Mutation of Key Residues in β-Glycosidase LXYL-P1-2 for Improved Activity
Abstract
:1. Introduction
2. Results
2.1. Selection of Mutation Sites
2.2. Measurement of β-Glycosidase Activities of Mutant Strains
2.3. Effect of L220G Mutation on the Activity of the Other LXYL-P1-2 Mutant EP2
2.4. Specific β-Glycosidase Activities of the Mutants
2.5. Kinetic Analysis of LXYL-P1-2 Mutants against XDT
3. Discussion
4. Materials and Methods
4.1. Plasmids and Strains
4.2. Molecular Docking between LXYL-P1-2 the Substrate XDT
4.3. Mutation of Key Residues in LXYL-P1-2
4.4. Measurement of β-Glycosidase Activities of Mutant Strains
4.5. Purification of Recombinant LXYL-P1-2 Mutants
4.6. Enzyme Activities and Kinetics Parameters Measurement of LXYL-P1-2 Mutants
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Chapman, J.; Ismail, A.E.; Dinu, C.Z. Industrial applications of enzymes: Recent advances, techniques, and outlooks. Catalysts 2018, 8, 238. [Google Scholar] [CrossRef] [Green Version]
- Choi, J.-M.; Han, S.-S.; Kim, H.-S. Industrial applications of enzyme biocatalysis: Current status and future aspects. Biotechnol. Adv. 2015, 33, 1443–1454. [Google Scholar] [CrossRef]
- Kirk, O.; Borchert, T.V.; Fuglsang, C.C. Industrial enzyme applications. Curr. Opin. Biotechnol. 2002, 13, 345–351. [Google Scholar] [CrossRef]
- Chu, J.; Yue, J.; Qin, S.; Li, Y.; Wu, B.; He, B. Biocatalysis for rare ginsenoside Rh2 production in high level with co-immobilized UDP-glycosyltransferase Bs-YjiC mutant and sucrose synthase AtSuSy. Catalysts 2021, 11, 132. [Google Scholar] [CrossRef]
- Millán, A.; Sala, N.; Torres, M.; Canela-Garayoa, R. Biocatalytic transformation of 5-hydroxymethylfurfural into 2, 5-di (hydroxymethyl) furan by a newly isolated Fusarium striatum strain. Catalysts 2021, 11, 216. [Google Scholar] [CrossRef]
- Bornscheuer, U.T.; Pohl, M. Improved biocatalysts by directed evolution and rational protein design. Curr. Opin. Chem. Biol. 2001, 5, 137–143. [Google Scholar] [CrossRef]
- Böttcher, D.; Bornscheuer, U.T. Protein engineering of microbial enzymes. Curr. Opin. Microbiol. 2010, 13, 274–282. [Google Scholar] [CrossRef] [PubMed]
- Kazlauskas, R.J.; Bornscheuer, U.T. Finding better protein engineering strategies. Nat. Chem. Biol. 2009, 5, 526–529. [Google Scholar] [CrossRef]
- Rubingh, D.N. Protein engineering from a bioindustrial point of view. Curr. Opin. Biotechnol. 1997, 8, 417–422. [Google Scholar] [CrossRef]
- Li, Y.; Song, K.; Zhang, J.; Lu, S. A computational method to predict effects of residue mutations on the catalytic efficiency of hydrolases. Catalysts 2021, 11, 286. [Google Scholar] [CrossRef]
- Svensson, B. Protein engineering in the α-amylase family: Catalytic mechanism, substrate specificity, and stability. Plant Mol. Biol. 1994, 25, 141–157. [Google Scholar] [CrossRef]
- Perugino, G.; Strazzulli, A.; Mazzone, M.; Rossi, M.; Moracci, M. Effects of random mutagenesis and in vivo selection on the specificity and stability of a thermozyme. Catalysts 2019, 9, 440. [Google Scholar] [CrossRef] [Green Version]
- Yang, H.; Liu, L.; Li, J.; Chen, J.; Du, G. Rational design to improve protein thermostability: Recent advances and prospects. ChemBioEng Rev. 2015, 2, 87–94. [Google Scholar] [CrossRef]
- Zamost, B.L.; Nielsen, H.K.; Starnes, R.L. Thermostable enzymes for industrial applications. J. Ind. Microbiol. Biot. 1991, 8, 71–81. [Google Scholar] [CrossRef]
