Next Article in Journal
Transfer Learning-Based Integration of Dual Imaging Modalities for Enhanced Classification Accuracy in Confocal Laser Endomicroscopy of Lung Cancer
Previous Article in Journal
Young Adults and Alcohol-Associated Liver Cancer: Incidence and Death from 2000 to 2021
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

IER5 Promotes Ovarian Cancer Cell Proliferation and Peritoneal Dissemination

1
Laboratory of Fundamental Oncology, National Cancer Center Research Institute, Tsukiji 5-1-1, Chuo-ku, Tokyo 104-0045, Japan
2
Department of Genomic Medicine, Fujita Health University, Toyoake 470-1192, Japan
3
Graduate School of Agricultural and Life Sciences, The University of Tokyo, Tokyo 113-8654, Japan
4
Department of Molecular Diagnosis, Chiba University School of Medicine, Chiba 260-0856, Japan
5
Graduate School of Medicine, Keio University, Tokyo 160-0016, Japan
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Cancers 2025, 17(4), 610; https://doi.org/10.3390/cancers17040610
Submission received: 6 November 2024 / Revised: 24 January 2025 / Accepted: 1 February 2025 / Published: 11 February 2025
(This article belongs to the Section Molecular Cancer Biology)

Simple Summary

Epithelial ovarian cancer (OC), the most common type of OC, frequently harbors p53 mutations. In this study, we found that the immediate early response 5 gene (IER5), a p53 target gene, is overexpressed in OC cells. Importantly, OC cells found floating in the ascites had a higher expression of Ier5 than the parent strain, suggesting a role for IER5 in metastasis. Our previous research demonstrated that IER5 activates heat shock factor-1 (HSF1), a key transcription factor that regulates heat shock protein (HSP) genes by promoting the formation of a hypo-phosphorylated active form of HSF1. This activation of HSF1 by IER5 leads to the transcriptional activation of HSP genes, which help protect cells from stress. Here we showed that knockdown of Ier5 reduced the proliferation of OC cells as well as the induction of HSPs. These results indicate that the IER5-HSF1-HSP pathway contributes to the proliferation and peritoneal dissemination of OC cells.

Abstract

Background/Objective: Ovarian cancer (OC) is one of the most lethal gynecological cancers, having a worldwide mortality rate of 66% in 2020. The overall 5-year relative survival rate is only 21% for distant stages, due to the lack of early diagnosis. Epithelial OC, the most common high-grade serous carcinoma, carries p53 mutations in most cases. However, we found that the immediate early response 5 gene (IER5), a p53 target gene, is overexpressed in ovarian cancer cells. The molecular mechanism underlying the role of IER5 in OC has not been well studied. We previously reported that IER5 promotes the dephosphorylation and activation of heat shock factor-1 (HSF1), the master regulator of proteostasis, which induces heat shock protein (HSP) expression. Methods/Results: Here we show that Ier5 mRNA expression is higher in ovarian cancer cells (MOV, ID8G, and HM-1) compared to normal ovarian cells. We also show that OC cells floating in the ascites have higher Ier5 expression than the parental strain. Knockdown of Ier5 suppressed HSP upregulation and proliferation of OC, while overexpression of IER5 promoted HSP upregulation. Knockdown of Hsf1 showed results similar to Ier5 knockdown. Conclusions: These results indicate that the IER5-HSF1 pathway contributes to the proliferation and peritoneal dissemination of OC cells. We also found that higher expression of IER5 family genes is related to poorer prognosis of OC patients, suggesting the potential of the IER5 gene family as diagnostic markers for OC, as well as potential therapeutic targets.

1. Introduction

Ovarian cancer (OC) is one of the most lethal gynecological cancers [1]; 90% of the reported cases are of epithelial origin, while other forms such as those of germ-cell origin constitute the remaining [2]. GLOBOCAN 2020 reported a global incidence of 313,959 cases of OC, with a mortality rate of 66% in 2020 [3]. Treatment for OC involves the combination of surgical removal of the tumor mass followed by the application of chemotherapeutic drugs, usually a combination of two or more cisplatin-based drugs [4]. The overall 5-year relative survival rate is only 21% for distant stages, while the survival rate for local stages is up to 92% [3,5]. Some of the main reasons for this high mortality rate include the lack of early diagnosis and a high rate of relapse, mainly due to drug resistance [6]. In recent years, precision medicine involving patient-derived xenografts or organoid models and drug screening has become a very advanced method of treating these cancers [4,6].
Heat shock factor 1 (HSF1) is a transcription factor that functions as a master regulator of the proteotoxic stress and heat shock responses to protect cellular proteins [7]. HSF1 has been recently reported to be involved in the tumorigenesis and progression of various cancers such as ovarian, pancreatic, breast, and hepatic cancers [8,9,10]. During cancer treatment, HSF1 can reprogram the proteome to protect cancer cells from stress, which can lead to multi-drug resistance [11]. HSF1 has also been reported to induce the epithelial–mesenchymal transition in a spheroid model of ovarian cancer following transforming growth factor-β treatment [12]. Similarly, HSF1 has been shown to be required for cancer cell growth in both in vitro and in vivo models of ovarian cancer [13].
Previously, we reported that immediate early gene 5 (IER5), a transcriptional target of tumor suppressor p53, promotes tumorigenesis and confers resistance against internal and external stresses via activation of HSF1 [14]. Activation of HSF1 generally involves its hyper-phosphorylation on certain Ser/Thr residues by protein kinase A, casein kinase 2, polo-like kinase 1, mitogen-activated protein kinase, and others [7]. However, we previously reported a novel mechanism of HSF1 activation involving IER5, which facilitates the generation of a hypo-phosphorylated, activated form of HSF1 that can contribute to tumorigenesis. This mechanism involves the formation of a ternary complex of IER5 with protein phosphatase 2A (PP2A) and HSF1. PP2A dephosphorylates HSF1 in this complex at key serine and threonine residues, including Ser121, Ser307, Ser314, Thr323, and Thr367, which normally keep HSF1 inactive. Thus, this hypo-phosphorylation form of HSF1 is activated [14,15]. By this mechanism, IER5 induces the expression of heat shock proteins (HSPs), which in turn protect cells from proteomic stress [7,14].
High IER5 expression is associated with poor prognosis in bladder, breast, brain, and glioma patients [14,16]. We also found that IER5 is overexpressed in various cancers, the highest of which was in ovarian cancer [14]. These findings suggest that IER5 may be involved in the development and progression of ovarian cancer. Since IER5 also contributes to the survival and proliferation of cancer cells in suspension [14], we wanted to examine whether IER5 is also involved in the metastasis of ovarian cancer cells. In this study, we created a mouse model of ovarian cancer peritoneal metastasis to analyze the potential role of IER5. We showed that both IER5 and HSF1 are essential for ovarian cancer cell proliferation in both adherent and suspension conditions. We also found that the expression of various HSF1 target genes is dependent on both IER5 and HSF1 in ovarian cancer cells. These results revealed that IER5 induces HSP expression via HSF1 and plays an important role in ovarian cell carcinogenesis and proliferation.

2. Materials and Methods

2.1. Cell Culture

ID8 cells were obtained from K. F. Roby (University of Kansas Medical Center) and cultured in DMEM medium supplemented with 4% FBS, insulin (5 μg/mL), transferrin (5 μg/mL), and sodium selenite (5 ng/mL) (ITS; Sigma-Aldrich, St. Louis, MO, USA). p53-def-MOSE and T-Ag-MOSE cells were obtained from the JCRB Cell Bank (Ibaraki, Japan) and were cultured in DMEM supplemented with 10% FBS. HM-1 cells were obtained from RIKEN BRC and were cultured in RPMI supplemented with 10% FBS. Mouse ovarian tumor-initiating MOV cells were obtained from T. Motohara (Keio University) and were cultured in DMEM-F12 supplemented with 10% FBS. All cells were maintained in 5% CO2 at 37 °C.

2.2. Viral Vectors

The plasmid pMXs-IRES-GFP (kindly provided by T. Kitamura, The University of Tokyo) was used to generate a GFP-expressing retrovirus, which was transduced into ID8 cells. Infected cells were then sorted using a MoFlo XDP cell sorter (Beckman Coulter, Miami, FL, USA) to collect GFP-positive (ID8G) cells.

2.3. Generation of ID8-Om2 Cells

ID8G cells (5 × 106) suspended in 300 µL of PBS were injected i.p. into 7- to 9-week-old female C57BL/6J mice. Between 90 and 120 days after cell injection, the omentum was isolated and dissociated by incubation for 1 h at 37 °C with collagenase (300 U/mL). Red blood cells in the tissue digest were lysed by exposure to ammonium chloride. The single-cell suspension thus obtained was sorted via a MoFlo XDP cell sorter to isolate CD45-GFP+ cells, which were cultured for several days. The resulting ID8-Om1 cells were then similarly injected i.p. into recipient mice. Subsequently, CD45-GFP+ cells were isolated from the omentum and designated ID8-Om2 cells [17].

2.4. In Vivo Expression of Ier5

ID8G cells (5 × 106) were suspended in 300 µL of PBS and then injected i.p. into 7- to 9-week-old female C57BL/6J mice. When ascites had been sufficiently formed, it was collected and CD45-GFP+ cells were isolated via a MoFlo XDP cell sorter. The collected cells were used for analysis of Ier5 expression.

2.5. RNA Extraction and RT-qPCR Analysis

Total RNA was extracted from cells by TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and subjected to reverse transcription with ReverTra Ace qPCR RT Master Mix (Toyobo, Osaka, Japan). The resulting cDNA was analyzed by qPCR using TB Green Premix Ex Taq II (Takara Bio, Shiga, Japan) for the SYBR Green system or PrimeTime Gene Expression Master Mix (Integrated DNA Technologies, Coralville, IA, USA) for the TaqMan system. For Hspa1a (Mm PT.58. 33332390.g), Dnajb1 (Mm PT.58.23437403) and Hspb2 (Mm PT.58. 13396417.g), custom-designed TaqMan probes were purchased from Integrated Technologies. For Ier5 and actin, custom-designed TaqMan probes from Sigma-Aldrich. Transcript levels were normalized to β-actin mRNA. Primer sequences used for expression analysis are listed in Table 1.

2.6. Animal Experiments

Animal care and procedures were performed in accordance with the guidelines of Keio University. Female immunocompetent (C57BL/6J) mice at 6 to 8 weeks of age were obtained from Charles River Japan (Atsugi, Japan). Mice were killed with the use of isoflurane before becoming moribund. All animal experimental protocols were approved by the Keio University Ethics Committee for Animal Experiments.

2.7. Transfection

Transient transfections were performed using Lipofectamine Plus reagent (Life Technologies, Carlsbad, CA, USA). siRNAs were introduced using OptiMEM and RNAiMAX (Invitrogen, Carlsbad, CA, USA). Control (D-001810-10-50), ON-TARGETplus Ier5-targeting (L-043689-01 and L-043689-01-005), and Hsf1-targeting (L-040660-01-0010) siRNA pools (each consisting of 4 siRNAs) were purchased from Dharmacon Research (Lafayette, CO, USA). Similarly, overexpression plasmids (for IER5-Flag) were transfected using OptiMEM and Lipofectamine 2000 reagent. The same amount of empty vector DNA was added to the control plates.

2.8. Cell Growth Assay

MOV or HM-1 cells (1 × 104 per well) were grown in 24-well adherent tissue culture plates (Corning, Tewksbury, MA, USA) and transfected with 20 nM of Ier5/Hsf1-targeting or control siRNAs (Dharmacon, Lafayette, CO, USA). Then, 48 h later, cell numbers were counted.

2.9. Cell Proliferation Assay

MOV or HM-1 cells (1 × 103 per well) were transferred to 96-well adherent tissue culture plates (Corning) for adherent mode or ultralow attachment 96-well plates (Corning) for suspension mode, and Ier5-targeting or control siRNAs were introduced. As MOV cells failed to attach to Corning plates, we used advanced μCLEAR plate (655983, Greiner Bio-One, Frickenhausen, Germany) to grow MOV cells in suspension mode. Cells were collected from 4–6 wells of each group in a 0, 1, 2, and 3-day time course after transfection, and cell proliferation was assayed with the CellTiter-Glo Luminescent Cell Viability Assay Kit (Promega, Madison, WI, USA) and a multimode plate reader (EnVision; Perkin-Elmer, Boston, MA, USA) or Wallac 1420 ARVOsx plate reader (PerkinElmer, Norwalk, CT, USA).

2.10. Western Blotting Analysis

Cells were lysed in a lysis buffer containing 50 mM Tris-HCl (pH 8.0), 1% NP40, 250 mM NaCl, 1 mM DTT, 5 mM EDTA, and 1 mM protease inhibitor (PMSF, aprotinin and leupeptin). The lysates were then treated with an equal volume of 4X SDS buffer (0.4 M Tris-HCl (pH 6.8), 8% SDS, 4% (v/v) glycerol, and 0.04% bromophenol blue). Whole cell lysates were subjected to protein quantification and analyzed by Western blotting. Antibodies used in this study: anti-IER5 rabbit polyclonal antibody (HPA029894, dilution ratio 1:5000) was purchased from Merck, anti-HSF1 rabbit polyclonal antibody (ADI-SPA-901, dilution ratio 1:10,000) was from Enzo Life Sciences, anti-DDDDK rabbit antibody (PM020, dilution ratio 1:3000) was from MBL, and anti-actin (clone C4) mouse monoclonal antibody (MAB1501, dilution ratio 1:5000) was from Millipore.

2.11. Statistical Analysis

Data were calculated and shown as the mean ± SD. In the figures, comparisons between the samples were performed by Student’s t test. Statistical significance was defined as p < 0.05.

3. Results

3.1. IER5 Family Genes Are Amplified or Overexpressed in Ovarian Cancer and Are Related to Poorer Prognosis

Previously, we reported that ovarian cancer has the highest degree of IER5 overexpression among various cancer types [14]. In addition to IER5, IER5L and IER2—two homologues of IER5 with structural similarity [18]—are also highly expressed and promote tumor progression, metastasis, and invasion in various cancers including prostate cancer, non-small cell lung cancer, melanoma, and colorectal cancer [19,20,21,22]. Previously, we reported that IER5 contributes to tumorigenesis by recruiting PP2A phosphatase to HSF1, resulting in the dephosphorylation at inhibitory phosphorylation sites and the generation of a novel hypo-phosphorylated active form of HSF1 [14]. IER2 and IER5L have also been reported to interact with PP2A and to generate hypo-phosphorylated active HSF1 [23]. IER5 and its family members IER5L and IER2 have undergone genetic alteration in ovarian cancer, including amplification and high expression, as shown in Figure 1A. It is expected that expression of the IER5 family genes is elevated in many ovarian cancer samples. Therefore, only several are classified as having high mRNA expression based on the strict criterion of “mRNA high”, defined as greater than two standard deviations above the mean. At least one IER5 family gene is overexpressed or amplified in 22.5% of ovarian cancers, suggesting that this family of genes is involved in ovarian cancer promotion. In addition, the overall survival of ovarian cancer patients having alterations in IER5 family genes is significantly lower than those without alterations, indicating that these genes are involved in cancer progression (Figure 1B). We further found that expression of the HSF1 target genes HSPA1A and HSPA1B was significantly higher in ovarian cancer samples with high IER5 family gene expression compared to samples with low IER5 family gene expression (Figure 1C,D), suggesting that the IER5 family gene–HSF1–HSP family gene axis may play an important role in ovarian cancer.
Ovarian cancer can originate from either ovarian surface epithelial (OSE) cells or fallopian tube epithelial (FTE) cells. We therefore analyzed the expression of Ier5 family genes derived from OSE (Figure 1E) and FTE (Figure 1F) using data from a published mouse model of ovarian cancer [24]. We found that Ier5 expression is elevated in ovarian cancer derived from OSE but not FTE, whereas both Ier5l and Ier2 were upregulated in those from FTE but not OSE. These results collectively suggest that IER5 family genes may promote the formation and progression of ovarian cancer.

3.2. IER5 Is Highly Expressed in Ovarian Cancer Cells

Since we found significant elevation of Ier5 mRNA in an ovarian cancer mouse model derived from OSE, we then decided to focus on the function of Ier5 in ovarian cancer cells derived from OSE. We first analyzed Ier5 mRNA levels in normal mouse OSE and cancerous mouse OSE cells. We chose two immortalized normal mouse OSE cell lines: p53 MOSE cells (from p53-deficient mice) and T-Ag-MOSE cells (expressing SV40 T antigen) and three mouse OSE cancer cells: MOV, ID8G, and HM-1 cells (Figure 2A). MOV cells were established from epithelial cell-adhesion molecule-positive cells derived from the ovaries of C57BL6 mice. These cells were transiently depleted of p53, followed by transfection with c-Myc and K-rasG12V to generate stem-like tumor-initiating cells that give rise to lethal ovarian tumors [25]. ID8 cells are one of the 10 clones established by Roby et al. that have the highest tumor-forming capacity [26]. HM-1 cells are highly metastatic cells established by Hashimoto et al. from the lung metastasis of an ovarian primary tumor in B6C3F1 mice [27]. We found significantly higher levels of Ier5 mRNA expression in all ovarian cancer cells (MOV, ID8G, and HM-1 cells) compared to normal ovarian cells (p53 MOSE and T-Ag-MOSE cells) (Figure 2B). We also isolated ID8-Om2 cells, which are derived from the peritoneal dissemination of ID8G cells (in the omentum). We observed an almost two-fold increase in Ier5 mRNA expression in ID8-Om2 compared to ID8G cells (Figure 2C), indicating a possible role of IER5 in peritoneal dissemination and metastasis. This notion was further confirmed by the multi-fold upregulation of Ier5 expression in ID8G cells from ascites isolated from mice compared to ID8G cells grown in vitro (Figure 2D). These results suggest that IER5 promotes tumorigenesis and metastasis of ovarian cancer.

3.3. IER5 Is Important for Ovarian Cancer Growth and Is Involved in the Induction of HSPs

To further investigate the role of IER5 in ovarian carcinogenesis, we knocked down Ier5 expression in HM-1 and MOV cells, two ovarian cancer cell lines having higher Ier5 expression, and analyzed the impact on cell growth (Figure 2B). Compared to MOV and HM-1 cells, ID8G cells showed lesser IER5 expression (as shown in Figure 2B). Furthermore, the efficiency of Ier5 siRNA knockdown was also too low in ID8G and ID8-Om2 cells and did not have a significant effect on cell number (Supplementary Figure S1A,B). Therefore, we did not include ID8G cells for further analysis. In MOV and HM-1 cells, knockdown was achieved using siRNA targeting Ier5, and cell numbers were counted 48 h later. Ier5 knockdown significantly reduced the numbers of both HM-1 and MOV cells compared to the siCtrl-treated group (Figure 3A–D; Supplementary Figure S1C,D). We further conducted a time-course cell proliferation assay using CellTiter-Glo Kit (Promega) to assess the effect of Ier5 knockdown on cell proliferation. Silencing of Ier5 expression inhibited the proliferation of these cells both in adherent and suspension cultures (Figure 3E,F). These results indicate the importance of IER5 for the proliferation of ovarian cancer cells under both adherent and suspension conditions.

3.4. IER5 Induces Transcription of HSPs

Previously, we showed that IER5 contributes to tumorigenesis by inducing various HSPs in epithelial lung cancer (H1299) and transformed embryonic kidney cells (293T) [14]. We hypothesized that the same mechanism might be at work in ovarian cancer. To assess the impact of Ier5 knockdown on HSF1 target genes, we analyzed the expression of HSPs in HM-1 and MOV ovarian cancer cells following knockdown. Our results showed that the expression of key HSPs such as Hspa1a, Hspa1b, and Dnajb1 was downregulated when Ier5 was knocked down compared to si-Control (Figure 4B,D). Ier5 knockdown was confirmed by analysis of Ier5 mRNA and protein expression (Figure 4A,C; Supplementary Figure S1C,D). These results were further validated by overexpression of IER5 in HM-1 cells, whereupon mRNA levels of these HSPs (Hspa1a, Dnajb1, and Hspb2) were increased significantly (Figure 4E,F). These results collectively indicate that IER5 induces the transcription of HSPs.

3.5. IER5 Activates HSF1 via Dephosphorylation and Upregulates Its Target Genes in OC Cells

IER5 is known to generate a hypo-phosphorylated active form of HSF1 in various cancer cells [14], distinct from the canonical hyper-phosphorylated active form [7]. We analyzed the effect of Ier5 knockdown on HSF1 phosphorylation in HM-1 cells by western blotting, and observed that the HSF1 band was shifted upwards (Figure 5A). This indicates that Ier5 knockdown abrogated HSF1 dephosphorylation. Next, to confirm whether IER5 mediates its tumorigenic effects via HSF1, we knocked down Hsf1 in HM-1 cells and examined cell proliferation and HSP levels. HM-1 cell proliferation was quantified by CellTiter-Glo Luminescent Kit (Promega) under adherent and suspension conditions. Hsf1 knockdown was confirmed by RT-PCR and western blotting (Figure 5C,D). Hsf1 knockdown suppressed the proliferation of HM-1 cells when in suspension, and less efficiently when adherent (Figure 5B). Further, expression of HSPs (Hspa1a, Hspa1b, and Dnajb1) was decreased similar to that caused by Ier5 knockdown (Figure 5E). These results collectively suggest that IER5 is required for HSF1 activation and induction of HSPs in OC cells.

4. Discussion

IER5 and its family members IER5L and IER2 have been reported to be overexpressed in many cancers including ovarian, hepatic, lung, and gastric cancers [14,18,19,20,21]. IER5 expression is associated with poor prognosis in glioma, bladder, and breast cancer patients [14,16]. IER5L has been shown to be a prognostic marker for non-small cell lung cancer, with higher IER5L expression seen in patients with relapse versus no relapse [18]. Further, IER5L depletion has been shown to reduce the growth, migration, and invasiveness of prostate cancer cells, indicating its importance for prostate cancer progression [19]. Similarly, IER2 has also been shown to promote invasion and metastasis in melanoma and colorectal cancer [20,21]. We now have shown that amplification and higher expression of the IER5 family genes are associated with poorer prognosis of ovarian cancer patients. Furthermore, analysis of data from an ovarian cancer mouse model seeded by OSE or FTE showed that higher expression of Ier5 is observed in ovarian cancer cells of OSE origin, whereas higher expression of Ier5l and Ier2 is observed in those derived from FTE. We also observed high expression of Ier5 gene expression in mouse ovarian cancer cells derived from OSE (MOV, ID8G, and HM-1 cells). We also reported a two-fold higher expression of Ier5 in metastatic tumor cells (ID8-Om2 cells) compared to original tumor cells (ID8G), suggesting a role for IER5 in metastasis. Further, using siRNA knockdown we have shown that IER5 is required for the proliferation and growth of ovarian cancer (HM-1 and MOV) cells.
Previously, we and others have reported that IER5 induces the transcription of multiple HSPs in response to various stresses including heat shock [14,28,29]. We also observed downregulation of key HSPs including Hspa1a, Hspa1b, and Dnajb1 upon Ier5 knockdown in HM-1 and MOV ovarian cancer cells. These results are consistent with our results showing that IER5 overexpression resulted in increased expression of key HSPs in HM-1 cells. This activation of HSPs was driven by HSF1, which is activated via IER5-mediated dephosphorylation. In addition to IER5, IER2 has also been shown to interact with PP2A, which dephosphorylates and activates HSF1 [17]. Finally, we showed that this IER5-HSF1-HSP axis is vital for cancer cell growth: Hsf1 knockdown resulted in reduced ovarian cancer cell (HM-1) proliferation and as well as decreased HSP expression, indicating that IER5 regulates HSPs via HSF1. To summarize, the IER5-HSF1-HSP axis is vital for ovarian cancer cell proliferation and metastasis.

5. Conclusions

Ovarian cancer, one of the most lethal gynecological cancers, is often treated with a combination of surgery and chemotherapy using platinum compounds. Recently, PARP inhibitors have also shown promising results in ovarian cancer patients. However, these results are short-lived, and the cancer typically reoccurs [30]. As HSF1 is a master transcription factor regulating genes involved in protecting cells against proteotoxic stress, it also controls various genes related to cancer cell survival. HSF1 drives a transcriptional program in cancer cells that is different from the canonical heat shock response [31]. Some of the genes upregulated by HSF1 in cancer cells protect the cancer cells against the toxic effects of the therapeutic drugs, which can lead to drug resistance [32]. Our results support the idea that the IER5–HSF1 axis promotes ovarian cancer cell survival as well as tumor progression. Further, since other IER5 family genes (IER2 and IER5L) have also been reported to regulate HSF1 activity, this family of genes may collectively be involved in the progression of ovarian cancer via the HSF1 pathway. However, further studies including animal studies are warranted to further elucidate their roles in cancer.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/cancers17040610/s1, Supplementary Figure S1: Ier5 knockdown reduces cell numbers. (A,B) Relative number of ID8G (A) and ID8G-Om2 (B) cells 72 h post-siRNA (Ier5) transfection. (C,D) Protein expression of IER5 in HM-1 (C) and MOV (D) cells treated with siIer5. Error bars represent mean ± SD (n = 3) and the ‘p’ values were calculated using ‘t’ test method. *** p < 0.0001, ** p < 0.005, and * p < 0.05. Relative densities of protein bands (except for actin) are numbered below the bands in the western blots.

Author Contributions

R.O., S.U. and Y.A. designed the research; J.K., S.U., M.N., Y.T., T.Y., Y.A. and R.O. performed experiments; J.K., S.U., M.N. and R.O. analyzed data; T.T., H.S., T.K. and R.O. supervised the study; J.K. and M.N. wrote the manuscript; R.O. edited the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This study was partly supported by a Grant-in-Aid for Scientific Research (B, #20H03523 and C, #20K07605 to R.O., C, #20K07605 to Y.T.) from MEXT of Japan, P-Direct and P-Create from AMED of Japan (R.O.), and research grants of the Life Science Foundation of Japan (R.O.). J.K. was supported by Takeda Science Foundation.

Institutional Review Board Statement

All animal experimental protocols were approved by the Keio University Ethics Committee for Animal Experiments (#14031, 2014/07/08).

Informed Consent Statement

Not applicable.

Data Availability Statement

All study data are included in the article. For further details, the corresponding author can be contacted.

Acknowledgments

We thank Marc Lamphier for his critical reading of the manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Coburn, S.B.; Bray, F.; Sherman, M.E.; Trabert, B. International patterns and trends in ovarian cancer incidence, overall and by histologic subtype. Int. J. Cancer 2017, 140, 2451–2460. [Google Scholar] [CrossRef] [PubMed]
  2. Höhn, A.K.; Brambs, C.E.; Hiller, G.G.R.; May, D.; Schmoeckel, E.; Horn, L.-C. 2020 WHO Classification of Female Genital Tumors. Geburtshilfe Und Frauenheilkd. 2021, 81, 1145–1153. [Google Scholar] [CrossRef]
  3. Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef]
  4. Shimada, M.; Yoshihara, K.; Tanigawa, T.; Nomura, H.; Hamanishi, J.; Fujiwara, S.; Tanabe, H.; Kajiyama, H.; Mandai, M.; Aoki, D.; et al. An attempt to establish real-world databases of poly(ADP-ribose) polymerase inhibitors for advanced or recurrent epithelial ovarian cancer: The Japanese Gynecologic Oncology Group. J. Gynecol. Oncol. 2023, 34, e62. [Google Scholar] [CrossRef] [PubMed]
  5. Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2019. CA Cancer J. Clin. 2019, 69, 7–34. [Google Scholar] [CrossRef] [PubMed]
  6. Spagnol, G.; Sensi, F.; De Tommasi, O.; Marchetti, M.; Bonaldo, G.; Xhindoli, L.; Noventa, M.; Agostini, M.; Tozzi, R.; Saccardi, C. Patient Derived Organoids (PDOs), Extracellular Matrix (ECM), Tumor Microenvironment (TME) and Drug Screening: State of the Art and Clinical Implications of Ovarian Cancer Organoids in the Era of Precision Medicine. Cancers 2023, 15, 2059. [Google Scholar] [CrossRef] [PubMed]
  7. Dai, C.; Sampson, S.B. HSF1: Guardian of Proteostasis in Cancer. Trends Cell Biol. 2016, 26, 17–28. [Google Scholar] [CrossRef] [PubMed]
  8. Carpenter, R.L.; Gökmen-Polar, Y. HSF1 as a Cancer Biomarker and Therapeutic Target. Curr. Cancer Drug Targets 2019, 19, 515–524. [Google Scholar] [CrossRef]
  9. Cyran, A.M.; Zhitkovich, A. Heat Shock Proteins and HSF1 in Cancer. Front. Oncol. 2022, 12, 860320. [Google Scholar] [CrossRef]
  10. Wang, G.; Cao, P.; Fan, Y.; Tan, K. Emerging roles of HSF1 in cancer: Cellular and molecular episodes. Biochim. Biophys. Acta (BBA) Rev. Cancer 2020, 1874, 188390. [Google Scholar] [CrossRef]
  11. Dai, C. The heat-shock, or HSF1-mediated proteotoxic stress, response in cancer: From proteomic stability to oncogenesis. Philos. Trans. R. Soc. B Biol. Sci. 2018, 373, 20160525. [Google Scholar] [CrossRef] [PubMed]
  12. Powell, C.D.; Paullin, T.R.; Aoisa, C.; Menzie, C.J.; Ubaldini, A.; Westerheide, S.D. The Heat Shock Transcription Factor HSF1 Induces Ovarian Cancer Epithelial-Mesenchymal Transition in a 3D Spheroid Growth Model. PLoS ONE 2016, 11, e0168389. [Google Scholar] [CrossRef] [PubMed]
  13. Chen, Y.-F.; Wang, S.-Y.; Yang, Y.-H.; Zheng, J.; Liu, T.; Wang, L. Targeting HSF1 leads to an antitumor effect in human epithelial ovarian cancer. Int. J. Mol. Med. 2017, 39, 1564–1570. [Google Scholar] [CrossRef] [PubMed]
  14. Asano, Y.; Kawase, T.; Okabe, A.; Tsutsumi, S.; Ichikawa, H.; Tatebe, S.; Kitabayashi, I.; Tashiro, F.; Namiki, H.; Kondo, T.; et al. IER5 generates a novel hypo-phosphorylated active form of HSF1 and contributes to tumorigenesis. Sci. Rep. 2016, 6, 19174. [Google Scholar] [CrossRef]
  15. Yamano, S.; Kimura, M.; Chen, Y.; Imamoto, N.; Ohki, R. Nuclear import of IER5 is mediated by a classical bipartite nuclear localization signal and is required for HSF1 full activation. Exp. Cell Res. 2020, 386, 111686. [Google Scholar] [CrossRef] [PubMed]
  16. Wu, Z.; Wang, D.; Zeng, F.; Zhang, Y.; Zhu, G.; Ma, Y.; Song, B.; Lui, S.; Wu, M. High IER5 Gene Expression Is Associated with Poor Prognosis in Glioma Patients. Front. Cell Dev. Biol. 2021, 9, 679684. [Google Scholar] [CrossRef]
  17. Ueno, S.; Sudo, T.; Saya, H.; Sugihara, E. Pigment epithelium-derived factor promotes peritoneal dissemination of ovarian cancer through induction of immunosuppressive macrophages. Commun. Biol. 2022, 5, 904. [Google Scholar] [CrossRef]
  18. Doi, K.; Takeuchi, H.; Sakurai, H. PP2A-B55 and its adapter proteins IER2 and IER5 regulate the activity of RB family proteins and the expression of cell cycle-related genes. FEBS J. 2023, 290, 745–762. [Google Scholar] [CrossRef] [PubMed]
  19. Chen, X.; He, Y.-Q.; Miao, T.-W.; Yin, J.; Liu, J.; Zeng, H.-P.; Zhu, Q. IER5L is a Prognostic Biomarker in Pan-Cancer Analysis and Correlates with Immune Infiltration and Immune Molecules in Non-Small Cell Lung Cancer. Int. J. Gen. Med. 2023, 16, 5889–5908. [Google Scholar] [CrossRef] [PubMed]
  20. Crespo, J.R.; Martín-Martín, N.; Garcia-Longarte, S.; Corres-Mendizabal, J.; Carlevaris, O.; Astobiza, I.; Zabala-Letona, A.; Guiu, M.; Azkargorta, M.; Gonzalez-Lopez, M.; et al. The PP2A regulator IER5L supports prostate cancer progression. Cell Death Dis. 2024, 15, 514. [Google Scholar] [CrossRef] [PubMed]
  21. Kyjacova, L.; Saup, R.; Rönsch, K.; Wallbaum, S.; Dukowic-Schulze, S.; Foss, A.; Scherer, S.D.; Rothley, M.; Neeb, A.; Grau, N.; et al. IER2-induced senescence drives melanoma invasion through osteopontin. Oncogene 2021, 40, 6494–6512. [Google Scholar] [CrossRef] [PubMed]
  22. Neeb, A.; Wallbaum, S.; Novac, N.; Dukovic-Schulze, S.; Scholl, I.; Schreiber, C.; Schlag, P.; Moll, J.; Stein, U.; Sleeman, J.P. The immediate early gene Ier2 promotes tumor cell motility and metastasis, and predicts poor survival of colorectal cancer patients. Oncogene 2012, 31, 3796–3806. [Google Scholar] [CrossRef] [PubMed]
  23. Ueda, T.; Kohama, Y.; Sakurai, H. IER family proteins are regulators of protein phosphatase PP2A and modulate the phosphorylation status of CDC25A. Cell. Signal. 2019, 55, 81–89. [Google Scholar] [CrossRef] [PubMed]
  24. Zhang, S.; Dolgalev, I.; Zhang, T.; Ran, H.; Levine, D.A.; Neel, B.G. Both fallopian tube and ovarian surface epithelium are cells-of-origin for high-grade serous ovarian carcinoma. Nat. Commun. 2019, 10, 5367. [Google Scholar] [CrossRef]
  25. Motohara, T.; Masuko, S.; Ishimoto, T.; Yae, T.; Onishi, N.; Muraguchi, T.; Hirao, A.; Matsuzaki, Y.; Tashiro, H.; Katabuchi, H.; et al. Transient depletion of p53 followed by transduction of c-Myc and K-Ras converts ovarian stem-like cells into tumor-initiating cells. Carcinogenesis 2011, 32, 1597–1606. [Google Scholar] [CrossRef]
  26. Roby, K.F.; Taylor, C.C.; Sweetwood, J.P.; Cheng, Y.; Pace, J.L.; Tawfik, O.; Persons, D.L.; Smith, P.G.; Terranova, P.F. Development of a syngeneic mouse model for events related to ovarian cancer. Carcinogenesis 2000, 21, 585–591. [Google Scholar] [CrossRef] [PubMed]
  27. Hashimoto, M.; Niwa, O.; Nitta, Y.; Takeichi, M.; Yokoro, K. Unstable expression of E-cadherin adhesion molecules in metastatic ovarian tumor cells. Jpn. J. Cancer Res. 1989, 80, 459–463. [Google Scholar] [CrossRef] [PubMed]
  28. Ishikawa, Y.; Sakurai, H. Heat-induced expression of the immediate-early gene IER5 and its involvement in the proliferation of heat-shocked cells. FEBS J. 2015, 282, 332–340. [Google Scholar] [CrossRef] [PubMed]
  29. Kawabata, S.; Ishita, Y.; Ishikawa, Y.; Sakurai, H. Immediate-early response 5 (IER5) interacts with protein phosphatase 2A and regulates the phosphorylation of ribosomal protein S6 kinase and heat shock factor 1. FEBS Lett. 2015, 589, 3679–3685. [Google Scholar] [CrossRef]
  30. Kobayashi, Y.; Shimada, M.; Tamate, M.; Cho, H.W.; Zhu, J.; Chou, H.-H.; Kajiyama, H.; Okamoto, A.; Aoki, D.; Kang, S.; et al. Current treatment strategies for ovarian cancer in the East Asian Gynecologic Oncology Trial Group (EAGOT). J. Gynecol. Oncol. 2024, 35, e87. [Google Scholar] [CrossRef] [PubMed]
  31. Mendillo, M.L.; Santagata, S.; Koeva, M.; Bell, G.W.; Hu, R.; Tamimi, R.M.; Fraenkel, E.; Ince, T.A.; Whitesell, L.; Lindquist, S. HSF1 drives a transcriptional program distinct from heat shock to support highly malignant human cancers. Cell 2012, 150, 549–562. [Google Scholar] [CrossRef] [PubMed]
  32. Krishnaraj, J.; Yamamoto, T.; Ohki, R. p53-Dependent Cytoprotective Mechanisms behind Resistance to Chemo-Radiotherapeutic Agents Used in Cancer Treatment. Cancers 2023, 15, 3399. [Google Scholar] [CrossRef] [PubMed]
Figure 1. IERs are altered in ovarian cancer and impact patient survival. (A) Genetic alterations including gene amplification and high/low mRNA expression of IER5, IER5L, and IER2 in human ovarian cancers (http://cbioportal.org). “Amplification” refers to high-level amplification (more than 8 copies), while “high mRNA expression” is defined as expression greater than 2 standard deviations above the mean. (B) Patient overall survival in the IER5-altered and unaltered groups. Logrank test was used to determine the ‘p’ value (http://cbioportal.org). (C,D) Expression of HSPA1A (C) and HSPA1B (D) mRNA in human ovarian cancer analyzed in (A). The expression levels of HSPA1A and HSPA1B were compared between samples with high IER5 family gene expression (top 50 samples with high IER5, IER5L, or IER2 expression) and those with low IER5 family gene expression (bottom 50 samples with low IER5, IER5L, or IER2 expression, excluding the samples included in the top 50). (E,F) Expression of Ier5, Ier5L, and Ier2 mRNA in mouse ovarian cancer samples derived from ovarian surface epithelium (E) and fallopian tube epithelium (F) are shown. The expression of Ier5, Ier5l, and Ier2 were analyzed by using the data published by Zhang et al. [24]. ** p < 0.01, *** p < 0.0001.
Figure 1. IERs are altered in ovarian cancer and impact patient survival. (A) Genetic alterations including gene amplification and high/low mRNA expression of IER5, IER5L, and IER2 in human ovarian cancers (http://cbioportal.org). “Amplification” refers to high-level amplification (more than 8 copies), while “high mRNA expression” is defined as expression greater than 2 standard deviations above the mean. (B) Patient overall survival in the IER5-altered and unaltered groups. Logrank test was used to determine the ‘p’ value (http://cbioportal.org). (C,D) Expression of HSPA1A (C) and HSPA1B (D) mRNA in human ovarian cancer analyzed in (A). The expression levels of HSPA1A and HSPA1B were compared between samples with high IER5 family gene expression (top 50 samples with high IER5, IER5L, or IER2 expression) and those with low IER5 family gene expression (bottom 50 samples with low IER5, IER5L, or IER2 expression, excluding the samples included in the top 50). (E,F) Expression of Ier5, Ier5L, and Ier2 mRNA in mouse ovarian cancer samples derived from ovarian surface epithelium (E) and fallopian tube epithelium (F) are shown. The expression of Ier5, Ier5l, and Ier2 were analyzed by using the data published by Zhang et al. [24]. ** p < 0.01, *** p < 0.0001.
Cancers 17 00610 g001
Figure 2. Ier5 is highly expressed in ovarian cancer. (A) List of cell lines used in this study. (B) Relative expression of Ier5 mRNA in p53-def MOSE, T-Ag-MOSE, MOV, ID8G, and HM-1 cells analyzed by RT-PCR. In the right panel, cumulative values of Ier5 expression in normal ovarian cells (p53-def MOSE, T-Ag-MOSE) and cancerous ovarian cells (MOV, ID8G, and HM-1) were compared. (C) Relative expression of Ier5 mRNA in ID8G and ID8-Om2 cells analyzed by RT-PCR. (D) Relative expression of Ier5 mRNA in ID8G cells cultured in vitro and ID8G cells from ascites collected from mice (n = 4) analyzed by RT-PCR. Data are means ± SD of three replicates for representative experiments. Error bars represent mean ± SD (n = 3) and the ‘p’ values were calculated using ‘t’ test method. *** p < 0.0001, ** p < 0.01, and * p < 0.05.
Figure 2. Ier5 is highly expressed in ovarian cancer. (A) List of cell lines used in this study. (B) Relative expression of Ier5 mRNA in p53-def MOSE, T-Ag-MOSE, MOV, ID8G, and HM-1 cells analyzed by RT-PCR. In the right panel, cumulative values of Ier5 expression in normal ovarian cells (p53-def MOSE, T-Ag-MOSE) and cancerous ovarian cells (MOV, ID8G, and HM-1) were compared. (C) Relative expression of Ier5 mRNA in ID8G and ID8-Om2 cells analyzed by RT-PCR. (D) Relative expression of Ier5 mRNA in ID8G cells cultured in vitro and ID8G cells from ascites collected from mice (n = 4) analyzed by RT-PCR. Data are means ± SD of three replicates for representative experiments. Error bars represent mean ± SD (n = 3) and the ‘p’ values were calculated using ‘t’ test method. *** p < 0.0001, ** p < 0.01, and * p < 0.05.
Cancers 17 00610 g002
Figure 3. IER5 promotes ovarian cancer cell growth. (A,B) Relative numbers of HM-1 (A) and MOV cells (B) 48 h post-siRNA transfection in adherent cultures. Ier5-targeting or control siRNA was introduced into cells. (C,D) Relative mRNA expression of Ier5 in HM-1 (C) and MOV (D) cells analyzed by RT-PCR. (E,F) Cell proliferation assay under adherent (left) or suspension (right) conditions of HM-1 (C) and MOV cells (D) 48 h post-siRNA transfection. Error bars represent mean ± SD (n = 3) and the ‘p’ values were calculated using ‘t’ test method. *** p < 0.0001, ** p < 0.01, and * p < 0.05.
Figure 3. IER5 promotes ovarian cancer cell growth. (A,B) Relative numbers of HM-1 (A) and MOV cells (B) 48 h post-siRNA transfection in adherent cultures. Ier5-targeting or control siRNA was introduced into cells. (C,D) Relative mRNA expression of Ier5 in HM-1 (C) and MOV (D) cells analyzed by RT-PCR. (E,F) Cell proliferation assay under adherent (left) or suspension (right) conditions of HM-1 (C) and MOV cells (D) 48 h post-siRNA transfection. Error bars represent mean ± SD (n = 3) and the ‘p’ values were calculated using ‘t’ test method. *** p < 0.0001, ** p < 0.01, and * p < 0.05.
Cancers 17 00610 g003
Figure 4. IER5 induces the transcription of HSPs. (A,B) HM-1 cells were transfected with Ier5-targeting or control siRNA and collected 45 h later. Relative mRNA expression of Ier5 (A), Hspa1a, Hspa1b, and Dnajb1 (B) analyzed by RT-PCR. (C,D) MOV cells were transfected with Ier5-targeting or control siRNA and collected 45 h later. Relative mRNA expression of Ier5 (C), Hspa1a, Hspa1b, and Dnajb1 (D) analyzed by RT-PCR. (E,F) HM-1 cells were transfected with vector or IER5-Flag plasmids and harvested 48 h later. Overexpression efficiency of IER5-Flag was analyzed by western blotting (E) with an anti-DDDDK antibody. Relative mRNA expression (F) of Hspa1a, Dnajb1, and Hspb2 analyzed by RT-PCR. Error bars represent mean ± SD (n = 3) and the ‘p’ values were calculated using the ‘t’ test method. *** p < 0.0001, ** p < 0.01, and * p < 0.05. Relative densities of protein bands (except for actin) are numbered below the bands in western blotting.
Figure 4. IER5 induces the transcription of HSPs. (A,B) HM-1 cells were transfected with Ier5-targeting or control siRNA and collected 45 h later. Relative mRNA expression of Ier5 (A), Hspa1a, Hspa1b, and Dnajb1 (B) analyzed by RT-PCR. (C,D) MOV cells were transfected with Ier5-targeting or control siRNA and collected 45 h later. Relative mRNA expression of Ier5 (C), Hspa1a, Hspa1b, and Dnajb1 (D) analyzed by RT-PCR. (E,F) HM-1 cells were transfected with vector or IER5-Flag plasmids and harvested 48 h later. Overexpression efficiency of IER5-Flag was analyzed by western blotting (E) with an anti-DDDDK antibody. Relative mRNA expression (F) of Hspa1a, Dnajb1, and Hspb2 analyzed by RT-PCR. Error bars represent mean ± SD (n = 3) and the ‘p’ values were calculated using the ‘t’ test method. *** p < 0.0001, ** p < 0.01, and * p < 0.05. Relative densities of protein bands (except for actin) are numbered below the bands in western blotting.
Cancers 17 00610 g004
Figure 5. The IER5-HSF1-HS-P axis is important for ovarian cancer survival and growth. (A) HM-1 cells (adherent) were transfected with Ier5-targeting or control siRNA and collected 68 h later. Expression of HSF1 and IER5 proteins were analyzed by western blotting using anti-HSF1 and anti-IER5 antibodies. (B) HM-1 cell proliferation assay under adherent (left) or suspension (right) conditions for 45 h post-siRNA (siHsf1) transfection. (C,D) Relative mRNA (C) and protein (D) expression of HSF1 in HM-1 cells 45 h post-siRNA (siHsf1) transfection. (E) Relative mRNA expression of Hspa1a, Hspa1b, and Dnajb1 in HM-1 cells 45 h post-siRNA (siHsf1) transfection. Error bars represent mean ± SD (n = 3) and the ‘p’ values were calculated using ‘t’ test method. *** p < 0.0001, ** p < 0.01, and * p < 0.05. Relative densities of protein bands (except for actin) are numbered below the bands in western blotting.
Figure 5. The IER5-HSF1-HS-P axis is important for ovarian cancer survival and growth. (A) HM-1 cells (adherent) were transfected with Ier5-targeting or control siRNA and collected 68 h later. Expression of HSF1 and IER5 proteins were analyzed by western blotting using anti-HSF1 and anti-IER5 antibodies. (B) HM-1 cell proliferation assay under adherent (left) or suspension (right) conditions for 45 h post-siRNA (siHsf1) transfection. (C,D) Relative mRNA (C) and protein (D) expression of HSF1 in HM-1 cells 45 h post-siRNA (siHsf1) transfection. (E) Relative mRNA expression of Hspa1a, Hspa1b, and Dnajb1 in HM-1 cells 45 h post-siRNA (siHsf1) transfection. Error bars represent mean ± SD (n = 3) and the ‘p’ values were calculated using ‘t’ test method. *** p < 0.0001, ** p < 0.01, and * p < 0.05. Relative densities of protein bands (except for actin) are numbered below the bands in western blotting.
Cancers 17 00610 g005
Table 1. List of Primers Used in the Study.
Table 1. List of Primers Used in the Study.
PrimerSequence (5’-3’)
Mouse Ier5 forwardCCTTCGCTTCCAGACGATAG
Mouse Ier5 ReverseGCGTCACCAGGTCTTTTCTC
Mouse β-Actin forwardCGGTTCCGATGCCCTGAGGCTCTT
Mouse β-Actin reverseCGTCACACTTCATGATGGAATTGA
Mouse Hspa1b forwardCCAGTAGCCTGGGAAGACAT
Mouse Hspa1b reverse CAGTGCCAAGACGTTTGTTT
Mouse Ier5 ForwardCGGCTCTACCCCTCTCAAGA
Mouse Ier5 ReverseCCGAAGATGCTGATGAGGTTTG
Mouse Ier5 ProbeCCATCTCCTCGTCGGTGTCGTCCT
Mouse Hsf1 ForwardGCACACTCTGTGCCCAAGTATG
Mouse Hsf1 ReverseAGCTGGTGACAGCATCAGAGGA
Mouse β-Actin ForwardCGCGAGCACAGCTTCTTTG
Mouse β-Actin ReverseCATGCCGGAGCCGTTGTC
Mouse β-Actin ProbeCACACCCGCCACCAGTTCGCCATG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Krishnaraj, J.; Ueno, S.; Nakamura, M.; Tabata, Y.; Yamamoto, T.; Asano, Y.; Tanaka, T.; Kuzuyama, T.; Saya, H.; Ohki, R. IER5 Promotes Ovarian Cancer Cell Proliferation and Peritoneal Dissemination. Cancers 2025, 17, 610. https://doi.org/10.3390/cancers17040610

AMA Style

Krishnaraj J, Ueno S, Nakamura M, Tabata Y, Yamamoto T, Asano Y, Tanaka T, Kuzuyama T, Saya H, Ohki R. IER5 Promotes Ovarian Cancer Cell Proliferation and Peritoneal Dissemination. Cancers. 2025; 17(4):610. https://doi.org/10.3390/cancers17040610

Chicago/Turabian Style

Krishnaraj, Jayaraman, Sayaka Ueno, Moe Nakamura, Yuko Tabata, Tatsuki Yamamoto, Yoshinori Asano, Tomoaki Tanaka, Tomohisa Kuzuyama, Hideyuki Saya, and Rieko Ohki. 2025. "IER5 Promotes Ovarian Cancer Cell Proliferation and Peritoneal Dissemination" Cancers 17, no. 4: 610. https://doi.org/10.3390/cancers17040610

APA Style

Krishnaraj, J., Ueno, S., Nakamura, M., Tabata, Y., Yamamoto, T., Asano, Y., Tanaka, T., Kuzuyama, T., Saya, H., & Ohki, R. (2025). IER5 Promotes Ovarian Cancer Cell Proliferation and Peritoneal Dissemination. Cancers, 17(4), 610. https://doi.org/10.3390/cancers17040610

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop