Unlocking Drug Resistance in Multiple Myeloma: Adipocytes as Modulators of Treatment Response
Abstract
Simple Summary
Abstract
1. Introduction
2. Methods
2.1. Multiple Myeloma Cell Lines
2.2. Adipose-Derived Stem Cell Culture and Differentiation to Adipocytes
2.3. Adipocyte and MM Co-Culture
2.4. Cell Viability Assay
2.5. Protein Isolation/Western Blotting
2.6. Quantitative PCR
2.7. Endothelial Cell Tube Formation Assay
2.8. Zymography
2.9. Oil Red Staining
2.10. Statistical Analysis
3. Results
3.1. Adipocytes Increase Cell Proliferation and Resistance to Drug-Induced Decreases in Viability in MM
3.2. Adipocytes from Overweight and Obese Individuals Protect MM Cells from Drug-Induced Reductions in Survival Factors
3.3. Adipocytes Prevent Drug-Induced Reductions in P-Glycoprotein and MRP1 Transporter Levels in MM Cells
3.4. MM Cells Co-Cultured with Adipocytes from Overweight or Obese Individuals Develop an Increased Endothelial Cell Tube Network and Are More Resistant to the Effects of Drugs
3.5. MMP-2 Enzymatic Activity Is Significantly Higher in MM Cells Co-Cultured with Adipocytes
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Siegel, R.L.; Miller, K.D.; Wagle, N.S.; Jemal, A. Cancer statistics, 2023. CA Cancer J. Clin. 2023, 73, 17–48. [Google Scholar] [CrossRef] [PubMed]
- Rajkumar, S.V. Multiple myeloma: 2020 update on diagnosis, risk-stratification and management. Am. J. Hematol. 2020, 95, 548–567. [Google Scholar] [CrossRef] [PubMed]
- Durie, B.G.M.; Hoering, A.; Abidi, M.H.; Rajkumar, S.V.; Epstein, J.; Kahanic, S.P.; Thakuri, M.; Reu, F.; Reynolds, C.M.; Sexton, R.; et al. Bortezomib with lenalidomide and dexamethasone versus lenalidomide and dexamethasone alone in patients with newly diagnosed myeloma without intent for immediate autologous stem-cell transplant (SWOG S0777): A randomised, open-label, phase 3 trial. Lancet 2017, 389, 519–527. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Beydoun, M.A.; Min, J.; Xue, H.; Kaminsky, L.A.; Cheskin, L.J. Has the prevalence of overweight, obesity and central obesity levelled off in the United States? Trends, patterns, disparities, and future projections for the obesity epidemic. Int. J. Epidemiol. 2020, 49, 810–823. [Google Scholar] [CrossRef]
- Fryar, C.D.; Carroll, M.D.; Ogden, C.L. Prevalence of Overweight, Obesity, and Severe Obesity among Adults Aged 20 and Over: United States, 1960–1962 through 2017–2018; National Center for Health Statistics: Hyattsville, MD, USA, 2020. [Google Scholar]
- Lauby-Secretan, B.; Scoccianti, C.; Loomis, D.; Grosse, Y.; Bianchini, F.; Straif, K. Body Fatness and Cancer—Viewpoint of the IARC Working Group. N. Engl. J. Med. 2016, 375, 794–798. [Google Scholar] [CrossRef]
- Teras, L.R.; Kitahara, C.M.; Birmann, B.M.; Hartge, P.A.; Wang, S.S.; Robien, K.; Patel, A.V.; Adami, H.-O.; Weiderpass, E.; Giles, G.G.; et al. Body size and multiple myeloma mortality: A pooled analysis of 20 prospective studies. Br. J. Haematol. 2014, 166, 667–676. [Google Scholar] [CrossRef]
- Thordardottir, M.; Lindqvist, E.K.; Lund, S.H.; Costello, R.; Burton, D.; Korde, N.; Mailankody, S.; Eiriksdottir, G.; Launer, L.J.; Gudnason, V.; et al. Obesity and risk of monoclonal gammopathy of undetermined significance and progression to multiple myeloma: A population-based study. Blood Adv. 2017, 1, 2186–2192. [Google Scholar] [CrossRef]
- Wallin, A.; Larsson, S.C. Body mass index and risk of multiple myeloma: A meta-analysis of prospective studies. Eur. J. Cancer 2011, 47, 1606–1615. [Google Scholar] [CrossRef]
- van de Donk, N.; Pawlyn, C.; Yong, K.L. Multiple myeloma. Lancet 2021, 397, 410–427. [Google Scholar] [CrossRef]
- Méndez-Ferrer, S.; Bonnet, D.; Steensma, D.P.; Hasserjian, R.P.; Ghobrial, I.M.; Gribben, J.G.; Andreeff, M.; Krause, D.S. Bone marrow niches in haematological malignancies. Nat. Rev. Cancer 2020, 20, 285–298. [Google Scholar] [CrossRef] [PubMed]
- Krause, D.S.; Scadden, D.T. A hostel for the hostile: The bone marrow niche in hematologic neoplasms. Haematologica 2015, 100, 1376–1387. [Google Scholar] [CrossRef]
- Falank, C.; Fairfield, H.; Reagan, M.R. Signaling Interplay between Bone Marrow Adipose Tissue and Multiple Myeloma cells. Front. Endocrinol. 2016, 7, 67. [Google Scholar] [CrossRef]
- Hardouin, P.; Rharass, T.; Lucas, S. Bone Marrow Adipose Tissue: To Be or Not To Be a Typical Adipose Tissue? Front. Endocrinol. 2016, 7, 85. [Google Scholar] [CrossRef]
- Veldhuis-Vlug, A.G.; Rosen, C.J. Clinical implications of bone marrow adiposity. J. Intern. Med. 2017, 283, 121–139. [Google Scholar] [CrossRef]
- Attie, A.D.; Scherer, P.E. Adipocyte metabolism and obesity. J. Lipid Res. 2009, 50, S395–S399. [Google Scholar] [CrossRef] [PubMed]
- Bunnell, B.A.; Martin, E.C.; Matossian, M.D.; Brock, C.K.; Nguyen, K.; Collins-Burow, B.; Burow, M.E. The effect of obesity on adipose-derived stromal cells and adipose tissue and their impact on cancer. Cancer Metastasis Rev. 2022, 41, 549–573. [Google Scholar] [CrossRef]
- Bullwinkle, E.M.; Parker, M.D.; Bonan, N.F.; Falkenberg, L.G.; Davison, S.P.; DeCicco-Skinner, K.L. Adipocytes contribute to the growth and progression of multiple myeloma: Unraveling obesity related differences in adipocyte signaling. Cancer Lett. 2016, 380, 114–121. [Google Scholar] [CrossRef]
- Fairfield, H.; Dudakovic, A.; Khatib, C.M.; Farrell, M.; Costa, S.; Falank, C.; Hinge, M.; Murphy, C.S.; DeMambro, V.; Pettitt, J.A.; et al. Myeloma-Modified Adipocytes Exhibit Metabolic Dysfunction and a Senescence-Associated Secretory Phenotype. Cancer Res 2021, 81, 634–647. [Google Scholar] [CrossRef] [PubMed]
- Morris, E.V.; Suchacki, K.J.; Hocking, J.; Cartwright, R.; Sowman, A.; Gamez, B.; Lea, R.; Drake, M.T.; Cawthorn, W.P.; Edwards, C.M. Myeloma Cells Down-Regulate Adiponectin in Bone Marrow Adipocytes Via TNF-Alpha. J. Bone Miner. Res. 2020, 35, 942–955. [Google Scholar] [CrossRef] [PubMed]
- Trotter, T.N.; Gibson, J.T.; Sherpa, T.L.; Gowda, P.S.; Peker, D.; Yang, Y. Adipocyte-Lineage Cells Support Growth and Dissemination of Multiple Myeloma in Bone. Am. J. Pathol. 2016, 186, 3054–3063. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.K.; Rajkumar, S.V.; Dispenzieri, A.; Lacy, M.Q.; Hayman, S.R.; Buadi, F.K.; Zeldenrust, S.R.; Dingli, D.; Russell, S.J.; Lust, J.A.; et al. Improved survival in multiple myeloma and the impact of novel therapies. Blood 2008, 111, 2516–2520. [Google Scholar] [CrossRef] [PubMed]
- Kastritis, E.; Zervas, K.; Symeonidis, A.; Terpos, E.; Delimbassi, S.; Anagnostopoulos, N.; Michali, E.; Zomas, A.; Katodritou, E.; Gika, D.; et al. Improved survival of patients with multiple myeloma after the introduction of novel agents and the applicability of the International Staging System (ISS): An analysis of the Greek Myeloma Study Group (GMSG). Leukemia 2009, 23, 1152–1157. [Google Scholar] [CrossRef]
- Bobin, A.; Liuu, E.; Moya, N.; Gruchet, C.; Sabirou, F.; Lévy, A.; Gardeney, H.; Nsiala, L.; Cailly, L.; Guidez, S.; et al. Multiple Myeloma: An Overview of the Current and Novel Therapeutic Approaches in 2020. Cancers 2020, 12, 2885. [Google Scholar] [CrossRef] [PubMed]
- Abdi, J.; Chen, G.; Chang, H. Drug resistance in multiple myeloma: Latest findings and new concepts on molecular mechanisms. Oncotarget 2013, 4, 2186–2207. [Google Scholar] [CrossRef] [PubMed]
- Pinto, V.; Bergantim, R.; Caires, H.R.; Seca, H.; Guimarães, J.E.; Vasconcelos, M.H. Multiple Myeloma: Available Therapies and Causes of Drug Resistance. Cancers 2020, 12, 407. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.K.; Lee, J.H.; Lahuerta, J.J.; Morgan, G.; Richardson, P.G.; Crowley, J.; Haessler, J.; Feather, J.; Hoering, A.; Moreau, P.; et al. Risk of progression and survival in multiple myeloma relapsing after therapy with IMiDs and bortezomib: A multicenter international myeloma working group study. Leukemia 2012, 26, 149–157. [Google Scholar] [CrossRef]
- Solimando, A.G.; Malerba, E.; Leone, P.; Prete, M.; Terragna, C.; Cavo, M.; Racanelli, V. Drug resistance in multiple myeloma: Soldiers and weapons in the bone marrow niche. Front. Oncol. 2022, 12, 973836. [Google Scholar] [CrossRef] [PubMed]
- Yang, W.C.; Lin, S.F. Mechanisms of Drug Resistance in Relapse and Refractory Multiple Myeloma. BioMed Res. Int. 2015, 2015, 341430. [Google Scholar] [CrossRef] [PubMed]
- Sodani, K.; Patel, A.; Kathawala, R.J.; Chen, Z.-S. Multidrug resistance associated proteins in multidrug resistance. Chin. J. Cancer 2012, 31, 58–72. [Google Scholar] [CrossRef] [PubMed]
- Damiano, J.S.; Cress, A.E.; Hazlehurst, L.A.; Shtil, A.A.; Dalton, W.S. Cell adhesion mediated drug resistance (CAM-DR): Role of integrins and resistance to apoptosis in human myeloma cell lines. Blood 1999, 93, 1658–1667. [Google Scholar] [CrossRef] [PubMed]
- Landowski, T.H.; Olashaw, N.E.; Agrawal, D.; Dalton, W.S. Cell adhesion-mediated drug resistance (CAM-DR) is associated with activation of NF-kappa B (RelB/p50) in myeloma cells. Oncogene 2003, 22, 2417–2421. [Google Scholar] [CrossRef] [PubMed]
- Hazlehurst, L.A.; Damiano, J.S.; Buyuksal, I.; Pledger, W.J.; Dalton, W.S. Adhesion to fibronectin via beta1 integrins regulates p27kip1 levels and contributes to cell adhesion mediated drug resistance (CAM-DR). Oncogene 2000, 19, 4319–4327. [Google Scholar] [CrossRef]
- Dalton, W.S.; Grogan, T.M.; Rybski, J.A.; Scheper, R.J.; Richter, L.; Kailey, J.; Broxterman, H.J.; Pinedo, H.M.; Salmon, S.E. Immunohistochemical detection and quantitation of P-glycoprotein in multiple drug-resistant human myeloma cells: Association with level of drug resistance and drug accumulation. Blood 1989, 73, 747–752. [Google Scholar] [CrossRef] [PubMed]
- Abraham, J.; Salama, N.N.; Azab, A.K. The role of P-glycoprotein in drug resistance in multiple myeloma. Leuk. Lymphoma 2015, 56, 26–33. [Google Scholar] [CrossRef] [PubMed]
- Grogan, T.M.; Spier, C.M.; Salmon, S.E.; Matzner, M.; Rybski, J.; Weinstein, R.S.; Scheper, R.J.; Dalton, W.S. P-glycoprotein expression in human plasma cell myeloma: Correlation with prior chemotherapy. Blood 1993, 81, 490–495. [Google Scholar] [CrossRef] [PubMed]
- Linsenmeyer, M.E.; Jefferson, S.; Wolf, M.; Matthews, J.P.; Board, P.G.; Woodcock, D.M. Levels of expression of the mdr1 gene and glutathione S-transferase genes 2 and 3 and response to chemotherapy in multiple myeloma. Br. J. Cancer 1992, 65, 471–475. [Google Scholar] [CrossRef][Green Version]
- DeCicco-Skinner, K.L.; Henry, G.H.; Cataisson, C.; Tabib, T.; Gwilliam, J.C.; Watson, N.J.; Bullwinkle, E.M.; Falkenburg, L.; O’Neill, R.C.; Morin, A.; et al. Endothelial cell tube formation assay for the in vitro study of angiogenesis. J. Vis. Exp. JoVE 2014, 91, e51312. [Google Scholar] [CrossRef]
- Kelley, M.; Fierstein, S.; Purkey, L.; DeCicco-Skinner, K. Endothelial Cell Tube Formation Assay: An In Vitro Model for Angiogenesis. Methods Mol. Biol. 2022, 2475, 187–196. [Google Scholar] [CrossRef]
- Demchenko, Y.N.; Kuehl, W.M. A critical role for the NFkB pathway in multiple myeloma. Oncotarget 2010, 1, 59–68. [Google Scholar] [CrossRef]
- Morales-Martínez, M.; Vega, M.I. Roles and Regulation of BCL-xL in Hematological Malignancies. Int. J. Mol. Sci. 2022, 23, 2193. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L. Caspase-8: Friend or Foe in Bortezomib/Lenalidomide-Based Therapy for Myeloma. Front. Oncol. 2022, 12, 861709. [Google Scholar] [CrossRef] [PubMed]
- Jäger, R.; Zwacka, R.M. The Enigmatic Roles of Caspases in Tumor Development. Cancers 2010, 2, 1952–1979. [Google Scholar] [CrossRef]
- Avrutsky, M.I.; Troy, C.M. Caspase-9: A Multimodal Therapeutic Target With Diverse Cellular Expression in Human Disease. Front. Pharmacol. 2021, 12, 701301. [Google Scholar] [CrossRef]
- Vacca, A.; Ribatti, D.; Roccaro, A.M.; Frigeri, A.; Dammacco, F. Bone marrow angiogenesis in patients with active multiple myeloma. Semin. Oncol. 2001, 28, 543–550. [Google Scholar] [CrossRef] [PubMed]
- Itoh, T.; Tanioka, M.; Yoshida, H.; Yoshioka, T.; Nishimoto, H.; Itohara, S. Reduced angiogenesis and tumor progression in gelatinase A-deficient mice. Cancer Res. 1998, 58. [Google Scholar]
- Stetler-Stevenson, W.G. Matrix metalloproteinases in angiogenesis: A moving target for therapeutic intervention. J. Clin. Investig. 1999, 103, 1237–1241. [Google Scholar] [CrossRef] [PubMed]
- Neumeister, P.; Schulz, E.; Pansy, K.; Szmyra, M.; Deutsch, A.J. Targeting the Microenvironment for Treating Multiple Myeloma. Int. J. Mol. Sci. 2022, 23, 7627. [Google Scholar] [CrossRef]
- Panaroni, C.; Fulzele, K.; Mori, T.; Siu, K.T.; Onyewadume, C.; Maebius, A.; Raje, N. Multiple myeloma cells induce lipolysis in adipocytes and uptake fatty acids through fatty acid transporter proteins. Blood 2022, 139, 876–888. [Google Scholar] [CrossRef] [PubMed]
- Caers, J.; Deleu, S.; Belaid, Z.; De Raeve, H.; Van Valckenborgh, E.; De Bruyne, E.; DeFresne, M.-P.; Van Riet, I.; Van Camp, B.; Vanderkerken, K. Neighboring adipocytes participate in the bone marrow microenvironment of multiple myeloma cells. Leukemia 2007, 21, 1580–1584. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y. Adipocyte and lipid metabolism in cancer drug resistance. J. Clin. Investig. 2019, 129, 3006–3017. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Xu, J.; He, J.; Liu, H.; Lin, P.; Wan, X.; Navone, N.M.; Tong, Q.; Kwak, L.W.; Orlowski, R.Z.; et al. Mature adipocytes in bone marrow protect myeloma cells against chemotherapy through autophagy activation. Oncotarget 2015, 6, 34329–34341. [Google Scholar] [CrossRef]
- Wang, Z.; He, J.; Bach, D.-H.; Huang, Y.-H.; Li, Z.; Liu, H.; Lin, P.; Yang, J. Induction of m6A methylation in adipocyte exosomal LncRNAs mediates myeloma drug resistance. J. Exp. Clin. Cancer Res. 2022, 41, 1–18. [Google Scholar] [CrossRef] [PubMed]
- Uckun, F.M. Cancer drug resistance in multiple myeloma. Cancer Drug Resist. 2022, 5, 271–276. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Xiao, W.; Wang, L.; Tian, Z.; Zhang, J. Deactivation of Signal Transducer and Activator of Transcription 3 Reverses Chemotherapeutics Resistance of Leukemia Cells via Down-Regulating P-gp. PLoS ONE 2011, 6, e20965. [Google Scholar] [CrossRef]
- Liu, J.; Zhou, F.; Chen, Q.; Kang, A.; Lu, M.; Liu, W.; Zang, X.; Wang, G.; Zhang, J. Chronic inflammation up-regulates P-gp in peripheral mononuclear blood cells via the STAT3/Nf-κb pathway in 2,4,6-trinitrobenzene sulfonic acid-induced colitis mice. Sci. Rep. 2015, 5, 13558. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, R.; Ogiya, D.; Ogawa, Y.; Kawada, H.; Ando, K. Targeting CAM-DR and Mitochondrial Transfer for the Treatment of Multiple Myeloma. Curr. Oncol. 2022, 29, 8529–8539. [Google Scholar] [CrossRef]
- Huang, Y.; Wang, Y.; Tang, J.; Qin, S.; Shen, X.; He, S.; Ju, S. CAM-DR: Mechanisms, Roles and Clinical Application in Tumors. Front. Cell Dev. Biol. 2021, 9. [Google Scholar] [CrossRef]
- Annunziata, C.M.; Davis, R.E.; Demchenko, Y.; Bellamy, W.; Gabrea, A.; Zhan, F.; Lenz, G.; Hanamura, I.; Wright, G.; Xiao, W.; et al. Frequent engagement of the classical and alternative NF-kappaB pathways by diverse genetic abnormalities in multiple myeloma. Cancer Cell 2007, 12, 115–130. [Google Scholar] [CrossRef] [PubMed]
- Roy, P.; Sarkar, U.A.; Basak, S. The NF-κB Activating Pathways in Multiple Myeloma. Biomedicines 2018, 6, 59. [Google Scholar] [CrossRef] [PubMed]
- Boice, A.; Bouchier-Hayes, L. Targeting apoptotic caspases in cancer. Biochim. Biophys. Acta Mol. Cell Res. 2020, 1867, 118688. [Google Scholar] [CrossRef]
- Zhao, R.; Kaakati, R.; Lee, A.K.; Liu, X.; Li, F.; Li, C.-Y. Novel roles of apoptotic caspases in tumor repopulation, epigenetic reprogramming, carcinogenesis, and beyond. Cancer Metastasis Rev. 2018, 37, 227–236. [Google Scholar] [CrossRef] [PubMed]
- Chauhan, D.; Catley, L.; Li, G.; Podar, K.; Hideshima, T.; Velankar, M.; Mitsiades, C.; Mitsiades, N.; Yasui, H.; Letai, A.; et al. A novel orally active proteasome inhibitor induces apoptosis in multiple myeloma cells with mechanisms distinct from Bortezomib. Cancer Cell 2005, 8, 407–419. [Google Scholar] [CrossRef]
- Chauhan, D.; Singh, A.V.; Ciccarelli, B.; Richardson, P.G.; Palladino, M.A.; Anderson, K.C. Combination of novel proteasome inhibitor NPI-0052 and lenalidomide trigger in vitro and in vivo synergistic cytotoxicity in multiple myeloma. Blood 2010, 115, 834–845. [Google Scholar] [CrossRef]
- Fianco, G.; Mongiardi, M.P.; Levi, A.; De Luca, T.; Desideri, M.; Trisciuoglio, D.; Del Bufalo, D.; Cinà, I.; Di Benedetto, A.; Mottolese, M.; et al. Caspase-8 contributes to angiogenesis and chemotherapy resistance in glioblastoma. eLife 2017, 6, e22593. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.; Huang, X.; Niesvizky, R.; Pu, Z.; Xu, G. Caspase-8 Regulates the Antimyeloma Activity of Bortezomib and Lenalidomide. Experiment 2021, 379, 303–309. [Google Scholar] [CrossRef]
- Luk, C.T.; Shi, S.Y.; Krishnamurthy, M.; Schroer, S.A.; Woo, M. Caspase 8 Plays a Pivotal Role in Adipose Tissue Inflammatory Signalling and Glucose HomeostasisImage 9. Can. J. Diabetes 2016, 40, S59. [Google Scholar] [CrossRef]
- Asosingh, K.; De Raeve, H.; Menu, E.; Van Riet, I.; Van Marck, E.; Van Camp, B.; Vanderkerken, K. Angiogenic switch during 5T2MM murine myeloma tumorigenesis: Role of CD45 heterogeneity. Blood 2004, 103, 3131–3137. [Google Scholar] [CrossRef]
- Mark, C.; Warrick, J.; Callander, N.S.; Hematti, P.; Miyamoto, S. A Hyaluronan and Proteoglycan Link Protein 1 Matrikine: Role of Matrix Metalloproteinase 2 in Multiple Myeloma NF-κB Activation and Drug Resistance. Mol. Cancer Res. MCR 2022, 20, 1456–1466. [Google Scholar] [CrossRef] [PubMed]
- Xie, T.X.; Wei, D.; Liu, M.; Gao, A.C.; Ali-Osman, F.; Sawaya, R.; Huang, S. Stat3 activation regulates the expression of matrix metalloproteinase-2 and tumor invasion and metastasis. Oncogene 2004, 23, 3550–3560. [Google Scholar] [CrossRef]
ID Number | BMI (kg/m2) | Location | Gender | Age |
---|---|---|---|---|
L030702T | 18 | Thigh/Abdomen | Female | 26 |
L053001 | 20.45 | Abdomen | Female | 28 |
L092815A | 21 | Thigh/Abdomen | Female | 35 |
ASC100614B | 21.5 | Abdomen | Female | 34 |
ASC100610B | 23.3 | Abdomen | Female | 40 |
LM060710C | 24.5 | Abdomen | Female | 67 |
L012502 | 25.3 | Abdomen | Male | 40 |
L120116E | 26.5 | Abdomen | Female | 52 |
ASC102014A | 26.2 | Abdomen | Female | 48 |
SL0064 | 27.3 | Abdomen/Thigh/Neck/Flanks | Female | 50 |
SL0071 | 27.5 | Abdomen/Thigh/Hip/Flank | Female | 49 |
SL0065 | 27.6 | Thigh/Flanks/Hips/Abdomen | Female | 44 |
L071212 | 30.6 | Abdomen | Female | 35 |
L080218B | 31.9 | Abdomen | Female | 39 |
L062016A | 32.8 | Abdomen | Female | 45 |
ASC050709B | 34.8 | Abdomen/Hip | Female | 42 |
L051319B | 35.4 | Abdomen/Thigh/Hip | Female | 56 |
L072709 | 38 | Abdomen/Hip | Female | 39 |
L050718A | 44.5 | Abdomen | Male | 51 |
Oligo Name | Sequence (5′ to 3′) |
---|---|
Human ABCB1 Forward | TGCTCAGACAGGATGTGAGTTG |
Human ABCB1 Reverse | TTACAGCAAGCCTGGAACCTA |
Human ABCC1 Forward | TCTACCTCCTGTGGCTGAATCTG |
Human ABCC1 Reverse | CACCTGATACGTCTTGGTCTTCAT |
Human GADDH Forward | AAGGTGAAGGTCGGAGTCAA |
Human GAPDH Reverse | AATGAAGGGGTCATTGATGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ochiai, M.; Fierstein, S.; XsSali, F.; DeVito, N.; Purkey, L.R.; May, R.; Correa-Medina, A.; Kelley, M.; Page, T.D.; DeCicco-Skinner, K. Unlocking Drug Resistance in Multiple Myeloma: Adipocytes as Modulators of Treatment Response. Cancers 2023, 15, 4347. https://doi.org/10.3390/cancers15174347
Ochiai M, Fierstein S, XsSali F, DeVito N, Purkey LR, May R, Correa-Medina A, Kelley M, Page TD, DeCicco-Skinner K. Unlocking Drug Resistance in Multiple Myeloma: Adipocytes as Modulators of Treatment Response. Cancers. 2023; 15(17):4347. https://doi.org/10.3390/cancers15174347
Chicago/Turabian StyleOchiai, Maria, Sara Fierstein, Farouq XsSali, Nicholas DeVito, Laura R. Purkey, Rebecca May, Abraham Correa-Medina, Mary Kelley, Thomas D. Page, and Kathleen DeCicco-Skinner. 2023. "Unlocking Drug Resistance in Multiple Myeloma: Adipocytes as Modulators of Treatment Response" Cancers 15, no. 17: 4347. https://doi.org/10.3390/cancers15174347
APA StyleOchiai, M., Fierstein, S., XsSali, F., DeVito, N., Purkey, L. R., May, R., Correa-Medina, A., Kelley, M., Page, T. D., & DeCicco-Skinner, K. (2023). Unlocking Drug Resistance in Multiple Myeloma: Adipocytes as Modulators of Treatment Response. Cancers, 15(17), 4347. https://doi.org/10.3390/cancers15174347