- Lehmann, M.; Wyss, M. Engineering proteins for thermostability: The use of sequence alignments versus rational design and directed evolution. Curr. Opin. Biotechnol. 2001, 12, 371–375. [Google Scholar] [CrossRef]
- Ayadi, D.Z.; Sayari, A.H.; Hlima, H.B.; Mabrouk, S.B.; Mezghani, M.; Bejar, S. Improvement of Trichoderma reesei xylanase II thermal stability by serine to threonine surface mutations. Int. J. Biol. Macromol. 2015, 72, 163–170. [Google Scholar] [CrossRef]
- Bao, X.; Huang, X.; Lu, X.; Li, J.-J. Improvement of hydrogen peroxide stability of Pleurotus eryngii versatile ligninolytic peroxidase by rational protein engineering. Enzyme Microb. Technol. 2014, 54, 51–58. [Google Scholar] [CrossRef] [PubMed]
- Jaafar, N.R.; Ayob, S.N.; Abd Rahman, N.H.; Bakar, F.D.A.; Murad, A.M.A.; Illias, R.M. Rational protein engineering of α-l-arabinofuranosidase from Aspergillus niger for improved catalytic hydrolysis efficiency on kenaf hemicellulose. Process Biochem. 2021, 102, 349–359. [Google Scholar] [CrossRef]
- Cheng, Y.-S.; Chen, C.-C.; Huang, J.-W.; Ko, T.-P.; Huang, Z.; Guo, R.-T. Improving the catalytic performance of a GH11 xylanase by rational protein engineering. Appl. Microbiol. Biotechnol. 2015, 99, 9503–9510. [Google Scholar] [CrossRef]
- Han, C.; Li, W.; Hua, C.; Sun, F.; Bi, P.; Wang, Q. Enhancement of catalytic activity and thermostability of a thermostable cellobiohydrolase from Chaetomium thermophilum by site-directed mutagenesis. Int. J. Biol. Macromol. 2018, 116, 691–697. [Google Scholar] [CrossRef]
- Oh, E.-J.; Lee, Y.-J.; Chol, J.; Seo, M.S.; Lee, M.S.; Kim, G.A.; Kwon, S.-T. Mutational analysis of Thermus caldophilus GK24 beta-glycosidase: Role of His119 in substrate binding and enzyme activity. J. Microbiol. Biotech. 2008, 18, 287–294. [Google Scholar]
- Lutz, S. Beyond directed evolution—Semi-rational protein engineering and design. Curr. Opin. Biotechnol. 2010, 21, 734–743. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cragg, G.M. Paclitaxel (Taxol): A success story with valuable lessons for natural product drug discovery and development. Med. Res. Rev. 1998, 18, 315–331. [Google Scholar] [CrossRef]
- Liu, W.C.; Gong, T.; Zhu, P. Advances in exploring alternative Taxol sources. RSC Adv. 2016, 6, 48800–48809. [Google Scholar] [CrossRef]
- McGuire, W.P.; Rowinsky, E.K.; Rosenshein, N.B.; Grumbine, F.C.; Ettinger, D.S.; Armstrong, D.K.; Donehower, R.C. Taxol: A unique antineoplastic agent with significant activity in advanced ovarian epithelial neoplasms. Ann. Intern. Med. 1989, 111, 273–279. [Google Scholar] [CrossRef] [PubMed]
- Stierle, A.; Strobel, G.; Stierle, D. Taxol and taxane production by Taxomyces andreanae, an endophytic fungus of Pacific yew. Science 1993, 260, 214–216. [Google Scholar] [CrossRef] [PubMed]
- Cheng, H.L.; Zhao, R.Y.; Chen, T.J.; Yu, W.B.; Wang, F.; Cheng, K.D.; Zhu, P. Cloning and characterization of the glycoside hydrolases that remove xylosyl groups from 7-β-xylosyl-10-deacetyltaxol and its analogues. Mol. Cell Proteomics 2013, 12, 2236–2248. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, B.J.; Wang, H.; Gong, T.; Chen, J.J.; Chen, T.J.; Yang, J.L.; Zhu, P. Improving 10-deacetylbaccatin III-10-β-O-acetyltransferase catalytic fitness for Taxol production. Nat. Commun. 2017, 8, 15544. [Google Scholar] [CrossRef] [Green Version]
- Liu, W.C.; Gong, T.; Wang, Q.H.; Liang, X.; Chen, J.J.; Zhu, P. Scaling-up Fermentation of Pichia pastoris to demonstration-scale using new methanol-feeding strategy and increased air pressure instead of pure oxygen supplement. Sci. Rep. 2016, 6, 18439. [Google Scholar] [CrossRef] [Green Version]
- Liu, W.C.; Zhu, P. Pilot studies on scale-up biocatalysis of 7-β-xylosyl-10-deacetyltaxol and its analogues by an engineered yeast. J. Ind. Microbiol. Biot. 2015, 42, 867–876. [Google Scholar] [CrossRef]
- Yu, W.B.; Liang, X.; Zhu, P. High-cell-density fermentation and pilot-scale biocatalytic studies of an engineered yeast expressing the heterologous glycoside hydrolase of 7-β-xylosyltaxanes. J. Ind. Microbiol. Biot. 2013, 40, 133–140. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Chen, T.-J.; Wang, F.; Li, L.; Yu, W.-B.; Si, Y.-K.; Chen, J.-J.; Liu, W.-C.; Zhu, P.; Gong, W. Structures of β-glycosidase LXYL-P1-2 reveals the product binding state of GH3 family and a specific pocket for Taxol recognition. Commun. Biol. 2020, 3, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.-J.; Liang, X.; Wang, F.; Wen, Y.-H.; Chen, T.-J.; Liu, W.-C.; Gong, T.; Yang, J.-L.; Zhu, P. Combinatorial mutation on the β-glycosidase specific to 7-β-xylosyltaxanes and increasing the mutated enzyme production by engineering the recombinant yeast. Acta Pharm. Sin. B 2019, 9, 626–638. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.J.; Liang, X.; Li, H.X.; Chen, T.J.; Zhu, P. Improving the catalytic property of the glycoside hydrolase LXYL-P1–2 by directed evolution. Molecules 2017, 22, 2133. [Google Scholar] [CrossRef] [Green Version]
Vmax (μmol L−1 min−1) | Km (mmol L−1) | kcat (s−1) | kcat/Km (mmol L−1 s−1) | |
---|---|---|---|---|
LXYL-P1-2 | 7.28 (±0.13) | 0.50 (±0.01) | 4.37 (±0.08) | 8.72 (±0.09) |
P1-2-L220G | 22.42 (±2.42) | 1.47 (±0.15) | 13.44 (±1.45) | 9.17 (±0.22) * |
EP2 | 3.30 (±0.04) | 0.15 (±0.01) | 1.98 (±0.03) | 13.44 (±0.76) *** |
EP2-L220G | 20.70 (±0.60) | 0.86 (±0.10) | 12.41 (±1.01) | 14.45 (±0.60) *** |
Primer | Sequence (5′ → 3′) |
---|---|
p1-2-L220G-F | AGAAATGGATATATCGACATCGACGGAGTT |
p1-2-L220G-R | GATGTCGATATATCCATTTCTCGATGTTTC |
p1-2-Y268E-F | CATGTGTTCCGAAAACCGTATCAACAACAC |
p1-2-Y268E-R | TACGGTTTTCGGAACACATGATATGATTCG |
p1-2-S466D-F | GGCGGAGACGGGTCGGCACTTTCACCATAC |
p1-2-S466D-R | GTGCCGACCCGTCTCCGCCTCCTGTTGTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, J.-J.; Liang, X.; Chen, T.-J.; Yang, J.-L.; Zhu, P. Mutation of Key Residues in β-Glycosidase LXYL-P1-2 for Improved Activity. Catalysts 2021, 11, 1042. https://doi.org/10.3390/catal11091042
Chen J-J, Liang X, Chen T-J, Yang J-L, Zhu P. Mutation of Key Residues in β-Glycosidase LXYL-P1-2 for Improved Activity. Catalysts. 2021; 11(9):1042. https://doi.org/10.3390/catal11091042
Chicago/Turabian StyleChen, Jing-Jing, Xiao Liang, Tian-Jiao Chen, Jin-Ling Yang, and Ping Zhu. 2021. "Mutation of Key Residues in β-Glycosidase LXYL-P1-2 for Improved Activity" Catalysts 11, no. 9: 1042. https://doi.org/10.3390/catal11091042
APA StyleChen, J.-J., Liang, X., Chen, T.-J., Yang, J.-L., & Zhu, P. (2021). Mutation of Key Residues in β-Glycosidase LXYL-P1-2 for Improved Activity. Catalysts, 11(9), 1042. https://doi.org/10.3390/catal11091042