IER5 Promotes Ovarian Cancer Cell Proliferation and Peritoneal Dissemination
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Viral Vectors
2.3. Generation of ID8-Om2 Cells
2.4. In Vivo Expression of Ier5
2.5. RNA Extraction and RT-qPCR Analysis
2.6. Animal Experiments
2.7. Transfection
2.8. Cell Growth Assay
2.9. Cell Proliferation Assay
2.10. Western Blotting Analysis
2.11. Statistical Analysis
3. Results
3.1. IER5 Family Genes Are Amplified or Overexpressed in Ovarian Cancer and Are Related to Poorer Prognosis
3.2. IER5 Is Highly Expressed in Ovarian Cancer Cells
3.3. IER5 Is Important for Ovarian Cancer Growth and Is Involved in the Induction of HSPs
3.4. IER5 Induces Transcription of HSPs
3.5. IER5 Activates HSF1 via Dephosphorylation and Upregulates Its Target Genes in OC Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Coburn, S.B.; Bray, F.; Sherman, M.E.; Trabert, B. International patterns and trends in ovarian cancer incidence, overall and by histologic subtype. Int. J. Cancer 2017, 140, 2451–2460. [Google Scholar] [CrossRef] [PubMed]
- Höhn, A.K.; Brambs, C.E.; Hiller, G.G.R.; May, D.; Schmoeckel, E.; Horn, L.-C. 2020 WHO Classification of Female Genital Tumors. Geburtshilfe Und Frauenheilkd. 2021, 81, 1145–1153. [Google Scholar] [CrossRef]
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef]
- Shimada, M.; Yoshihara, K.; Tanigawa, T.; Nomura, H.; Hamanishi, J.; Fujiwara, S.; Tanabe, H.; Kajiyama, H.; Mandai, M.; Aoki, D.; et al. An attempt to establish real-world databases of poly(ADP-ribose) polymerase inhibitors for advanced or recurrent epithelial ovarian cancer: The Japanese Gynecologic Oncology Group. J. Gynecol. Oncol. 2023, 34, e62. [Google Scholar] [CrossRef] [PubMed]
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2019. CA Cancer J. Clin. 2019, 69, 7–34. [Google Scholar] [CrossRef] [PubMed]
- Spagnol, G.; Sensi, F.; De Tommasi, O.; Marchetti, M.; Bonaldo, G.; Xhindoli, L.; Noventa, M.; Agostini, M.; Tozzi, R.; Saccardi, C. Patient Derived Organoids (PDOs), Extracellular Matrix (ECM), Tumor Microenvironment (TME) and Drug Screening: State of the Art and Clinical Implications of Ovarian Cancer Organoids in the Era of Precision Medicine. Cancers 2023, 15, 2059. [Google Scholar] [CrossRef] [PubMed]
- Dai, C.; Sampson, S.B. HSF1: Guardian of Proteostasis in Cancer. Trends Cell Biol. 2016, 26, 17–28. [Google Scholar] [CrossRef] [PubMed]
- Carpenter, R.L.; Gökmen-Polar, Y. HSF1 as a Cancer Biomarker and Therapeutic Target. Curr. Cancer Drug Targets 2019, 19, 515–524. [Google Scholar] [CrossRef]
- Cyran, A.M.; Zhitkovich, A. Heat Shock Proteins and HSF1 in Cancer. Front. Oncol. 2022, 12, 860320. [Google Scholar] [CrossRef]
- Wang, G.; Cao, P.; Fan, Y.; Tan, K. Emerging roles of HSF1 in cancer: Cellular and molecular episodes. Biochim. Biophys. Acta (BBA) Rev. Cancer 2020, 1874, 188390. [Google Scholar] [CrossRef]
- Dai, C. The heat-shock, or HSF1-mediated proteotoxic stress, response in cancer: From proteomic stability to oncogenesis. Philos. Trans. R. Soc. B Biol. Sci. 2018, 373, 20160525. [Google Scholar] [CrossRef] [PubMed]
- Powell, C.D.; Paullin, T.R.; Aoisa, C.; Menzie, C.J.; Ubaldini, A.; Westerheide, S.D. The Heat Shock Transcription Factor HSF1 Induces Ovarian Cancer Epithelial-Mesenchymal Transition in a 3D Spheroid Growth Model. PLoS ONE 2016, 11, e0168389. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.-F.; Wang, S.-Y.; Yang, Y.-H.; Zheng, J.; Liu, T.; Wang, L. Targeting HSF1 leads to an antitumor effect in human epithelial ovarian cancer. Int. J. Mol. Med. 2017, 39, 1564–1570. [Google Scholar] [CrossRef] [PubMed]
- Asano, Y.; Kawase, T.; Okabe, A.; Tsutsumi, S.; Ichikawa, H.; Tatebe, S.; Kitabayashi, I.; Tashiro, F.; Namiki, H.; Kondo, T.; et al. IER5 generates a novel hypo-phosphorylated active form of HSF1 and contributes to tumorigenesis. Sci. Rep. 2016, 6, 19174. [Google Scholar] [CrossRef]
- Yamano, S.; Kimura, M.; Chen, Y.; Imamoto, N.; Ohki, R. Nuclear import of IER5 is mediated by a classical bipartite nuclear localization signal and is required for HSF1 full activation. Exp. Cell Res. 2020, 386, 111686. [Google Scholar] [CrossRef] [PubMed]
- Wu, Z.; Wang, D.; Zeng, F.; Zhang, Y.; Zhu, G.; Ma, Y.; Song, B.; Lui, S.; Wu, M. High IER5 Gene Expression Is Associated with Poor Prognosis in Glioma Patients. Front. Cell Dev. Biol. 2021, 9, 679684. [Google Scholar] [CrossRef]
- Ueno, S.; Sudo, T.; Saya, H.; Sugihara, E. Pigment epithelium-derived factor promotes peritoneal dissemination of ovarian cancer through induction of immunosuppressive macrophages. Commun. Biol. 2022, 5, 904. [Google Scholar] [CrossRef]
- Doi, K.; Takeuchi, H.; Sakurai, H. PP2A-B55 and its adapter proteins IER2 and IER5 regulate the activity of RB family proteins and the expression of cell cycle-related genes. FEBS J. 2023, 290, 745–762. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; He, Y.-Q.; Miao, T.-W.; Yin, J.; Liu, J.; Zeng, H.-P.; Zhu, Q. IER5L is a Prognostic Biomarker in Pan-Cancer Analysis and Correlates with Immune Infiltration and Immune Molecules in Non-Small Cell Lung Cancer. Int. J. Gen. Med. 2023, 16, 5889–5908. [Google Scholar] [CrossRef] [PubMed]
- Crespo, J.R.; Martín-Martín, N.; Garcia-Longarte, S.; Corres-Mendizabal, J.; Carlevaris, O.; Astobiza, I.; Zabala-Letona, A.; Guiu, M.; Azkargorta, M.; Gonzalez-Lopez, M.; et al. The PP2A regulator IER5L supports prostate cancer progression. Cell Death Dis. 2024, 15, 514. [Google Scholar] [CrossRef] [PubMed]
- Kyjacova, L.; Saup, R.; Rönsch, K.; Wallbaum, S.; Dukowic-Schulze, S.; Foss, A.; Scherer, S.D.; Rothley, M.; Neeb, A.; Grau, N.; et al. IER2-induced senescence drives melanoma invasion through osteopontin. Oncogene 2021, 40, 6494–6512. [Google Scholar] [CrossRef] [PubMed]
- Neeb, A.; Wallbaum, S.; Novac, N.; Dukovic-Schulze, S.; Scholl, I.; Schreiber, C.; Schlag, P.; Moll, J.; Stein, U.; Sleeman, J.P. The immediate early gene Ier2 promotes tumor cell motility and metastasis, and predicts poor survival of colorectal cancer patients. Oncogene 2012, 31, 3796–3806. [Google Scholar] [CrossRef] [PubMed]
- Ueda, T.; Kohama, Y.; Sakurai, H. IER family proteins are regulators of protein phosphatase PP2A and modulate the phosphorylation status of CDC25A. Cell. Signal. 2019, 55, 81–89. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Dolgalev, I.; Zhang, T.; Ran, H.; Levine, D.A.; Neel, B.G. Both fallopian tube and ovarian surface epithelium are cells-of-origin for high-grade serous ovarian carcinoma. Nat. Commun. 2019, 10, 5367. [Google Scholar] [CrossRef]
- Motohara, T.; Masuko, S.; Ishimoto, T.; Yae, T.; Onishi, N.; Muraguchi, T.; Hirao, A.; Matsuzaki, Y.; Tashiro, H.; Katabuchi, H.; et al. Transient depletion of p53 followed by transduction of c-Myc and K-Ras converts ovarian stem-like cells into tumor-initiating cells. Carcinogenesis 2011, 32, 1597–1606. [Google Scholar] [CrossRef]
- Roby, K.F.; Taylor, C.C.; Sweetwood, J.P.; Cheng, Y.; Pace, J.L.; Tawfik, O.; Persons, D.L.; Smith, P.G.; Terranova, P.F. Development of a syngeneic mouse model for events related to ovarian cancer. Carcinogenesis 2000, 21, 585–591. [Google Scholar] [CrossRef] [PubMed]
- Hashimoto, M.; Niwa, O.; Nitta, Y.; Takeichi, M.; Yokoro, K. Unstable expression of E-cadherin adhesion molecules in metastatic ovarian tumor cells. Jpn. J. Cancer Res. 1989, 80, 459–463. [Google Scholar] [CrossRef] [PubMed]
- Ishikawa, Y.; Sakurai, H. Heat-induced expression of the immediate-early gene IER5 and its involvement in the proliferation of heat-shocked cells. FEBS J. 2015, 282, 332–340. [Google Scholar] [CrossRef] [PubMed]
- Kawabata, S.; Ishita, Y.; Ishikawa, Y.; Sakurai, H. Immediate-early response 5 (IER5) interacts with protein phosphatase 2A and regulates the phosphorylation of ribosomal protein S6 kinase and heat shock factor 1. FEBS Lett. 2015, 589, 3679–3685. [Google Scholar] [CrossRef]
- Kobayashi, Y.; Shimada, M.; Tamate, M.; Cho, H.W.; Zhu, J.; Chou, H.-H.; Kajiyama, H.; Okamoto, A.; Aoki, D.; Kang, S.; et al. Current treatment strategies for ovarian cancer in the East Asian Gynecologic Oncology Trial Group (EAGOT). J. Gynecol. Oncol. 2024, 35, e87. [Google Scholar] [CrossRef] [PubMed]
- Mendillo, M.L.; Santagata, S.; Koeva, M.; Bell, G.W.; Hu, R.; Tamimi, R.M.; Fraenkel, E.; Ince, T.A.; Whitesell, L.; Lindquist, S. HSF1 drives a transcriptional program distinct from heat shock to support highly malignant human cancers. Cell 2012, 150, 549–562. [Google Scholar] [CrossRef] [PubMed]
- Krishnaraj, J.; Yamamoto, T.; Ohki, R. p53-Dependent Cytoprotective Mechanisms behind Resistance to Chemo-Radiotherapeutic Agents Used in Cancer Treatment. Cancers 2023, 15, 3399. [Google Scholar] [CrossRef] [PubMed]
Primer | Sequence (5’-3’) |
---|---|
Mouse Ier5 forward | CCTTCGCTTCCAGACGATAG |
Mouse Ier5 Reverse | GCGTCACCAGGTCTTTTCTC |
Mouse β-Actin forward | CGGTTCCGATGCCCTGAGGCTCTT |
Mouse β-Actin reverse | CGTCACACTTCATGATGGAATTGA |
Mouse Hspa1b forward | CCAGTAGCCTGGGAAGACAT |
Mouse Hspa1b reverse | CAGTGCCAAGACGTTTGTTT |
Mouse Ier5 Forward | CGGCTCTACCCCTCTCAAGA |
Mouse Ier5 Reverse | CCGAAGATGCTGATGAGGTTTG |
Mouse Ier5 Probe | CCATCTCCTCGTCGGTGTCGTCCT |
Mouse Hsf1 Forward | GCACACTCTGTGCCCAAGTATG |
Mouse Hsf1 Reverse | AGCTGGTGACAGCATCAGAGGA |
Mouse β-Actin Forward | CGCGAGCACAGCTTCTTTG |
Mouse β-Actin Reverse | CATGCCGGAGCCGTTGTC |
Mouse β-Actin Probe | CACACCCGCCACCAGTTCGCCATG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Krishnaraj, J.; Ueno, S.; Nakamura, M.; Tabata, Y.; Yamamoto, T.; Asano, Y.; Tanaka, T.; Kuzuyama, T.; Saya, H.; Ohki, R. IER5 Promotes Ovarian Cancer Cell Proliferation and Peritoneal Dissemination. Cancers 2025, 17, 610. https://doi.org/10.3390/cancers17040610
Krishnaraj J, Ueno S, Nakamura M, Tabata Y, Yamamoto T, Asano Y, Tanaka T, Kuzuyama T, Saya H, Ohki R. IER5 Promotes Ovarian Cancer Cell Proliferation and Peritoneal Dissemination. Cancers. 2025; 17(4):610. https://doi.org/10.3390/cancers17040610
Chicago/Turabian StyleKrishnaraj, Jayaraman, Sayaka Ueno, Moe Nakamura, Yuko Tabata, Tatsuki Yamamoto, Yoshinori Asano, Tomoaki Tanaka, Tomohisa Kuzuyama, Hideyuki Saya, and Rieko Ohki. 2025. "IER5 Promotes Ovarian Cancer Cell Proliferation and Peritoneal Dissemination" Cancers 17, no. 4: 610. https://doi.org/10.3390/cancers17040610
APA StyleKrishnaraj, J., Ueno, S., Nakamura, M., Tabata, Y., Yamamoto, T., Asano, Y., Tanaka, T., Kuzuyama, T., Saya, H., & Ohki, R. (2025). IER5 Promotes Ovarian Cancer Cell Proliferation and Peritoneal Dissemination. Cancers, 17(4), 610. https://doi.org/10.3390/cancers17040610