Next Article in Journal
Metabolic Biodegradation Pathway of Fluoranthene by Indigenous Trichoderma lixii and Talaromyces pinophilus spp.
Previous Article in Journal
g-C3N4 for Photocatalytic Degradation of Parabens: Precursors Influence, the Radiation Source and Simultaneous Ozonation Evaluation
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Catalysts
Volume 13
Issue 5
10.3390/catal13050790
catalysts-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

SOEing PCR/Docking Optimization of Protein A-G/scFv-Fc-Bioconjugated Au Nanoparticles for Interaction with Meningitidis Bacterial Antigen

by
Maryam Rad
1,
Gholamhossein Ebrahimipour
1,
Mojgan Bandehpour
2,3,*,
Omid Akhavan
4,* and
Fatemeh Yarian
5
1
Department of Microbiology and Microbial Biotechnology, Faculty of Life Sciences and Biotechnology, Shahid Beheshti University, Tehran 1983969411, Iran
2
Cellular and Molecular Biology Research Center, Shahid Beheshti University of Medical Sciences, Tehran 1481997791, Iran
3
Department of Medical Biotechnology, School of Advanced Technologies of Medicine, Shahid Beheshti University of Medical Sciences, Tehran 9168917313, Iran
4
Department of Physics, Sharif University of Technology, Tehran 11155-9161, Iran
5
Department of Medical Biotechnology, School of Advanced Technologies in Medicine, Fasa University of Medical Sciences, Fasa 74616-86688, Iran
*
Authors to whom correspondence should be addressed.
Catalysts 2023, 13(5), 790; https://doi.org/10.3390/catal13050790
Submission received: 1 January 2023 / Accepted: 21 April 2023 / Published: 23 April 2023
(This article belongs to the Section Biocatalysis)
Browse Figures
Versions Notes

Abstract

Recent advances in the use of gold nanoparticles (Au NPs)/antibody conjugations in nanomedicine have increased the need to optimize the synthesis conditions and surface functionalization of Au NPs. In this study, a home-made Neisseria meningitidis recombinant antibody (scFv-Fc) was developed by connecting the fragment crystallizable (Fc) region of a human antibody with a mouse recombinant antibody (single-chain variable fragment antibody (scFv)) and characterized using the SOEing PCR technique. Then, an optimized gold coating agent for the scFv-Fc/Au NP conjugation (i.e., the citrate agent) was found among three common agents (citrate, allylamine hydrochloride, and polyvinyl alcohol) with different surface charges (negative, positive, and neutral, respectively). Moreover, the stability of the scFv-Fc/protein A-G in the presence of a N-succinimidyl 3-(2-pyridyldithio) propionate (SPDP) linker was investigated using the docking method. It was found that the designed scFv-Fc/protein A-G/SPDP/citrate recombinant antibody showed optimized bottom-on conjugation of the protein A-G with the improved scFv-Fc/Au NPs, enabling a suitable interaction with the Neisseria meningitidis bacterial antigen.

Graphical Abstract

1. Introduction

The connection of biological molecules, such as antibodies, to nanoparticles, which is the reason for the adequate performance of these particles in the clinical field, is called bioconjugation. This bond can be established using biological or chemical tools [1]. The new complex formed via this mechanism has the characteristics of a mixture of individual components [2]. Some examples of this include: recent advances in rapid diagnostic tests that have played a role in the success of conjugated gold nanoparticles, and the surface chemistry and nanoparticle–protein combination that have determined this achievement [3]. In this regard, this biological component and its composition on the surface of gold nanoparticles are essential in the development of biomedical diagnostic methods [1]. This biological component with its diagnostic role, along with a transducer and a display, are the three essential components of rapid biological diagnostic tests. After recognizing the target with the biological molecule, a detectable signal transducer is created and the result is displayed [4]. Preservation of the original protein composition, and the maintenance of protein function after immobilization on a surface with proper orientation and stability, in diverse biological environments, using efficient binding chemistry, shows the importance of protein–nanoparticle conjugates in increasing and controlling the efficiency of the resulting conjugate [5,6] Predicting the proper orientation of two molecules in relation to each other and creating a stable complex using mathematical techniques is the definition of docking. In this method, the binding affinity of two molecules is estimated using scoring functions based on their preferred directions. Predicting the strength and type of the signal created during the interactions of biomolecules, such as proteins, etc., in the path of signal transmission and drug regulation for ligands is one of the applications of this method. Decreasing the free energy of the whole system by optimizing the shape of the protein and the ligand, and the relative orientation of the protein and the ligand, is the aim of the docking study [6].
Molecular docking has been growing since the early 1980s. Predicting the interactions between small molecules and proteins, and between proteins, is possible using this method [7]. For example, many efforts have focused on the surface chemistry of gold nanoparticles [3,8]. Using EDC/NHS on Au NPs carboxylated to bind to primary amine to lysine residues during protein binding, between fragment crystallizable (Fc) oxidized carbohydrates from IgG antibodies with modified Au NPs, forms part of these trials [3]. Recently, the use of a single-chain variable fragment antibody (scFv) against the surface antigen of Neisseria meningitidis bacteria (fHbp) to bind to gold nanoparticles has been studied [9].
Due to the complex effects of the binding stage of nanoparticles (in this case, gold nanoparticles) to antibodies on the sensitivity and reproducibility of point-of-care tests, it is essential to study the conjugation conditions in the first stages. Since the scFv antibody used in this work was a home-made antibody designed specifically for Neisseria meningitidis, and since it was also improved to form scFv-Fc (confirmed via SOEing PCR) with different sequences from other antibodies, it was essential to optimize the conjugation conditions (including the right side and orientation of the conjugation) using a software method in the first stages of the investigation. In this regard, the protein A-G, as a suitable binder to the Fc region, was selected for effective bottom-on (among the head-on, side-on, bottom-on, and flat-on conjugations) conjugation with the improved scFv-Fc antibody/Au NPs using the docking method. Then, the scFv-Fc/ protein A-G/SPDP recombinant antibody was proposed, and we tried to optimize it through the suitable conjugation of the protein A-G with the improved scFv-Fc/Au NPs to enable an effective interaction with Neisseria meningitidis bacteria.

2. Results and Discussion

Given the effect of the binding of nanoparticles to antibodies on the sensitivity and reproducibility of point-of-care tests [10], it is essential to optimize the conjugation conditions. The availability of the antigen binding region in the antibody structure is one of the most crucial factors in the success of this step and in determining the final results of the diagnostic test, and is achieved through the correct orientation of the antibody on the nanoparticle level [11].
Specificity and sensitivity are two critical factors in areas of medicine such as immunodiagnostics. Head-on, side-on, bottom-on, and flat-on are the four directions of antibody fixation on a surface. Antibody immobilization via a covalent method with controllable orientation and adjustable coating density is essential. Despite efforts to conjugate antibodies with efficient biological activity, harmful exposure caused by the direct binding of antibodies to the surface reduces the signal-to-noise ratio, antigen binding efficiency, and loading capacity [12].
In order to achieve the correct orientation, in this study, an Fc piece was used, which was connected to an ScFv via PCR. According to Rispens et al. [13], this fragment is able to bind to the protein A-G and create a bottom-on orientation where the antigen binding region is available.
On the other hand, nowadays, recombinant antibodies have emerged to optimize the cost of assays and the efficiency of antibodies. scFv is an example of these antibodies, and consists of a linker peptide that connects the variable regions of the light and heavy chains of the antibody. With the appropriate selection of the linker sequence, this antibody can be fixed on the nanoparticle’s surface [14].
Figure 1 shows the SOEing PCR results, checked via the agarose gel method. It confirms the binding of the Fc fragment to scFv for the production of scFv-Fc (~1700 bp). It should be noted that better thermal stability, solubility, and diffusion are some of the advantages of scFv antibodies as compared to the other ones [15], due to their small size and homogeneity [16]. Their small size brings other advantages, such as easier attachment to nanoparticles [17]. Moreover, they have the advantage of easy genetic manipulation, which can improve the desired performance (16, 18) as compared to monoclonal and polyclonal antibodies [18]. Furthermore, our home-made scFv possesses a perfect affinity of ~8.65 × 109 M−1 for the fHbp antigen located on the surface of all strains of Neisseria meningitidis.
Next, we tried to improve the performance of this antibody to increase the performance of point-of-care tests (POCT) for Neisseria meningitides through effective conjugation to Au NPs. In this regard, the molecular structure of the protein A-G and the scFv-Fc recombinant antibody were studied and are presented in Figure 2. Then, the antibody–ligand interactions between the protein A-G and SPDP, the A-G protein and citrate, scFv-Fc and citrate, scFv-Fc and PAH, and scFv-Fc and PVA were investigated via the docking method.
Molecular docking is a technique based on molecular modeling that can predict the preferred orientations for forming a stable complex in the combining of two molecules with each other. In the preferred orientation, scoring functions predicate the intensity of association or the binding affinity between ligand and substrate. Efficient combination and relative orientation, along with the minimization of total free energy, are the goals of molecular docking [19].
From nine positions for each ligand in contact with the protein, the lowest binding affinity (best result) for the ligands and proteins is reported, as mentioned in Table 1. Additionally, the best positions of the ligands and proteins are shown in Figure 3 for ensuring an interaction between the protein A-G and SPDP. Table 2 also gives more details on the chemical bonds and amino acid in the protein A-G/SPDP conjugation. The same interactions and details were studied and are presented in Figures S1–S4 and Tables S1–S4 for interactions between the protein A-G and citrate, scFv-Fc and citrate, scFv-Fc and PAH, and scFv-Fc and PVA.
Protein A-G/citrate and protein A-G/SPDP complexes have suitable binding affinities; however, based on the results shown in Table 1, protein A-G/SPDP (−6.4 kcal/mol) is more preferable than protein A-G/citrate (−5.2 kcal/mol). Furthermore, it is known that the acyl group of a thioester can be transformed into a water molecule in a hydrolysis reaction, leading to a carboxylate. An example of thioester hydrolysis is the conversion of (S)-citryl CoA to citrate in the citric acid cycle (which is known as the Krebs cycle) [20], similar to the carboxylate ester formed in the work reported by Wiley et al. [21]. In this research, we have consistently proposed that due to the pyridine/acetic acid reaction in the presence of Au NPs (as the metallic catalysts), the thioester in SPDP/citrate would be changed to a carboxylate ester during a hydrolysis reaction. On the other and, the A-G protein binds to the Fc region of the antibody through an appropriate binding orientation. These statements are schematically presented in Figure 4. It is worth noting that recently, Yamazaki et al. [22] reported modification of the Fc region of the IgG antibody upon using lipoic acid ligase under mild reaction conditions to obtain a biased site-specificity. Here, from another point of view, we tried to find the optimal positioning of the molecules in order to reduce their steric effects in the scFv-Fc/ protein A-G/SPDP/citrate structure using the docking method.

3. Materials and Methods

In this research, at first, a single-chain variable fragment (scFv) antibody against factor H binding protein, located on the surface of Neisseria meningitidis, was synthesized (more details can be found in [23]). Then, the scFv was attached to the Fc fragment of the human antibody, and finally, characterized using the SOEing PCR technique. We used the following steps to make the scFv-Fc: (1 and 2) we conducted pET28a-scFv PCR to obtain scFv; (3 and 4) we conducted pUcm-Fc PCR to obtain Fc; (5 and 6) we conducted Fc PCR in order to add part of the scFv sequence to Fc; and finally, (7, 8, and 9) we conducted scFv and Fc PCR to bind these pieces to each other. Figure 5 shows a schematic drawing of this process. SOEing PCR creates a chimeric gene by connecting smaller fragments without the need for ligase and restriction enzyme cutting sites [24]. Here, the scFv bound to Fc and the scFv-Fc recombinant antibody are known as chimeric genes. Hence, the primers for scFv and Fc were designed using Gene Runner software (Table 3). After converting the DNA sequence to an amino acid sequence using Expasy [25], the protein sequence was loaded into the I-TASSER server [26,27,28] to study the protein structure. Among the five structures of I-TASSER, the structure with the highest C-score was selected after refinement using the FG-MD online server [29] and minimization using Yasara [30]. The results were uploaded to the Prosa [31,32] and UCLA websites [33] for confirmation. Then, three common agents covering and stabilizing the surface of gold nanoparticles (Table 4) with positive, negative, and neutral charges were selected from Pubchem and used in the docking stages with the help of Chimera [34], PyRx, and PyMol [35] software. In this regard, all ligand and protein formats were specified for PyRx by Chimera. Then, the proteins and each substrate were uploaded to PyRx for docking, and the final results were investigated using PyMol. Additionally, similar steps were applied to study the structure of the A-G protein, and the role of this protein, in conjugation with antibodies and SPDP linkers, was investigated. Finally, the results of protein–ligand interaction were analyzed by using the protein–ligand interaction profiler [36] and PDBsum. Some of the figures were prepared by using Biorender software.

4. Conclusions

The recombinant scFv antibody has favorable sensitivity and specificity for binding to the surface antigen of Neisseria meningitidis bacteria. Therefore, the optimization of this antibody to improve its binding to the surface of gold nanoparticles leads to an increase in the efficiency of the diagnostic tests for this bacterium. Connecting an Fc fragment to this antibody exposes the binding region to the antigen of this antibody, and this fragment specifically binds to the protein A-G, which causes it to bind more tightly to the surface of gold nanoparticles through the carboxylate ester formed on citrate/SPDP. Therefore, the scFv-Fc synthetic complex used for binding to gold nanoparticles, with the help of an SPDP/ protein A-G linker, has the ability to provide biosensors and another point-of-care tests for this bacterium, and a way to design such tests for meningococcal bacteria.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/catal13050790/s1, Figure S1: An illustration for the antibody-ligand interaction between protein A-G and citrate based on: (a) the protein-ligand interaction profiler, (b) the PDBsum, (c) a cartoon view by Pymol, and (d) the surface view by Pymol; Figure S2: An illustration for the antibody-ligand interaction between the scFv-Fc and citrate based on: (a) the protein-ligand interaction profiler, (b) the PDBsum, (c) a cartoon view by Pymol, and (d) the surface view by Pymol; Figure S3: An illustration for the antibody-ligand interaction between the scFv-Fc and PAH based on: (a) the protein-ligand interaction profiler, (b) the PDBsum, (c) a cartoon view by Pymol, and (d) the surface view by Pymol; Figure S4: An illustration for the antibody-ligand interaction between the scFv-Fc and PVA based on: (a) the protein-ligand interaction profiler, (b) the PDBsum, (c) a cartoon view by Pymol, and (d) the surface view by Pymol; Table S1: Some properties of the chemical binds and amino acids of the protein A-G/citrate conjugation; Table S2: Some properties of the chemical binds and amino acids of the scFv-Fc/citrate conjugation; Table S3: Some properties of the chemical binds and amino acids of the scFv-Fc/PAH conjugation; Table S4: Some properties of the chemical binds and amino acids of the scFv-Fc/PVA conjugation.

Author Contributions

Conceptualization, M.R., G.E., M.B. and O.A.; data curation, M.R., G.E., M.B. and O.A.; formal analysis, M.R.; funding acquisition, G.E. and M.B.; investigation, M.R., G.E., M.B. and O.A.; methodology, M.R., G.E., M.B. and O.A.; project administration, G.E. and M.B.; resources, G.E., M.B. and F.Y.; software, M.R.; supervision, G.E., M.B. and O.A.; validation, M.R., G.E., M.B. and O.A.; visualization, M.R., G.E., M.B. and O.A.; writing—original draft, M.R., G.E., M.B. and O.A.; writing—review and editing, M.R., G.E., M.B., O.A. and F.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This study was conducted at the Cellular and Molecular Biology Research Center, Shahid Beheshti University of Medical Sciences. It was funded by a grant from the Iran National Science Foundation (grant no. 91002087).

Data Availability Statement

The data are contained within the article.

Acknowledgments

The authors would like to thank the Shahid Beheshti University, Shahid Beheshti University of Medical Sciences, and the Cellular and Molecular Biology Research Center of Shahid Beheshti University of Medical Sciences for supporting this research project. Also, “Created with BioRender.com” for design some of pictures.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Jazayeri, M.H.; Amani, H.; Pourfatollah, A.A.; Pazoki-Toroudi, H.; Sedighimoghaddam, B. Various methods of gold nanoparticles (GNPs) conjugation to antibodies. Sens. Bio-Sens. Res. 2016, 9, 17–22. [Google Scholar] [CrossRef][Green Version]
  2. Yao, J.; Wang, Y.; Dai, Y.; Liu, C.C. Bioconjugated, single-use biosensor for the detection of biomarkers of prostate cancer. ACS Omega 2018, 3, 6411–6418. [Google Scholar] [CrossRef]
  3. Okyem, S.; Awotunde, O.; Ogunlusi, T.; Riley, M.B.; Driskell, J.D. High-Affinity Points Of Interaction on Antibody Allow Synthesis of Stable and Highly Functional Antibody–Gold Nanoparticle Conjugates. Bioconjug. Chem. 2021, 32, 1753–1762. [Google Scholar] [CrossRef]
  4. Conroy, P.J.; Hearty, S.; Leonard, P.; O’Kennedy, R.J. (Eds.) Antibody production, design and use for biosensor-based applications. In Seminars in Cell & Developmental Biology; Elsevier: Amsterdam, The Netherlands, 2009. [Google Scholar]
  5. Assali, A.; Razzazan, S.; Akhavan, O.; Mottaghitalab, F.; Adeli, M.; Atyabi, F. The bio-interface between functionalized Au NR@ GO nanoplatforms with protein corona and their impact on delivery and release system. Coll. Surf. B Biointerfaces 2019, 173, 891–898. [Google Scholar] [CrossRef]
  6. Raval, K.; Ganatra, T. Basics, types and applications of molecular docking: A review. IP Int. J. Compr. Adv. Pharmacol. 2022, 7, 12–16. [Google Scholar] [CrossRef]
  7. Bartuzi, D.; Kaczor, A.A.; Targowska-Duda, K.M.; Matosiuk, D. Recent advances and applications of molecular docking to G protein-coupled receptors. Molecules 2017, 22, 340. [Google Scholar] [CrossRef] [PubMed][Green Version]
  8. Assali, A.; Akhavan, O.; Adeli, M.; Razzazan, S.; Dinarvand, R.; Zanganeh, S.; Soleimani, M.; Dinarvand, M.; Atyabi, F. Multifunctional core-shell nanoplatforms (gold@ graphene oxide) with mediated NIR thermal therapy to promote miRNA delivery. Nanomed. Nanotechnol. Biol. Med. 2018, 14, 1891–1903. [Google Scholar] [CrossRef] [PubMed]
  9. Rad, M.; Ebrahimipour, G.; Bandehpour, M.; Akhavan, O.; Yarian, F. Enzymatic Formation of Recombinant Antibody-Conjugated Gold Nanoparticles in the Presence of Citrate Groups and Bacteria. Catalysts 2022, 12, 1048. [Google Scholar] [CrossRef]
  10. Mirica, A.-C.; Stan, D.; Chelcea, I.-C.; Mihailescu, C.M.; Ofiteru, A.; Bocancia-Mateescu, L.-A. Latest Trends in Lateral Flow Immunoassay (LFIA) Detection Labels and Conjugation Process. Front. Bioeng. Biotechnol. 2022, 10, 922772. [Google Scholar] [CrossRef]
  11. Tripathi, K.; Driskell, J.D. Quantifying bound and active antibodies conjugated to gold nanoparticles: A comprehensive and robust approach to evaluate immobilization chemistry. ACS Omega 2018, 3, 8253–8259. [Google Scholar] [CrossRef][Green Version]
  12. Gao, S.; Rojas-Vega, F.; Rocha-Martin, J.; Guisán, J.M. Oriented immobilization of antibodies through different surface regions containing amino groups: Selective immobilization through the bottom of the Fc region. Int. J. Biol. Macromol. 2021, 177, 19–28. [Google Scholar] [CrossRef] [PubMed]
  13. Rispens, T.; Vidarsson, G. Human IgG Subclasses. In Antibody Fc; Elsevier: Amsterdam, The Netherlands, 2014; pp. 159–177. [Google Scholar]
  14. Zeng, X.; Shen, Z.; Mernaugh, R. Recombinant antibodies and their use in biosensors. Anal. Bioanal. Chem. 2012, 402, 3027–3038. [Google Scholar] [CrossRef][Green Version]
  15. Xu, X.; Zhang, R.; Chen, X. Application of a single-chain fragment variable (scFv) antibody for the confirmatory diagnosis of hydatid disease in non-endemic areas. Electron. J. Biotechnol. 2017, 29, 57–62. [Google Scholar] [CrossRef]
  16. Ahangarzadeh, S.; Bandehpour, M.; Kazemi, B. Selection of single-chain variable fragments specific for Mycobacterium tuberculosis ESAT-6 antigen using ribosome display. Iran. J. Basic Med. Sci. 2017, 20, 327. [Google Scholar] [PubMed]
  17. Eyvazi, S.; Bandehpour, M.; Kazemi, B. Study of the production and the application of monoclonal antibodies: ScFv. Res. Med. 2017, 41, 138–151. [Google Scholar]
  18. Yang, H.; Zhong, Y.; Wang, J.; Zhang, Q.; Li, X.; Ling, S.; Wang, S.; Wang, R. Screening of a ScFv antibody with high affinity for application in human IFN-γ immunoassay. Front. Microbiol. 2018, 9, 261. [Google Scholar] [CrossRef][Green Version]
  19. Gaba, M.; Gaba, P.; Singh, S.; Gupta, G. An overview on molecular docking. Int. J. Drug Dev. Res. 2010, 2, 219–231. [Google Scholar]
  20. Alabduladhem, T.O.; Bordoni, B. Physiology, Krebs Cycle. In StatPearls [Internet]; StatPearls Publishing: Tampa, FL, USA, 2021. [Google Scholar]
  21. Wiley, D.T.; Webster, P.; Gale, A.; Davis, M.E. Transcytosis and brain uptake of transferrin-containing nanoparticles by tuning avidity to transferrin receptor. Proc. Natl. Acad. Sci. USA 2013, 110, 8662–8667. [Google Scholar] [CrossRef][Green Version]
  22. Yamazaki, S.; Shikida, N.; Takahashi, K.; Matsuda, Y.; Inoue, K.; Shimbo, K.; Mihara, Y. Lipoate-acid ligase a modification of native antibody: Synthesis and conjugation site analysis. Bioorgan. Med. Chem. Lett. 2021, 51, 128360. [Google Scholar] [CrossRef]
  23. Yarian, F.; Kazemi, B.; Bandehpour, M. Identification and characterization of a novel single-chain variable fragment (scFv) antibody against Neisseria meningitidis factor H-binding protein (fHbp). J. Med. Microbiol. 2018, 67, 820–827. [Google Scholar] [CrossRef]
  24. Zarghampoor, F.; Behzad-Behbahani, A.; Azarpira, N.; Khatami, S.R.; Fanian, M.; Aghdaie, M.H.; Dehbidi, G.R. A single tube overlap extension PCR method for splicing of multiple DNA fragments. Avicenna J. Med. Biotechnol. 2020, 12, 37. [Google Scholar] [PubMed]
  25. Gasteiger, E.; Gattiker, A.; Hoogland, C.; Ivanyi, I.; Appel, R.D.; Bairoch, A. ExPASy: The proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Res. 2003, 31, 3784–3788. [Google Scholar] [CrossRef] [PubMed][Green Version]
  26. Zheng, W.; Zhang, C.; Li, Y.; Pearce, R.; Bell, E.W.; Zhang, Y. Folding non-homologous proteins by coupling deep-learning contact maps with I-TASSER assembly simulations. Cell Rep. Methods 2021, 1, 100014. [Google Scholar] [CrossRef] [PubMed]
  27. Zhang, C.; Freddolino, P.L.; Zhang, Y. COFACTOR: Improved protein function prediction by combining structure, sequence and protein–protein interaction information. Nucleic Acids Res. 2017, 45, W291–W299. [Google Scholar] [CrossRef] [PubMed][Green Version]
  28. Yang, J.; Zhang, Y. I-TASSER server: New development for protein structure and function predictions. Nucleic Acids Res. 2015, 43, W174–W181. [Google Scholar] [CrossRef][Green Version]
  29. Xu, D.; Zhang, Y. Improving the physical realism and structural accuracy of protein models by a two-step atomic-level energy minimization. Biophys. J. 2011, 101, 2525–2534. [Google Scholar] [CrossRef][Green Version]
  30. Krieger, E.; Joo, K.; Lee, J.; Lee, J.; Raman, S.; Thompson, J.; Tyka, M.; Baker, D.; Karplus, K. Improving physical realism, stereochemistry, and side-chain accuracy in homology modeling: Four approaches that performed well in CASP8. Proteins Struct. Funct. Bioinformat. 2009, 77 (Suppl. S9), 114–122. [Google Scholar] [CrossRef][Green Version]
  31. Wiederstein, M.; Sippl, M.J. ProSA-web: Interactive web service for the recognition of errors in three-dimensional structures of proteins. Nucleic Acids Res. 2007, 35 (Suppl. S2), W407–W410. [Google Scholar] [CrossRef][Green Version]
  32. Sippl, M.J. Recognition of errors in three-dimensional structures of proteins. Proteins Struct. Funct. Bioinform. 1993, 17, 355–362. [Google Scholar] [CrossRef]
  33. Colovos, C.; Yeates, T.O. Verification of protein structures: Patterns of nonbonded atomic interactions. Protein Sci. 1993, 2, 1511–1519. [Google Scholar] [CrossRef][Green Version]
  34. Pettersen, E.F.; Goddard, T.D.; Huang, C.C.; Couch, G.S.; Greenblatt, D.M.; Meng, E.C.; Ferrin, T.E. UCSF Chimera—A visualization system for exploratory research and analysis. J. Comput. Chem. 2004, 25, 1605–1612. [Google Scholar] [CrossRef] [PubMed][Green Version]
  35. Schrödinger, L.; DeLano, W. PyMOL [Internet]. 2020. Available online: http://www.pymol.org/pymol (accessed on 1 September 2022).
  36. Adasme, M.F.; Linnemann, K.L.; Bolz, S.N.; Kaiser, F.; Salentin, S.; Haupt, V.J.; Schroeder, M. PLIP 2021: Expanding the scope of the protein–ligand interaction profiler to DNA and RNA. Nucleic Acids Res. 2021, 49, W530–W534. [Google Scholar] [CrossRef] [PubMed]
Catalysts 13 00790 g001
Figure 1. The SOEing PCR results, including the scFv antibody, CH1: the first Fc’s PCR cycle; CH2: the second Fc’s PCR cycle; M: the DNA marker, and the scFv-Fc.
Figure 1. The SOEing PCR results, including the scFv antibody, CH1: the first Fc’s PCR cycle; CH2: the second Fc’s PCR cycle; M: the DNA marker, and the scFv-Fc.
Catalysts 13 00790 g001
Catalysts 13 00790 g002
Figure 2. A schematic representation of the molecular structures of (a) the scFv-Fc recombinant antibody, (b) the protein A-G and (c) the amino acid sequence of the scFv-Fc antibody.
Figure 2. A schematic representation of the molecular structures of (a) the scFv-Fc recombinant antibody, (b) the protein A-G and (c) the amino acid sequence of the scFv-Fc antibody.
Catalysts 13 00790 g002
Catalysts 13 00790 g003
Figure 3. An illustration of the antibody–ligand interaction between protein A-G and SPDP based on: (a) the protein–ligand interaction profiler, (b) the PDBsum, (c) a cartoon view created using Pymol and (d) a surface view created using Pymol.
Figure 3. An illustration of the antibody–ligand interaction between protein A-G and SPDP based on: (a) the protein–ligand interaction profiler, (b) the PDBsum, (c) a cartoon view created using Pymol and (d) a surface view created using Pymol.
Catalysts 13 00790 g003
Catalysts 13 00790 g004
Figure 4. A schematic representation of the catalytic reaction of citrate and SPDP linkers on a gold nanoparticle for the formation of the scFv-Fc/A-G protein/SPDP/citrate/Au recombinant antibody.
Figure 4. A schematic representation of the catalytic reaction of citrate and SPDP linkers on a gold nanoparticle for the formation of the scFv-Fc/A-G protein/SPDP/citrate/Au recombinant antibody.
Catalysts 13 00790 g004
Catalysts 13 00790 g005
Figure 5. Schematic representation of SOEing PCR between scFv and Fc according to the following steps: (1 and 2) formation of the scFv antibody, (3 and 4) formation of the Fc protein, (5 and 6) adding the scFv sequence to the Fc sequence via PCR, (7 and 8) binding the scFv to the Fc, and finally, (9) multiplication of the scFv-Fc antibody.
Figure 5. Schematic representation of SOEing PCR between scFv and Fc according to the following steps: (1 and 2) formation of the scFv antibody, (3 and 4) formation of the Fc protein, (5 and 6) adding the scFv sequence to the Fc sequence via PCR, (7 and 8) binding the scFv to the Fc, and finally, (9) multiplication of the scFv-Fc antibody.
Catalysts 13 00790 g005
Table 1. Complexes and binding energy values evaluated through docking.
Table 1. Complexes and binding energy values evaluated through docking.
ComplexBinding Affinity (Kcal/mol)
(scFv-Fc)/citrate−5.5
(scFv-Fc)/PHA−2.6
(scFv-Fc)/PVA−2.2
Protein A-G/citrate−5.2
Protein A-G/SPDP−6.4
(scFv’s antigen binding site)/citrate−4.5
Table 2. Some properties of chemical bonds and amino acids of the protein A-G/SPDP conjugation.
Table 2. Some properties of chemical bonds and amino acids of the protein A-G/SPDP conjugation.
Hydrogen Bonds
IndexResidueAADistance
H-A		Distance
D-A		Donor AngleProtein Donor?Side Chain?Donor AtomAcceptor Atom
1200ALYS2.323.27156.68√√3297[N3+]6745[O3]
2281AHIS2.443.44169.68√√4627[Nar]6730[N3]
Hydrophobic Interactions
IndexResidueAADistanceLigand AtomProtein Atom
1183ATYR3.5567353006
2184APHE3.8367363030
3187ALEU3.9567363081
4199ALYS3.9867403272
Table 3. The primers used in different steps of the SOEing PCR.
Table 3. The primers used in different steps of the SOEing PCR.
Fc Cycle 1Fc Cycle 2scFvSOEing
ForwardAGCGCCAGCACCAAGGGTGAAACGGGCTGATGCTGCAAGCGCCAGCACCAAGGATATATATCCATGGGACAGGTCCACCATATATATCCATGGGACAGGTCCACC
ReverseATATATATGCGGCCGCCTTGCCGGGGCTCAGGCATATATATGCGGCCGCCTTGCCGGGGCTCAGGCTGCAGCATCAGCCCGTTTCATATATATGCGGCCGCCTTGCCGGGGCTCAGGC
Table 4. Outline of chemical components used in the docking method.
Table 4. Outline of chemical components used in the docking method.
Chemical NamePubChem CID2D Structure3D StructureCharge
Citrate 31,348Catalysts 13 00790 i001Catalysts 13 00790 i002Anionic
Allylamine hydrochloride (PAH)82,291Catalysts 13 00790 i003Catalysts 13 00790 i004Cationic
Polyvinyl alcohol (PVA)11,199Catalysts 13 00790 i005Catalysts 13 00790 i006Neutral
N-Succinimidyl 3-(2-pyridyldithio)propionate (SPDP)100,682Catalysts 13 00790 i007Catalysts 13 00790 i008-
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Rad, M.; Ebrahimipour, G.; Bandehpour, M.; Akhavan, O.; Yarian, F. SOEing PCR/Docking Optimization of Protein A-G/scFv-Fc-Bioconjugated Au Nanoparticles for Interaction with Meningitidis Bacterial Antigen. Catalysts 2023, 13, 790. https://doi.org/10.3390/catal13050790

AMA Style

Rad M, Ebrahimipour G, Bandehpour M, Akhavan O, Yarian F. SOEing PCR/Docking Optimization of Protein A-G/scFv-Fc-Bioconjugated Au Nanoparticles for Interaction with Meningitidis Bacterial Antigen. Catalysts. 2023; 13(5):790. https://doi.org/10.3390/catal13050790

Chicago/Turabian Style

Rad, Maryam, Gholamhossein Ebrahimipour, Mojgan Bandehpour, Omid Akhavan, and Fatemeh Yarian. 2023. "SOEing PCR/Docking Optimization of Protein A-G/scFv-Fc-Bioconjugated Au Nanoparticles for Interaction with Meningitidis Bacterial Antigen" Catalysts 13, no. 5: 790. https://doi.org/10.3390/catal13050790

APA Style

Rad, M., Ebrahimipour, G., Bandehpour, M., Akhavan, O., & Yarian, F. (2023). SOEing PCR/Docking Optimization of Protein A-G/scFv-Fc-Bioconjugated Au Nanoparticles for Interaction with Meningitidis Bacterial Antigen. Catalysts, 13(5), 790. https://doi.org/10.3390/catal13050790

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop