  11. Tran, P.L.; Park, E.-J.; Hong, J.-S.; Lee, C.-K.; Kang, T.; Park, J.-T. Mechanism of Action of Three Different Glycogen Branching Enzymes and Their Effect on Bread Quality. Int. J. Biol. Macromol. 2024, 256, 128471. [Google Scholar] [CrossRef]
  12. Xue, Y.; Cui, X.; Zhang, Z.-H.; Zhou, T.; Gao, R.; Li, Y.; Ding, X. Effect of β-Endoxylanase and α-Arabinofuranosidase Enzymatic Hydrolysis on Nutritional and Technological Properties of Wheat Brans. Food Chem. 2020, 302, 125332. [Google Scholar] [CrossRef] [PubMed]
  13. Goupy, J. Introduction Aux Plans d’Expériences, 5th ed.; Dunod: Paris, France, 2013; ISBN 978-21-0059-296-8. [Google Scholar]
  14. Montgomery, D.C. Design and Analysis of Experiments; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2017; ISBN 9781119113478. [Google Scholar]
  15. Abdelaliem, Y.F.; Mahmoud, M.H.; Elkassem, N.A.; Mansour, S.M.; Ramadan, M.F. Utilization of Agro-Industrial Biowastes to Produce Xylanase Using Aspergillus Niger AUMC 14230: Optimization of Production Parameters. Rend. Lincei Sci. Fis. Nat. 2023, 34, 941–951. [Google Scholar] [CrossRef]
  16. Abou-Dobara, M.I.; El-Sayed, A.K.; Elfayoumy, R.A. Optimization and Physiochemical Properties of Xylanase from Bacillus coagulans and Bacillus licheniformis. J. Am. Sci. 2011, 7, 661–670. [Google Scholar]
  17. Zhou, H.; Cai, Y.; Long, M.; Zheng, N.; Zhang, Z.; You, C.; Hussain, A.; Xia, X. Computer-Aided Reconstruction and Application of Bacillus halodurans S7 Xylanase with Heat and Alkali Resistance. J. Agric. Food Chem. 2024, 72, 1213–1227. [Google Scholar] [CrossRef]
  18. Della Torre, C.L.; Silva-Lucca, R.A.; Ferreira, R.d.S.; Andrade Luz, L.; Oliva, M.L.V.; Kadowaki, M.K. Correlation of the Conformational Structure and Catalytic Activity of the Highly Thermostable Xylanase of Thermomyces lanuginosus PC7S1T. Biocatal. Biotransform. 2021, 41, 81–92. [Google Scholar] [CrossRef]
  19. Malhotra, G.; Chapadgaonkar, S.S. Taguchi Optimization and Scale up of Xylanase from Bacillus licheniformis Isolated from Hot Water Geyser. J. Genet. Eng. Biotechnol. 2020, 18, 65. [Google Scholar] [CrossRef]
  20. Joshi, N.; Sharma, M.; Singh, S.P. Characterization of a Novel Xylanase from an Extreme Temperature Hot Spring Metagenome for Xylooligosaccharide Production. Appl. Microbiol. Biotechnol. 2020, 104, 4889–4901. [Google Scholar] [CrossRef] [PubMed]
  21. Ravichandra, K.; Balaji, R.; Devarapalli, K.; Batchu, U.R.; Thadikamala, S.; Banoth, L.; Pinnamaneni, S.R.; Prakasham, R.S. Enzymatic Production of Prebiotic Xylo oligosaccharides from Sorghum (Sorghum bicolor (L.) Xylan: Value Addition to Sorghum Bagasse. Biomass Convers. Biorefinery 2022, 13, 11131–11139. [Google Scholar] [CrossRef]
  22. Zhang, G.; Li, Z.; Chen, G.; Zhang, L.; Cai, W.; Deng, S.; Zhang, H.; Wu, L.; Li, H.; Liu, H. Purification and Characterization of the Low Molecular Weight Xylanase from Bacillus cereus L-1. Braz. J. Microbiol. 2023, 54, 2951–2959. [Google Scholar] [CrossRef]
  23. Joshi, J.B.; Priyadharshini, R.; Uthandi, S. Glycosyl Hydrolase 11 (XynA) Gene with Xylanase Activity from Thermophilic Bacteria Isolated from Thermal Springs. Microb. Cell Factories 2022, 21, 62. [Google Scholar] [CrossRef] [PubMed]
  24. Chauhan, J.; Shukla, R.; Bishoyi, A.K.; Goyal, S.; Sanghvi, G. Investigation of Physical, Nutritional and Sensory Properties of Wheat Bread Treated with Purified Thermostable Cellulase and Alpha Amylase. Cogent Food Agric. 2023, 9, 2261839. [Google Scholar] [CrossRef]
  25. El-Gendi, H.; Badawy, A.S.; Bakhiet, E.K.; Rawway, M.; Ali, S.G. Valorization of Lignocellulosic Wastes for Sustainable Xylanase Production from Locally Isolated Bacillus Subtilis Exploited for Xylooligosaccharides’ Production with Potential Antimicrobial Activity. Arch. Microbiol. 2023, 205, 315. [Google Scholar] [CrossRef]
  26. Gupta, P.K.; Choudhary, S.; Chandrananthi, C.; Eveline, J.S.; Sushmitha, S.P.; Hiremath, L.; Srivastava, A.K.; Kumar, S.N. Fungal Biodiversity Producing Xylanase Enzymes Involved in Efficient Uses of Xylanolysis. In Mycodegradation of Lignocelluloses. Fungal Biology; Naraian, R., Ed.; Springer: Cham, Switzerland, 2019; pp. 51–63. [Google Scholar]
  27. Ameen, F. Purification and Characterization of Xylanase Produced by Aspergillus Fumigatus Isolated from the Northern Border Region of Saudi Arabia. Fermentation 2023, 9, 595. [Google Scholar] [CrossRef]
  28. Khandeparker, R.; Verma, P.; Deobagkar, D. A Novel Halotolerant Xylanase from Marine Isolate Bacillus subtilis Cho40: Gene Cloning and Sequencing. New Biotechnol. 2011, 28, 814–821. [Google Scholar] [CrossRef]
  29. Singh, A.; Sharma, D.; Varghese, L.M.; Mahajan, R. Fast Flow Rate Processes for Purification of Alkaline Xylanase Isoforms from Bacillus pumilus AJK and Their Biochemical Characterization for Industrial Application Purposes. Biotechnol. Prog. 2019, 36, e2898. [Google Scholar] [CrossRef]
  30. Ulucay, O.; Gormez, A.; Ozic, C. For Biotechnological Applications: Purification and Characterization of Recombinant and Nanoconjugated Xylanase Enzyme from Thermophilic Bacillus subtilis. Biocatal. Agric. Biotechnol. 2022, 44, 102478. [Google Scholar] [CrossRef]
  31. Paul, M.; Nayak, D.P.; Thatoi, H. Optimization of Xylanase from Pseudomonas mohnii Isolated from Simlipal Biosphere Reserve, Odisha, Using Response Surface Methodology. J. Genet. Eng. Biotechnol. 2020, 18, 81. [Google Scholar] [CrossRef] [PubMed]
  32. Devi, S.; Dwivedi, D.; Bhatt, A.K. Utilization of Agroresidues for the Production of Xylanase by Bacillus safensis XPS7 and Optimization of Production Parameters. Fermentation 2022, 8, 221. [Google Scholar] [CrossRef]
  33. Iram, A.; Cekmecelioglu, D.; Demirci, A. The Effect of Dilution, Aeration, and Agitation on Fungal Cellulase and Xylanase Production by DDGS-Based Fermentation Media in Stirred Tank Bioreactors. In Proceedings of the ASABE Annual International Meeting 2022, Houston, TX, USA, 17–20 July 2022. [Google Scholar] [CrossRef]
  34. Köstekci, S.; Aygan, A.; Comlekcioglu, N.; Sarıtürk, S. Alkaline Cellulase Free Xylanase from Bacillus sp. ASX42: Properties, Purification and Its Effect on Seed Germination. J. Microbiol. Biotechnol. Food Sci. 2022, 12, e4431. [Google Scholar] [CrossRef]
  35. Das, A.; Ray, L. Production of Crude Xylanase Using a Isolated Fungal Strain Aspergillus sp. S6by Solid State Fermentation. Mater. Today Proc. 2016, 3, 3343–3360. [Google Scholar] [CrossRef]
  36. Silva, L.A.O.; Terrasan, C.R.F.; Carmona, E.C. Purification and Characterization of Xylanases from Trichoderma inhamatum. Electron. J. Biotechnol. 2015, 18, 307–313. [Google Scholar] [CrossRef]
  37. Abdella, A.; Ramadan, S.; Hamouda, R.A.; Saddiq, A.A.; Alhazmi, N.M.; Al-Saman, M.A. Paecilomyces variotii Xylanase Production, Purification and Characterization with Antioxidant Xylo-Oligosaccharides Production. Sci. Rep. 2021, 11, 16468. [Google Scholar] [CrossRef]
  38. Tiwari, S.; Singh, R.; Yadav, J.; Gaur, R.; Singh, A.; Yadav, J.S.; Pandey, P.K.; Yadav, S.K.; Prajapati, J.; Helena, P.; et al. Three-Step Purification and Characterization of Organic Solvent-Tolerant and Alkali-Thermo-Tolerant Xylanase from Bacillus paramycoides T4 [MN370035]. Catalysts 2022, 12, 749. [Google Scholar] [CrossRef]
  39. Lv, Z.; Yang, J.; Yuan, H. Production, Purification and Characterization of an Alkaliphilic Endo-β-1,4-Xylanase from a Microbial Community EMSD5. Enzym. Microb. Technol. 2008, 43, 343–348. [Google Scholar] [CrossRef]
  40. Zafar, A.; Aftab, M.N.; Din, Z.U.; Aftab, S.; Iqbal, I.; Shahid, A.; Tahir, A.; Haq, I.U. Cloning, Expression, and Purification of Xylanase Gene from Bacillus licheniformis for Use in Saccharification of Plant Biomass. Appl. Biochem. Biotechnol. 2015, 178, 294–311. [Google Scholar] [CrossRef]
  41. Hamid, A.; Aftab, M.N. Cloning, Purification, and Characterization of Recombinant Thermostable β-Xylanase Tnap_0700 from Thermotoga naphthophila. Appl. Biochem. Biotechnol. 2019, 189, 1274–1290. [Google Scholar] [CrossRef]
  42. Suhag, A.; Kumar, V.; Singh, B. Biochemical Characteristics of a Novel Ethanol-Tolerant Xylanase from Bacillus subtilis subsp. Subtilis JJBS250 and Its Applicability in Saccharification of Rice Straw. Biomass Convers. Biorefinery 2021, 13, 1937–1949. [Google Scholar] [CrossRef]
  43. Kallel, F.; Driss, D.; Bouaziz, F.; Neifer, M.; Ghorbel, R.; Ellouz Chaabouni, S. Production of Xylooligosaccharides from Garlic Straw Xylan by Purified Xylanase from Bacillus mojavensis UEB-FK and Their in Vitro Evaluation as Prebiotics. Food Bioprod. Process. 2015, 94, 536–546. [Google Scholar] [CrossRef]
  44. Rajabi, M.; Nourisanami, F.; Ghadikolaei, K.K.; Changizian, M.; Noghabi, K.A.; Zahiri, H.S. Metagenomic Psychrohalophilic Xylanase from Camel Rumen Investigated for Bioethanol Production from Wheat Bran Using Bacillus subtilis AP. Sci. Rep. 2022, 12, 8152. [Google Scholar] [CrossRef]
  45. Zhang, Y.; Liu, C.; Yang, M.; Ou, Z.; Lin, Y.; Zhao, F.; Han, S. Characterization and Application of a Novel Xylanase from Halolactibacillus miurensis in Wholewheat Bread Making. Front. Bioeng. Biotechnol. 2022, 10, 1018476. [Google Scholar] [CrossRef]
  46. Ratnadewi, A.A.I.; Santoso, A.B.; Naqib, M. Isolation and Some Properties of Xylanase from Soil-Termite Guts and Influence of Enzymes in Baking. 2024. Available online: http://repository.unej.ac.id/handle/123456789/56810 (accessed on 10 April 2014).
  47. Iqbal, S.; Arif, S.; Khurshid, S.; Iqbal, H.M.; Akbar, Q.; Ali, T.M.; Mohiuddin, S. A Combined Use of Different Functional Additives for Improvement of Wheat Flour Quality for Bread Making. J. Sci. Food Agric. 2023, 103, 3261–3271. [Google Scholar] [CrossRef]
  48. Yang, M.; Yue, Y.; Liu, L.; Tong, L.; Wang, L.; Ashraf, J.; Li, N.; Zhou, X.; Zhou, S. Investigation of Combined Effects of Xylanase and Glucose Oxidase in Whole Wheat Buns Making Based on Reconstituted Model Dough System. LWT 2020, 135, 110261. [Google Scholar] [CrossRef]
  49. Mohammadi, M.; Zoghi, A.; Azizi, M.H. Effect of Xylanase and Pentosanase Enzymes on Dough Rheological Properties and Quality of Baguette Bread. J. Food Qual. 2022, 2022, 2910821. [Google Scholar] [CrossRef]
  50. Gahfif, O.; Yasmina Souagui, Y.; Azzouz, Z.; Nouari, S.; Amghar, Z.; Boucherba, N.; Kecha, M.; Benallaoua, S.; Bettache, A. Isolation and Screening of Fungal Culture Isolated from Algerian Soil for the Production of Cellulase and Xylanase. J. Drug Deliv. Ther. 2020, 10, 108–113. [Google Scholar] [CrossRef]
  51. Morán-Aguilar, M.G.; Calderón-Santoyo, M.; Domínguez, J.M.; Aguilar-Uscanga, M.G. Optimization of Cellulase and Xylanase Production by Aspergillus niger CECT 2700 Using Brewery Spent Grain Based on Taguchi Design. Biomass Convers. Biorefinery 2021, 13, 7983–7991. [Google Scholar] [CrossRef]
  52. Buonaurio, R.; Stravato, V.M.; Cappelli, C. Brown Spot Caused by Sphingomonas sp. On Yellow Spanish Melon Fruits in Spain*. Plant Pathol. 2001, 50, 397–401. [Google Scholar] [CrossRef]
  53. Okonechnikov, K.; Golosova, O.; Fursov, M. Unipro UGENE: A Unified Bioinformatics Toolkit. Bioinformatics 2012, 28, 1166–1167. [Google Scholar] [CrossRef]
  54. Bailey, M.J.; Biely, P.; Poutanen, K. Interlaboratory Testing of Methods for Assay of Xylanase Activity. J. Biotechnol. 1992, 23, 257–270. [Google Scholar] [CrossRef]
  55. Božinović, M.; Sokač, T.; Šalić, A.; Dukarić, A.-M.; Tišma, M.; Planinić, M.; Zelić, B. Standardization of 3,5-Dinitrosalicylic Acid (DNS) Assay for Measuring Xylanase Activity. Croat. J. Food Sci. Technol. 2023, 15, 151–162. [Google Scholar] [CrossRef]
  56. Hadrich, B. Design of Experiments Applications Review: Food Processing Engineering as an Example Field. Contemp. Math. 2025, 6, 3686–3704. [Google Scholar] [CrossRef]
  57. Gautério, G.V.; da Silva, L.G.G.; Hübner, T.; Ribeiro, T.d.R.; Kalil, S.J. Xylooligosaccharides Production by Crude and Partially Purified Xylanase from Aureobasidium pullulans: Biochemical and Thermodynamic Properties of the Enzymes and Their Application in Xylan Hydrolysis. Process Biochem. 2021, 104, 161–170. [Google Scholar] [CrossRef]
  58. American Association of Cereal Chemists (Ed.) AACC Approved Method of the AACC, 10th ed.; American Association of Cereal Chemists: St. Paul, MN, USA, 2000. [Google Scholar]
Catalysts 15 00792 g001
Figure 1. Phylogenetic tree of Mangrovibacter plantisponsor UMTKB-3 (▲) (GenBank Access Number PV759790).
Figure 1. Phylogenetic tree of Mangrovibacter plantisponsor UMTKB-3 (▲) (GenBank Access Number PV759790).
Catalysts 15 00792 g001
Catalysts 15 00792 g002
Figure 2. Three-dimensional graphs depicting the dependence of the obtained xylanase activity on various factor combinations while keeping the other factors fixed at their central levels: (A) tryptone and yeast extract concentrations, (B) tryptone and NaCl concentrations, (C) tryptone concentration and initial OD, (D) yeast extract and NaCl concentrations, (E) yeast extract concentration and initial OD, and (F) NaCl concentration and initial OD. Blue points represent the tested experimental values.
Figure 2. Three-dimensional graphs depicting the dependence of the obtained xylanase activity on various factor combinations while keeping the other factors fixed at their central levels: (A) tryptone and yeast extract concentrations, (B) tryptone and NaCl concentrations, (C) tryptone concentration and initial OD, (D) yeast extract and NaCl concentrations, (E) yeast extract concentration and initial OD, and (F) NaCl concentration and initial OD. Blue points represent the tested experimental values.
Catalysts 15 00792 g002
Catalysts 15 00792 g003
Figure 3. Profiles for predicted values and desirability. Green curves: xylanase activity evolution as function of each factor. Vertical green lines: error bars (−95% to +95%). Red lines: level of the factor that gives the optimum xylanase activity. Dash blue lines: predicted optimum value of xylanase activity and its desirability. Continuous blue lines: range of xylanase activity.
Figure 3. Profiles for predicted values and desirability. Green curves: xylanase activity evolution as function of each factor. Vertical green lines: error bars (−95% to +95%). Red lines: level of the factor that gives the optimum xylanase activity. Dash blue lines: predicted optimum value of xylanase activity and its desirability. Continuous blue lines: range of xylanase activity.
Catalysts 15 00792 g003
Catalysts 15 00792 g004
Figure 4. (A): Effect of temperature on xylanase activity and stability. (B): Effect of pH on xylanase activity and stability.
Figure 4. (A): Effect of temperature on xylanase activity and stability. (B): Effect of pH on xylanase activity and stability.
Catalysts 15 00792 g004
Catalysts 15 00792 g005
Figure 5. Effect of adding different amounts of xylanase on bread volume. (A): White bread volume. (B): Whole-wheat bread volume.
Figure 5. Effect of adding different amounts of xylanase on bread volume. (A): White bread volume. (B): Whole-wheat bread volume.
Catalysts 15 00792 g005
Catalysts 15 00792 g006
Figure 6. Effect of adding different amounts of xylanase on bread mass. (A): White bread mass. (B): Whole-wheat bread mass.
Figure 6. Effect of adding different amounts of xylanase on bread mass. (A): White bread mass. (B): Whole-wheat bread mass.
Catalysts 15 00792 g006
Catalysts 15 00792 g007
Figure 7. (1) Apparent porosity of bread prepared with 100 g of white wheat flour. (A) Addition of 100 units of xylanase. (B) Addition of 125 units of xylanase. (2) Apparent porosity of bread prepared with 100 g of whole-wheat flour. (A) Addition of 25.0 units of xylanase. (B) Addition of 50.0 units of xylanase.
Figure 7. (1) Apparent porosity of bread prepared with 100 g of white wheat flour. (A) Addition of 100 units of xylanase. (B) Addition of 125 units of xylanase. (2) Apparent porosity of bread prepared with 100 g of whole-wheat flour. (A) Addition of 25.0 units of xylanase. (B) Addition of 50.0 units of xylanase.
Catalysts 15 00792 g007
Table 1. Experimental conditions based on the Box–Behnken design and their corresponding enzymatic production response.
Table 1. Experimental conditions based on the Box–Behnken design and their corresponding enzymatic production response.
RunTryptone in g/L (Coded Level)Yeast Extract in g/L (Coded Level)NaCl in g/L (Coded Level)Initial OD (Coded Level)Xylanase Activity in U/mL
18 (−1)5 (−1)10 (0)0.15 (0)15.055 ± 0.155
216 (+1)5 (−1)10 (0)0.15 (0)15.198 ± 0.350
38 (−1)15 (+1)10 (0)012.467 ± 0.320
416 (+1)15 (+1)10 (0)0.15 (0)14.085 ± 0.755
512 (0)10 (0)5 (−1)0.10 (−1)12.674 ± 0.327
612 (0)10 (0)15 (+1)0.10 (−1)13.710 ± 0.261
712 (0)10 (0)5 (−1)0.20 (+1)16.413 ± 0.474
812 (0)10 (0)15 (+1)0.20 (+1)18.225 ± 0.208
98 (−1)10 (0)10 (0)0.10 (−1)17.854 ± 0.288
1016 (+1)10 (0)10 (0)0.10 (−1)16.051 ± 0.254
118 (−1)10 (0)10 (0)0.20 (+1)16.011 ± 0.227
1216 (+1)10 (0)10 (0)0.20 (+1)18.683 ± 0.474
1312 (0)5 (−1)5 (−1)0.15 (0)15.197 ± 0.281
1412 (0)15 (+1)5 (−1)0.15 (0)15.359 ± 0.242
1512 (0)5 (−1)15 (+1)0.15 (0)11.855 ± 0.326
1612 (0)15 (+1)15 (+1)0.15 (0)13.858 ± 0.372
178 (−1)10 (0)5 (−1)0.15 (0)12.289 ± 0.215
1816 (+1)10 (0)5 (−1)0.15 (0)12.209 ± 0.338
198 (−1)10 (0)15 (+1)0.15 (0)12.120 ± 0.283
2016 (+1)10 (0)15 (+1)0.15 (0)16.676 ± 0.583
2112 (0)5 (−1)10 (0)0.10 (−1)11.381 ± 0.369
2212 (0)15 (+1)10 (0)0.10 (−1)10.840 ± 0.408
2312 (0)5 (−1)10 (0)0.20 (+1)11.390 ± 0.329
2412 (0)15 (+1)10 (0)0.20 (+1)12.940 ± 0.456
2512 (0)10 (0)10 (0)0.15 (0)8.221 ± 0.171
Table 2. Statistical Student’s t-test on the influence of four factors and their interactions on Mangrovibacter plantisponsor production (p < 0.05).
Table 2. Statistical Student’s t-test on the influence of four factors and their interactions on Mangrovibacter plantisponsor production (p < 0.05).
FactorCoeff.Std. Err.t(12)p
Mean/Interc.16.2900.79520.487<0.001
(1) Tryptone (g/L) (L)0.5920.6890.8600.407
Tryptone (g/L) (Q)−1.9770.516−3.8280.002
(2) Yeast extract (g/L) (L)−0.0440.689−0.0640.950
Yeast extract (g/L) (Q)−0.7850.516−1.5200.154
(3) NaCl (g/L) (L)0.1920.6890.2790.785
NaCl (g/L) (Q)−1.4700.516−2.8470.015
(4) Initial OD (L)0.9290.6891.3500.202
Initial OD (Q)−1.8190.516−3.5230.004
1 L by 2 L0.3691.1930.3090.763
1 L by 3 L1.1591.1930.9720.350
1 L by 4 L1.1191.1930.9380.367
2 L by 3 L0.4601.1930.3860.706
2 L by 4 L0.5231.1930.4380.670
3 L by 4 L0.1941.1930.1630.874
Coeff.: coefficient; Std. Err.: standard error; t(12): Student factor for degree of freedom equals 12 (Coeff./Std. Err.); p: probability value.
Table 3. Effect of different concentrations of metal ions on Mangrovibacter plantisponsor xylanase activity.
Table 3. Effect of different concentrations of metal ions on Mangrovibacter plantisponsor xylanase activity.
Metal IonsConcentrations (mM)Relative Activity (%)
Control0.0100.0 ± 1.3
NaCl25.055.1 ± 0.12
7.530.2 ± 1.01
10.024.5 ± 1.00
12.511.1 ± 0.09
CaCl25.073.5 ± 0.01
7.555.2 ± 1.02
10.038.1 ± 0.04
12.527.0 ±1.01
NiCl25.097.1 ± 1.07
7.572.9 ± 1.12
10.044.0 ± 0.02
12.531.1 ± 0.07
KCl5.064.0 ± 1.02
7.540.5 ± 0.02
10.022.0 ± 2.03
12.59.50 ± 1.10
MnCl25.0190 ± 0.07
7.5223 ± 0.02
10.0227 ± 0.08
12.5182 ± 0.01
MgSO45.056.0 ± 0.20
7.533.2 ± 0.03
10.025.5 ± 0.09
12.59.01 ± 0.01
FeSO45.081.2 ± 0.12
7.566.7 ± 0.09
10.040.3 ± 0.01
12.531.4 ± 0.22
HgCl25.016.0 ± 1.10
7.59.40 ± 0.05
10.02.23 ± 0.20
12.50.60 ± 0.11
Table 4. Effect of various inhibitors, surfactants, and organic solvents on Mangrovibacter plantisponsor xylanase activity.
Table 4. Effect of various inhibitors, surfactants, and organic solvents on Mangrovibacter plantisponsor xylanase activity.
Relative activity (%)
Control100.0 ± 1.2
Inhibitors
EDTA16.4 ± 0.2
DTT23.5 ± 1.0
BME15.1 ± 0.7
SDS17.2 ± 1.1
H2O253.5 ± 0.4
Sodium azide32.1 ± 0.2
Polyethene glycol41.0 ± 0.5
Surfactants
Tween-2019.0 ± 0.2
Tween-8015.2 ± 1.4
Organic solvents
Isopropanol45.8 ± 4.3
Ethanol60.2 ± 2.3
Acetone43.7 ± 1.9
Chloroform46.5 ± 2.6
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Alshehri, W.A.; Alharbi, E.M.; Hadrich, B.; Khalel, A.F.; Alqahtani, F.S.; Almulaiky, Y.Q.; Sayari, A. Enhancing the Production of Thermostable Mangrovibacter plantisponsor Xylanase for Application in Breadmaking. Catalysts 2025, 15, 792. https://doi.org/10.3390/catal15080792

AMA Style

Alshehri WA, Alharbi EM, Hadrich B, Khalel AF, Alqahtani FS, Almulaiky YQ, Sayari A. Enhancing the Production of Thermostable Mangrovibacter plantisponsor Xylanase for Application in Breadmaking. Catalysts. 2025; 15(8):792. https://doi.org/10.3390/catal15080792

Chicago/Turabian Style

Alshehri, Wafa A., Ebtihal M. Alharbi, Bilel Hadrich, Ashjan F. Khalel, Fatimah S. Alqahtani, Yaaser Q. Almulaiky, and Adel Sayari. 2025. "Enhancing the Production of Thermostable Mangrovibacter plantisponsor Xylanase for Application in Breadmaking" Catalysts 15, no. 8: 792. https://doi.org/10.3390/catal15080792

APA Style

Alshehri, W. A., Alharbi, E. M., Hadrich, B., Khalel, A. F., Alqahtani, F. S., Almulaiky, Y. Q., & Sayari, A. (2025). Enhancing the Production of Thermostable Mangrovibacter plantisponsor Xylanase for Application in Breadmaking. Catalysts, 15(8), 792. https://doi.org/10.3390/catal15080792

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Article metric data becomes available approximately 24 hours after publication online.
Back to TopTop