Integrated Analysis of TME and Hypoxia Identifies a Classifier to Predict Prognosis and Therapeutic Biomarkers in Soft Tissue Sarcomas
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Date Source
2.2. Identification of Hypoxia Genes and TME Cells Associated with Prognosis
2.3. Establishment of Hypoxia-TME Prognostic Model
2.4. DEGs Analysis, Gene Set Enrichment Analysis, and Tumor SOMATIC mutation
2.5. Single-Cell Analysis and Chemotherapeutic Response Prediction
2.6. Cell Culture and Cell Lines
2.7. Quantitative Real-Time PCR
2.8. Statistical Analysis
3. Results
3.1. Identify Hypoxia and TME Differences between Tumor and Normal Tissues
3.2. Identify the Prognostic Value of Hypoxia and TME
3.3. Establishment of Hypoxia-TME Classifier
3.4. Mutation Analysis and Establishment of Hypoxia-TME Prognostic Model
3.5. Subgroups of Hypoxia-TME Display Distinct Immune Responses
3.6. Treatment Response Prediction with Hypoxia-TME
3.7. Differences in Gene Expression within Subgroups and the Identification of Key Genes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- D’angelo, S.; Tap, W.; Schwartz, G.; Carvajal, R. Sarcoma immunotherapy: Past approaches and future directions. Sarcoma 2014, 2014, 391967. [Google Scholar] [CrossRef] [PubMed]
- Sharma, S.; Takyar, S.; Manson, S.C.; Powell, S.; Penel, N. Efficacy and safety of pharmacological interventions in second-or later-line treatment of patients with advanced soft tissue sarcoma: A systematic review. BMC Cancer 2013, 13, 385. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Singer, S.; Demetri, G.D.; Baldini, E.H.; Fletcher, C.D. Management of soft-tissue sarcomas: An overview and update. Lancet Oncol. 2000, 1, 75–85. [Google Scholar] [CrossRef]
- Tap, W.D.; Jones, R.L.; Van Tine, B.A.; Chmielowski, B.; Elias, A.D.; Adkins, D.; Agulnik, M.; Cooney, M.M.; Livingston, M.B.; Pennock, G.; et al. Olaratumab and doxorubicin versus doxorubicin alone for treatment of soft-tissue sarcoma: An open-label phase 1b and randomised phase 2 trial. Lancet 2016, 388, 488–497. [Google Scholar] [CrossRef] [Green Version]
- Mathoulin-Pélissier, S.; Chevreau, C.; Bellera, C.; Bauvin, E.; Savès, M.; Grosclaude, P.; Albert, S.; Goddard, J.; Le Guellec, S.; Delannes, M.; et al. Adherence to consensus-based diagnosis and treatment guidelines in adult soft-tissue sarcoma patients: A French prospective population-based study. Ann. Oncol. 2014, 25, 225–231. [Google Scholar] [CrossRef]
- Ryan, C.; Schoffski, P.; Merimsky, O.; Agulnik, M.; Blay, J.; Schuetze, S.; Buck, J.; Garcia del Muro, X.; Judson, I.; Maki, R. PICASSO 3: A phase 3 international, randomized, double-blind, placebo-controlled study of doxorubicin (dox) plus palifosfamide (pali) vs. dox plus placebo for patients (pts) in first-line for metastatic soft tissue sarcoma (mSTS). Eur. J. Cancer 2013, 49, S876. [Google Scholar]
- Tsagozis, P.; Gonzalez-Molina, J.; Georgoudaki, A.M.; Lehti, K.; Carlson, J.; Lundqvist, A.; Haglund, F.; Ehnman, M. Sarcoma Tumor Microenvironment. Adv. Exp. Med. Biol. 2020, 1296, 319–348. [Google Scholar] [CrossRef]
- Mullinax, J.E.; Hall, M.; Beatty, M.; Weber, A.M.; Sannasardo, Z.; Svrdlin, T.; Hensel, J.; Bui, M.; Richards, A.; Gonzalez, R.J.; et al. Expanded Tumor-infiltrating Lymphocytes From Soft Tissue Sarcoma Have Tumor-specific Function. J. Immunother. 2021, 44, 63–70. [Google Scholar] [CrossRef]
- Morales, E.; Olson, M.; Iglesias, F.; Dahiya, S.; Luetkens, T.; Atanackovic, D. Role of immunotherapy in Ewing sarcoma. J. Immunother Cancer 2020, 8, e000653. [Google Scholar] [CrossRef]
- Sullivan, R.; Graham, C.H. Hypoxia-driven selection of the metastatic phenotype. Cancer Metastasis Rev. 2007, 26, 319–331. [Google Scholar] [CrossRef]
- Man, J.; Yu, X.; Huang, H.; Zhou, W.; Xiang, C.; Huang, H.; Miele, L.; Liu, Z.; Bebek, G.; Bao, S.; et al. Hypoxic Induction of Vasorin Regulates Notch1 Turnover to Maintain Glioma Stem-like Cells. Cell Stem Cell 2018, 22, 104–118.e106. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Ye, T.; Liu, H.; Lv, P.; Duan, C.; Wu, X.; Jiang, K.; Lu, H.; Xia, D.; Peng, E.; et al. Expression profiles, biological functions and clinical significance of circRNAs in bladder cancer. Mol. Cancer 2021, 20, 4. [Google Scholar] [CrossRef] [PubMed]
- Niu, Z.; Shi, Q.; Zhang, W.; Shu, Y.; Yang, N.; Chen, B.; Wang, Q.; Zhao, X.; Chen, J.; Cheng, N.; et al. Caspase-1 cleaves PPARγ for potentiating the pro-tumor action of TAMs. Nat. Commun. 2017, 8, 766. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brizel, D.M.; Scully, S.P.; Harrelson, J.M.; Layfield, L.J.; Bean, J.M.; Prosnitz, L.R.; Dewhirst, M.W. Tumor oxygenation predicts for the likelihood of distant metastases in human soft tissue sarcoma. Cancer Res. 1996, 56, 941–943. [Google Scholar]
- Wilson, W.R.; Hay, M.P. Targeting hypoxia in cancer therapy. Nat. Rev. Cancer 2011, 11, 393–410. [Google Scholar] [CrossRef] [PubMed]
- Liapis, V.; Labrinidis, A.; Zinonos, I.; Hay, S.; Ponomarev, V.; Panagopoulos, V.; DeNichilo, M.; Ingman, W.; Atkins, G.J.; Findlay, D.M. Hypoxia-activated pro-drug TH-302 exhibits potent tumor suppressive activity and cooperates with chemotherapy against osteosarcoma. Cancer Lett. 2015, 357, 160–169. [Google Scholar] [CrossRef] [Green Version]
- Lunt, S.; Cawthorne, C.; Ali, M.; Telfer, B.; Babur, M.; Smigova, A.; Julyan, P.J.; Price, P.M.; Stratford, I.; Bloomer, W. The hypoxia-selective cytotoxin NLCQ-1 (NSC 709257) controls metastatic disease when used as an adjuvant to radiotherapy. Br. J. Cancer 2010, 103, 201–208. [Google Scholar] [CrossRef] [Green Version]
- Petrova, V.; Annicchiarico-Petruzzelli, M.; Melino, G.; Amelio, I. The hypoxic tumour microenvironment. Oncogenesis 2018, 7, 10. [Google Scholar] [CrossRef] [Green Version]
- Tao, J.; Yang, G.; Zhou, W.; Qiu, J.; Chen, G.; Luo, W.; Zhao, F.; You, L.; Zheng, L.; Zhang, T.; et al. Targeting hypoxic tumor microenvironment in pancreatic cancer. J. Hematol. Oncol. 2021, 14, 14. [Google Scholar] [CrossRef]
- Xu, S.; Tang, L.; Liu, Z.; Luo, C.; Cheng, Q. Hypoxia-Related lncRNA Correlates With Prognosis and Immune Microenvironment in Lower-Grade Glioma. Front. Immunol. 2021, 12, 731048. [Google Scholar] [CrossRef]
- Bader, J.E.; Voss, K.; Rathmell, J.C. Targeting metabolism to improve the tumor microenvironment for cancer immunotherapy. Mol. Cell 2020, 78, 1019–1033. [Google Scholar] [CrossRef] [PubMed]
- Colegio, O.R.; Chu, N.-Q.; Szabo, A.L.; Chu, T.; Rhebergen, A.M.; Jairam, V.; Cyrus, N.; Brokowski, C.E.; Eisenbarth, S.C.; Phillips, G.M. Functional polarization of tumour-associated macrophages by tumour-derived lactic acid. Nature 2014, 513, 559–563. [Google Scholar] [CrossRef] [PubMed]
- Chiu, D.K.-C.; Tse, A.P.-W.; Xu, I.M.-J.; Di Cui, J.; Lai, R.K.-H.; Li, L.L.; Koh, H.-Y.; Tsang, F.H.-C.; Wei, L.L.; Wong, C.-M. Hypoxia inducible factor HIF-1 promotes myeloid-derived suppressor cells accumulation through ENTPD2/CD39L1 in hepatocellular carcinoma. Nat. Commun. 2017, 8, 517. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Clambey, E.T.; McNamee, E.N.; Westrich, J.A.; Glover, L.E.; Campbell, E.L.; Jedlicka, P.; De Zoeten, E.F.; Cambier, J.C.; Stenmark, K.R.; Colgan, S.P. Hypoxia-inducible factor-1 alpha–dependent induction of FoxP3 drives regulatory T-cell abundance and function during inflammatory hypoxia of the mucosa. Proc. Natl. Acad. Sci. USA 2012, 109, E2784–E2793. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pardoll, M.; Pan, F. Control of TH17/Treg Balance by Hypoxia-inducible Factor. Cell 2011, 146, 772–784. [Google Scholar]
- Sitkovsky, M.; Lukashev, D. Regulation of immune cells by local-tissue oxygen tension: HIF1α and adenosine receptors. Nat. Rev. Immunol. 2005, 5, 712–721. [Google Scholar] [CrossRef]
- Vito, A.; El-Sayes, N.; Mossman, K. Hypoxia-driven immune escape in the tumor microenvironment. Cells 2020, 9, 992. [Google Scholar] [CrossRef]
- Yang, K.; Yu, G.; Yang, Z.; Yue, L.; Zhang, X.; Sun, C.; Wei, J.; Rao, L.; Chen, X.; Wang, R. Supramolecular Polymerization-Induced Nanoassemblies for Self-Augmented Cascade Chemotherapy and Chemodynamic Therapy of Tumor. Angew. Chem. Int. Ed. Engl. 2021, 60, 17570–17578. [Google Scholar] [CrossRef]
- Yang, K.; Yu, G.; Tian, R.; Zhou, Z.; Deng, H.; Li, L.; Yang, Z.; Zhang, G.; Liu, D.; Wei, J.; et al. Oxygen-Evolving Manganese Ferrite Nanovesicles for Hypoxia-Responsive Drug Delivery and Enhanced Cancer Chemoimmunotherapy. Adv. Funct. Mater. 2021, 31, 2008078. [Google Scholar] [CrossRef]
- Sormendi, S.; Wielockx, B. Hypoxia Pathway Proteins As Central Mediators of Metabolism in the Tumor Cells and Their Microenvironment. Front. Immunol. 2018, 9, 40. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.; Zhao, L.; Li, X.F. Hypoxia and the Tumor Microenvironment. Technol. Cancer Res. Treat. 2021, 20, 15330338211036304. [Google Scholar] [CrossRef] [PubMed]
- Kumar, A.; Deep, G. Exosomes in hypoxia-induced remodeling of the tumor microenvironment. Cancer Lett. 2020, 488, 488. [Google Scholar] [CrossRef] [PubMed]
- Tumor hypoxia is a therapeutic target in soft-tissue sarcoma. Cancer Discov. 2014, 4, Of21. [CrossRef] [PubMed]
- Grünewald, T.G.; Alonso, M.; Avnet, S.; Banito, A.; Burdach, S.; Cidre-Aranaz, F.; Di Pompo, G.; Distel, M.; Dorado-Garcia, H.; Garcia-Castro, J.; et al. Sarcoma treatment in the era of molecular medicine. EMBO Mol. Med. 2020, 12, e11131. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Gao, Y.; Wang, Y.; Daemen, T. The combined signatures of hypoxia and cellular landscape provides a prognostic and therapeutic biomarker in hepatitis B virus-related hepatocellular carcinoma. Int. J. Cancer 2022, 151, 809–824. [Google Scholar] [CrossRef]
- Aran, D.; Hu, Z.; Butte, A.J. xCell: Digitally portraying the tissue cellular heterogeneity landscape. Genome Biol. 2017, 18, 220. [Google Scholar] [CrossRef] [Green Version]
- Sturm, G.; Finotello, F.; Petitprez, F.; Zhang, J.D.; Baumbach, J.; Fridman, W.H.; List, M.; Aneichyk, T. Comprehensive evaluation of transcriptome-based cell-type quantification methods for immuno-oncology. Bioinformatics 2019, 35, i436–i445. [Google Scholar] [CrossRef]
- Meléndez, B.; Van Campenhout, C.; Rorive, S.; Remmelink, M.; Salmon, I.; D’Haene, N. Methods of measurement for tumor mutational burden in tumor tissue. Transl. Lung Cancer Res. 2018, 7, 661. [Google Scholar] [CrossRef]
- Aibar, S.; González-Blas, C.B.; Moerman, T.; Huynh-Thu, V.A.; Imrichova, H.; Hulselmans, G.; Rambow, F.; Marine, J.C.; Geurts, P.; Aerts, J.; et al. SCENIC: Single-cell regulatory network inference and clustering. Nat. Methods 2017, 14, 1083–1086. [Google Scholar] [CrossRef] [Green Version]
- Geeleher, P.; Cox, N.J.; Huang, R.S. Clinical drug response can be predicted using baseline gene expression levels and in vitrodrug sensitivity in cell lines. Genome Biol. 2014, 15, R47. [Google Scholar] [CrossRef] [Green Version]
- Lu, X.; Jiang, L.; Zhang, L.; Zhu, Y.; Hu, W.; Wang, J.; Ruan, X.; Xu, Z.; Meng, X.; Gao, J. Immune signature-based subtypes of cervical squamous cell carcinoma tightly associated with human papillomavirus type 16 expression, molecular features, and clinical outcome. Neoplasia 2019, 21, 591–601. [Google Scholar] [CrossRef] [PubMed]
- Fischer, J.W.; Busa, V.F.; Shao, Y.; Leung, A.K.L. Structure-Mediated RNA Decay by UPF1 and G3BP1. Mol. Cell. 2020, 78, 70–84.e76. [Google Scholar] [CrossRef] [PubMed]
- Lequeux, A.; Noman, M.Z.; Xiao, M.; Sauvage, D.; Van Moer, K.; Viry, E.; Bocci, I.; Hasmim, M.; Bosseler, M.; Berchem, G. Impact of hypoxic tumor microenvironment and tumor cell plasticity on the expression of immune checkpoints. Cancer Lett. 2019, 458, 13–20. [Google Scholar] [CrossRef]
- Huang, P.; Zhang, X.; Pan, M.; Deng, J.; Chen, Z.; Zhou, X.; Liang, M.; Liang, D. Effect of Activated Protein Kinase C Beta Type Mediated Phosphorylation of Signal Transducer and Activator of Transcription 4 on Proliferation and Phenotypic Transformation of Vascular Smooth Muscle Cells After Vascular Injury Induced by Nano-SiO₂. J. Nanosci. Nanotechnol. 2020, 20, 7385–7397. [Google Scholar] [CrossRef]
- Nagato, H.; Matsuo, N.; Sumiyoshi, H.; Sakata-Takatani, K.; Nasu, M.; Yoshioka, H. The transcription factor CCAAT-binding factor CBF/NF-Y and two repressors regulate the core promoter of the human pro-alpha3(V) collagen gene (COL5A3). J. Biol. Chem. 2004, 279, 46373–46383. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wagner, M.; Lévy, J.; Jung-Klawitter, S.; Bakhtiari, S.; Monteiro, F.; Maroofian, R.; Bierhals, T.; Hempel, M.; Elmaleh-Bergès, M.; Kitajima, J.P.; et al. Loss of TNR causes a nonprogressive neurodevelopmental disorder with spasticity and transient opisthotonus. Genet. Med. 2020, 22, 1061–1068. [Google Scholar] [CrossRef]
- Li, X.; Pasche, B.; Zhang, W.; Chen, K. Association of MUC16 Mutation With Tumor Mutation Load and Outcomes in Patients With Gastric Cancer. JAMA Oncol. 2018, 4, 1691–1698. [Google Scholar] [CrossRef]
- Swietach, P.; Vaughan-Jones, R.D.; Harris, A.L. Regulation of tumor pH and the role of carbonic anhydrase 9. Cancer Metastasis Rev. 2007, 26, 299–310. [Google Scholar] [CrossRef]
- Amann, T.; Maegdefrau, U.; Hartmann, A.; Agaimy, A.; Marienhagen, J.; Weiss, T.S.; Stoeltzing, O.; Warnecke, C.; Schölmerich, J.; Oefner, P.J. GLUT1 expression is increased in hepatocellular carcinoma and promotes tumorigenesis. Am. J. Pathol. 2009, 174, 1544–1552. [Google Scholar] [CrossRef] [Green Version]
- Vasan, N.; Baselga, J.; Hyman, D.M. A view on drug resistance in cancer. Nature 2019, 575, 299–309. [Google Scholar] [CrossRef] [Green Version]
- Birkbak, N.J.; Wang, Z.C.; Kim, J.Y.; Eklund, A.C.; Li, Q.; Tian, R.; Bowman-Colin, C.; Li, Y.; Greene-Colozzi, A.; Iglehart, J.D.; et al. Telomeric allelic imbalance indicates defective DNA repair and sensitivity to DNA-damaging agents. Cancer Discov. 2012, 2, 366–375. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, X.; Bahrami, A.; Pappo, A.; Easton, J.; Dalton, J.; Hedlund, E.; Ellison, D.; Shurtleff, S.; Wu, G.; Wei, L. Recurrent somatic structural variations contribute to tumorigenesis in pediatric osteosarcoma. Cell Rep. 2014, 7, 104–112. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Entz-Werlé, N.; Stoetzel, C.; Berard-Marec, P.; Kalifa, C.; Brugiere, L.; Pacquement, H.; Schmitt, C.; Tabone, M.D.; Gentet, J.C.; Quillet, R. Frequent genomic abnormalities at TWIST in human pediatric osteosarcomas. Int. J. Cancer 2005, 117, 349–355. [Google Scholar] [CrossRef]
- Kansara, M.; Tsang, M.; Kodjabachian, L.; Sims, N.A.; Trivett, M.K.; Ehrich, M.; Dobrovic, A.; Slavin, J.; Choong, P.F.; Simmons, P.J. Wnt inhibitory factor 1 is epigenetically silenced in human osteosarcoma, and targeted disruption accelerates osteosarcomagenesis in mice. J. Clin. Investig. 2009, 119, 837–851. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Matsuoka, K.; Bakiri, L.; Wolff, L.I.; Linder, M.; Mikels-Vigdal, A.; Patiño-García, A.; Lecanda, F.; Hartmann, C.; Sibilia, M.; Wagner, E.F. Wnt signaling and Loxl2 promote aggressive osteosarcoma. Cell Res. 2020, 30, 885–901. [Google Scholar] [CrossRef] [PubMed]
- Måseide, K.; Kandel, R.A.; Bell, R.S.; Catton, C.N.; O’Sullivan, B.; Wunder, J.S.; Pintilie, M.; Hedley, D.; Hill, R.P. Carbonic anhydrase IX as a marker for poor prognosis in soft tissue sarcoma. Clin. Cancer Res. 2004, 10, 4464–4471. [Google Scholar] [CrossRef] [Green Version]
- Li, G.H.; Liu, X.; Feng, L.J.; Zhang, L. Expression of Tmem41b and MMP13 associated with poor outcome in osteosarcomas. Neoplasma 2021, 201209N1329. [Google Scholar] [CrossRef] [PubMed]
- Ma, O.; Cai, W.W.; Zender, L.; Dayaram, T.; Shen, J.; Herron, A.J.; Lowe, S.W.; Man, T.K.; Lau, C.C.; Donehower, L.A. MMP13, Birc2 (cIAP1), and Birc3 (cIAP2), amplified on chromosome 9, collaborate with p53 deficiency in mouse osteosarcoma progression. Cancer Res. 2009, 69, 2559–2567. [Google Scholar] [CrossRef] [Green Version]
- Kawazu, M.; Ueno, T.; Kontani, K.; Ogita, Y.; Ando, M.; Fukumura, K.; Yamato, A.; Soda, M.; Takeuchi, K.; Miki, Y.; et al. Transforming mutations of RAC guanosine triphosphatases in human cancers. Proc. Natl. Acad. Sci. USA 2013, 110, 3029–3034. [Google Scholar] [CrossRef]
Gene | Sequence of Primer |
---|---|
GAPDH | F 1: CAGGAGGCATTGCTGATGAT |
R 2: GAAGGCTGGGGCTCATTT | |
ACSM5 | F: GGACAGGGACTGTGATGATTCC |
R: CCCTTGGAGCTAGGGAGTCA | |
WNT7B | F: GAAGCAGGGCTACTACAACCA |
R: CGGCCTCATTGTTATGCAGGT | |
RAC3 | F: TCCCCACCGTTTTTGACAACT |
R: GCACGAACATTCTCGAAGGAG | |
RA9 | F: TTTGCCAGAGTTGACGAGGC |
R: GCTCATAGGCACTGTTTTCTTCC | |
MMP13 | F: ACTGAGAGGCTCCGAGAAATG |
R: GAACCCCGCATCTTGGCTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, R.; Qi, L.; Ren, X.; Zhang, W.; Li, C.; Liu, Z.; Tu, C.; Li, Z. Integrated Analysis of TME and Hypoxia Identifies a Classifier to Predict Prognosis and Therapeutic Biomarkers in Soft Tissue Sarcomas. Cancers 2022, 14, 5675. https://doi.org/10.3390/cancers14225675
Xu R, Qi L, Ren X, Zhang W, Li C, Liu Z, Tu C, Li Z. Integrated Analysis of TME and Hypoxia Identifies a Classifier to Predict Prognosis and Therapeutic Biomarkers in Soft Tissue Sarcomas. Cancers. 2022; 14(22):5675. https://doi.org/10.3390/cancers14225675
Chicago/Turabian StyleXu, Ruiling, Lin Qi, Xiaolei Ren, Wenchao Zhang, Chenbei Li, Zhongyue Liu, Chao Tu, and Zhihong Li. 2022. "Integrated Analysis of TME and Hypoxia Identifies a Classifier to Predict Prognosis and Therapeutic Biomarkers in Soft Tissue Sarcomas" Cancers 14, no. 22: 5675. https://doi.org/10.3390/cancers14225675