Mitochondrial Elongation and OPA1 Play Crucial Roles during the Stemness Acquisition Process in Pancreatic Ductal Adenocarcinoma
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. RNA Extraction and Real-Time PCR (qPCR)
2.3. mtDNA Quantification
Gene | Primer Pairs–Sequence (5′-3′) | |
---|---|---|
Forward | Reverse | |
NRF1 | CCACGTTACAGGGAGGTGAG | TGTAGCTCCCTGCTGCATCT |
NRF2 | GCGACGGAAAGAGTATGAGC | GTTGGCAGATCCACTGGTTT |
TFAM | GTGGTTTTCATCTGTCTTGGC | ACTCCGCCCTATAAGCATCTTG |
PGC1α | TGACTGGCGTCATTCAGGAG | CCAGAGCAGCACACTCGAT |
CDH1 | GACACCAACGATAATCCTCCGA | GGCACCTGACCCTTGTACGT |
ZEB1 | GTTACCAGGGAGGAGCAGTGAAA | GACAGCAGTGTCTTGTTGTTGTAGAAA |
SOX2 | GGGAAATGGGAGGGGTGCAAAAGAGG | TTGCGTGAGTGTGGATGGGATTGGTG |
NANOG | AGTCCCAAAGGCAAACAACCCACTTC | TGCTGGAGGCTGAGGTATTTCTGTCTC |
OCT3/4 | GACAGGGGGAGGGGAGGAGCTAGG | CTTCCCTCCAACCAGTTGCCCCAAAC |
ND1 * | GTCAACCTCGCTTCCCCACCCT | TCCTGCGAATAGGCTTCCGGCT |
B2M * | CGACGGGAGGGTCGGGACAA | GCCCCGCGAAAGAGCGGAAG |
DRP1 | AAGAACCAACCACAGGCAAC | GTTCACGGCATGACCTTTTT |
FIS1 | CTTGCTGTGTCCAAGTCCAA | GCTGAAGGACGAATCTCAGG |
MFN1 | TTGGAGCGGAGACTTAGCAT | TTCGATCAAGTTCCGGATTC |
MFN2 | AGAGGCATCAGTGAGGTGCT | GCAGAACTTTGTCCCAGAGC |
OPA1 | GGCCAGCAAGATTAGCTACG | ACAATGTCAGGCACAATCCA |
2.4. Protein Extraction and Immunoblotting
2.5. Transmission Electron Microscopy
2.6. Mitochondria Fluorescent Staining
2.7. Spheroid Formation Assay
2.8. siRNA Knockdown
2.9. Soft Agar Colony Formation Assay
2.10. Isolation of Mitochondria
2.11. Cellular ATP Levels
2.12. Blue Native Gel Electrophoresis (BNGE)
2.13. Mitochondrial Respiratory Complex Activities
2.14. Statistical Analysis
3. Results
3.1. CSCs Present Increased Mitochondrial Mass
3.2. Mitochondrial Fusion Is Increased in CSCs
3.3. OPA1 Modulates the Tumorsphere Formation
3.4. CSCs Show Modulation of Mitochondrial Respiratory Complex Amounts, Activity, and Assembly into Supercomplexes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA A Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Ushio, J.; Kanno, A.; Ikeda, E.; Ando, K.; Nagai, H.; Miwata, T.; Kawasaki, Y.; Tada, Y.; Yokoyama, K.; Numao, N.; et al. Pancreatic Ductal Adenocarcinoma: Epidemiology and Risk Factors. Diagnostics 2021, 11, 562. [Google Scholar] [CrossRef] [PubMed]
- Nevala-Plagemann, C.; Hidalgo, M.; Garrido-Laguna, I. From State-of-the-Art Treatments to Novel Therapies for Advanced-Stage Pancreatic Cancer. Nat. Rev. Clin. Oncol. 2020, 17, 108–123. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Zheng, Y.; Yang, F.; Zhu, L.; Zhu, X.Q.; Wang, Z.F.; Wu, X.L.; Zhou, C.H.; Yan, J.Y.; Hu, B.Y.; et al. The Molecular Biology of Pancreatic Adenocarcinoma: Translational Challenges and Clinical Perspectives. Signal Transduct. Target. Ther. 2021, 6, 249. [Google Scholar] [CrossRef]
- Quiñonero, F.; Mesas, C.; Doello, K.; Cabeza, L.; Perazzoli, G.; Jimenez-Luna, C.; Rama, A.R.; Melguizo, C.; Prados, J. The Challenge of Drug Resistance in Pancreatic Ductal Adenocarcinoma: A Current Overview. Cancer Biol. Med. 2019, 16, 688–699. [Google Scholar] [CrossRef]
- Sergeant, G.; Vankelecom, H.; Gremeaux, L.; Topal, B. Role of Cancer Stem Cells in Pancreatic Ductal Adenocarcinoma. Nat. Rev. Clin. Oncol. 2009, 6, 580–586. [Google Scholar] [CrossRef]
- Stoica, A.F.; Chang, C.H.; Pauklin, S. Molecular Therapeutics of Pancreatic Ductal Adenocarcinoma: Targeted Pathways and the Role of Cancer Stem Cells. Trends Pharmacol. Sci. 2020, 41, 977–993. [Google Scholar] [CrossRef]
- Zhou, H.M.; Zhang, J.G.; Zhang, X.; Li, Q. Targeting Cancer Stem Cells for Reversing Therapy Resistance: Mechanism, Signaling, and Prospective Agents. Signal Transduct. Target. Ther. 2021, 6, 62. [Google Scholar] [CrossRef]
- Zhou, Y.; Zhou, Y.; Shingu, T.; Feng, L.; Chen, Z.; Ogasawara, M.; Keating, M.J.; Kondo, S.; Huang, P. Metabolic Alterations in Highly Tumorigenic Glioblastoma Cells: Preference for Hypoxia and High Dependency on Glycolysis. J. Biol. Chem. 2011, 286, 32843–32853. [Google Scholar] [CrossRef] [Green Version]
- Ciavardelli, D.; Rossi, C.; Barcaroli, D.; Volpe, S.; Consalvo, A.; Zucchelli, M.; de Cola, A.; Scavo, E.; Carollo, R.; D’Agostino, D.; et al. Breast Cancer Stem Cells Rely on Fermentative Glycolysis and Are Sensitive to 2-Deoxyglucose Treatment. Cell Death Dis. 2014, 5, e1336. [Google Scholar] [CrossRef] [Green Version]
- Valle, S.; Alcalá, S.; Martin-Hijano, L.; Cabezas-Sáinz, P.; Navarro, D.; Muñoz, E.R.; Yuste, L.; Tiwary, K.; Walter, K.; Ruiz-Cañas, L.; et al. Exploiting Oxidative Phosphorylation to Promote the Stem and Immunoevasive Properties of Pancreatic Cancer Stem Cells. Nat. Commun. 2020, 11, 5265. [Google Scholar] [CrossRef] [PubMed]
- Sancho, P.; Burgos-Ramos, E.; Tavera, A.; Bou Kheir, T.; Jagust, P.; Schoenhals, M.; Barneda, D.; Sellers, K.; Campos-Olivas, R.; Graña, O.; et al. MYC/PGC-1α Balance Determines the Metabolic Phenotype and Plasticity of Pancreatic Cancer Stem Cells. Cell Metab. 2015, 22, 590–605. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ambrosini, G.; Dalla Pozza, E.; Fanelli, G.; di Carlo, C.; Vettori, A.; Cannino, G.; Cavallini, C.; Carmona-Carmona, C.A.; Brandi, J.; Rinalducci, S.; et al. Progressively De-Differentiated Pancreatic Cancer Cells Shift from Glycolysis to Oxidative Metabolism and Gain a Quiescent Stem State. Cells 2020, 9, 1572. [Google Scholar] [CrossRef]
- Maycotte, P.; Marín-Hernández, A.; Goyri-Aguirre, M.; Anaya-Ruiz, M.; Reyes-Leyva, J.; Cortés-Hernández, P. Mitochondrial Dynamics and Cancer. Tumor Biol. 2017, 39, 9839. [Google Scholar] [CrossRef] [Green Version]
- Intlekofer, A.M.; Finley, L.W.S. Metabolic Signatures of Cancer Cells and Stem Cells. Nat. Metab. 2019, 1, 177–188. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xie, Q.; Wu, Q.; Horbinski, C.M.; Flavahan, W.A.; Yang, K.; Zhou, W.; Dombrowski, S.M.; Huang, Z.; Fang, X.; Shi, Y.; et al. Mitochondrial Control by DRP1 in Brain Tumor Initiating Cells. Nat. Neurosci. 2015, 18, 501–510. [Google Scholar] [CrossRef] [Green Version]
- Loureiro, R.; Mesquita, K.A.; Magalhães-Novais, S.; Oliveira, P.J.; Vega-Naredo, I. Mitochondrial Biology in Cancer Stem Cells. Semin. Cancer Biol. 2017, 47, 18–28. [Google Scholar] [CrossRef]
- Inak, G.; Rybak-Wolf, A.; Lisowski, P.; Pentimalli, T.M.; Jüttner, R.; Glažar, P.; Uppal, K.; Bottani, E.; Brunetti, D.; Secker, C.; et al. Defective Metabolic Programming Impairs Early Neuronal Morphogenesis in Neural Cultures and an Organoid Model of Leigh Syndrome. Nat. Commun. 2021, 12, 1929. [Google Scholar] [CrossRef]
- Dolci, S.; Mannino, L.; Bottani, E.; Campanelli, A.; di Chio, M.; Zorzin, S.; D’Arrigo, G.; Amenta, A.; Segala, A.; Paglia, G.; et al. Therapeutic Induction of Energy Metabolism Reduces Neural Tissue Damage and Increases Microglia Activation in Severe Spinal Cord Injury. Pharmacol. Res. 2022, 178, 106149. [Google Scholar] [CrossRef]
- Bonnen, P.E.; Yarham, J.W.; Besse, A.; Wu, P.; Faqeih, E.A.; Al-Asmari, A.M.; Saleh, M.A.M.; Eyaid, W.; Hadeel, A.; He, L.; et al. Mutations in FBXL4 Cause Mitochondrial Encephalopathy and a Disorder of Mitochondrial DNA Maintenance. Am. J. Hum. Genet. 2013, 93, 471–481. [Google Scholar] [CrossRef] [Green Version]
- Sánchez-Cenizo, L.; Formentini, L.; Aldea, M.; Ortega, Á.D.; García-Huerta, P.; Sánchez-Aragó, M.; Cuezva, J.M. Up-Regulation of the ATPase Inhibitory Factor 1 (IF1) of the Mitochondrial H+-ATP Synthase in Human Tumors Mediates the Metabolic Shift of Cancer Cells to a Warburg Phenotype. J. Biol. Chem. 2010, 285, 25308–25313. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nuevo-Tapioles, C.; Santacatterina, F.; Stamatakis, K.; Núñez de Arenas, C.; Gómez de Cedrón, M.; Formentini, L.; Cuezva, J.M. Coordinate β-Adrenergic Inhibition of Mitochondrial Activity and Angiogenesis Arrest Tumor Growth. Nat. Commun. 2020, 11, 3606. [Google Scholar] [CrossRef] [PubMed]
- Bugiardini, E.; Bottani, E.; Marchet, S.; Poole, O.V.; Beninca, C.; Horga, A.; Woodward, C.; Lam, A.; Hargreaves, I.; Chalasani, A.; et al. Expanding the Molecular and Phenotypic Spectrum of Truncating MT-ATP6 Mutations. Neurol. Genet. 2020, 6, e381. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bottani, E.; Cerutti, R.; Harbour, M.E.; Ravaglia, S.; Dogan, S.A.; Giordano, C.; Fearnley, I.M.; D’Amati, G.; Viscomi, C.; Fernandez-Vizarra, E.; et al. TTC19 Plays a Husbandry Role on UQCRFS1 Turnover in the Biogenesis of Mitochondrial Respiratory Complex III. Mol. Cell 2017, 67, 418–428. [Google Scholar] [CrossRef] [Green Version]
- Nijtmans, L.G.J.; Henderson, N.S.; Holt, I.J. Blue Native Electrophoresis to Study Mitochondrial and Other Protein Complexes. Methods 2002, 26, 327–334. [Google Scholar] [CrossRef]
- Wittig, I.; Braun, H.P.; Schägger, H. Blue Native PAGE. Nat. Protoc. 2006, 1, 418–428. [Google Scholar] [CrossRef]
- Kirby, D.M.; Thorburn, D.R.; Turnbull, D.M.; Taylor, R.W. Biochemical Assays of Respiratory Chain Complex Activity. Methods Cell Biol. 2007, 80, 93–119. [Google Scholar]
- Spinazzi, M.; Casarin, A.; Pertegato, V.; Salviati, L.; Angelini, C. Assessment of Mitochondrial Respiratory Chain Enzymatic Activities on Tissues and Cultured Cells. Nat. Protoc. 2012, 7, 1235–1246. [Google Scholar] [CrossRef]
- Masoud, R.; Reyes-Castellanos, G.; Lac, S.; Garcia, J.; Dou, S.; Shintu, L.; Abdel Hadi, N.; Gicquel, T.; el Kaoutari, A.; Diémé, B.; et al. Targeting Mitochondrial Complex I Overcomes Chemoresistance in High OXPHOS Pancreatic Cancer. Cell Rep. Med. 2020, 1, 100143. [Google Scholar] [CrossRef]
- Hollinshead, K.E.R.; Parker, S.J.; Eapen, V.V.; Encarnacion-Rosado, J.; Sohn, A.; Oncu, T.; Cammer, M.; Mancias, J.D.; Kimmelman, A.C. Respiratory Supercomplexes Promote Mitochondrial Efficiency and Growth in Severely Hypoxic Pancreatic Cancer. Cell Rep. 2020, 33, 108231. [Google Scholar] [CrossRef]
- Lapuente-Brun, E.; Moreno-Loshuertos, R.; Aciń-Pérez, R.; Latorre-Pellicer, A.; Colaś, C.; Balsa, E.; Perales-Clemente, E.; Quirós, P.M.; Calvo, E.; Rodríguez-Hernández, M.A.; et al. Supercomplex Assembly Determines Electron Flux in the Mitochondrial Electron Transport Chain. Science 2013, 340, 1567–1570. [Google Scholar] [CrossRef] [PubMed]
- Askan, G.; Sahin, I.H.; Chou, J.F.; Yavas, A.; Capanu, M.; Iacobuzio-Donahue, C.A.; Basturk, O.; O’Reilly, E.M. Pancreatic Cancer Stem Cells May Define Tumor Stroma Characteristics and Recurrence Patterns in Pancreatic Ductal Adenocarcinoma. BMC Cancer 2021, 21, 385. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.; Ricciardiello, F.; Yang, G.; Qiu, J.; Huang, H.; Xiao, J.; Cao, Z.; Zhao, F.; Liu, Y.; Luo, W.; et al. The Role of Mitochondria in the Chemoresistance of Pancreatic Cancer Cells. Cells 2021, 10, 497. [Google Scholar] [CrossRef] [PubMed]
- Shin, M.K.; Cheong, J.H. Mitochondria-Centric Bioenergetic Characteristics in Cancer Stem-like Cells. Arch. Pharmacal Res. 2019, 42, 113–127. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dai, W.; Wang, G.; Chwa, J.; Oh, M.E.; Abeywardana, T.; Yang, Y.; Wang, Q.A.; Jiang, L. Mitochondrial Division Inhibitor (Mdivi-1) Decreases Oxidative Metabolism in Cancer. Br. J. Cancer 2020, 122, 1288–1297. [Google Scholar] [CrossRef] [Green Version]
- Singh, A.K.; Arya, R.K.; Maheshwari, S.; Singh, A.; Meena, S.; Pandey, P.; Dormond, O.; Datta, D. Tumor Heterogeneity and Cancer Stem Cell Paradigm: Updates in Concept, Controversies and Clinical Relevance. Int. J. Cancer 2015, 136, 1991–2000. [Google Scholar] [CrossRef]
- Pozza, E.D.; Dando, I.; Biondani, G.; Brandi, J.; Costanzo, C.; Zoratti, E.; Fassan, M.; Boschi, F.; Melisi, D.; Cecconi, D.; et al. Pancreatic Ductal Adenocarcinoma Cell Lines Display a Plastic Ability to Bi-Directionally Convert into Cancer Stem Cells. Int. J. Oncol. 2015, 46, 1099–1108. [Google Scholar] [CrossRef] [Green Version]
- Zhao, J.; Zhang, J.; Yu, M.; Xie, Y.; Huang, Y.; Wolff, D.W.; Abel, P.W.; Tu, Y. Mitochondrial Dynamics Regulates Migration and Invasion of Breast Cancer Cells. Oncogene 2013, 32, 4814–4824. [Google Scholar] [CrossRef]
- Seo, S.K.; Kim, J.H.; Choi, H.N.; Choe, T.B.; Hong, S.-I.; Yi, J.Y.; Hwang, S.G.; Lee, H.G.; Lee, Y.H.; Park, I.C. Knockdown of TWIST1 Enhances Arsenic Trioxide- and Ionizing Radiation-Induced Cell Death in Lung Cancer Cells by Promoting Mitochondrial Dysfunction. Biochem. Biophys. Res. Commun. 2014, 449, 490–495. [Google Scholar] [CrossRef]
- de Luca, A.; Fiorillo, M.; Peiris-Pagès, M.; Ozsvari, B.; Smith, D.L.; Sanchez-Alvarez, R.; Martinez-Outschoorn, U.E.; Cappello, A.R.; Pezzi, V.; Lisanti, M.P.; et al. Mitochondrial Biogenesis Is Required for the Anchorage-Independent Survival and Propagation of Stem-like Cancer Cells. Oncotarget 2015, 6, 14777–14795. [Google Scholar] [CrossRef] [Green Version]
- Lebleu, V.S.; O’Connell, J.T.; Gonzalez Herrera, K.N.; Wikman, H.; Pantel, K.; Haigis, M.C.; de Carvalho, F.M.; Damascena, A.; Domingos Chinen, L.T.; Rocha, R.M.; et al. PGC-1α Mediates Mitochondrial Biogenesis and Oxidative Phosphorylation in Cancer Cells to Promote Metastasis. Nat. Cell Biol. 2014, 16, 992–1003. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martínez-Reyes, I.; Cardona, L.R.; Kong, H.; Vasan, K.; McElroy, G.S.; Werner, M.; Kihshen, H.; Reczek, C.R.; Weinberg, S.E.; Gao, P.; et al. Mitochondrial Ubiquinol Oxidation Is Necessary for Tumour Growth. Nature 2020, 585, 288–292. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.; Smith, S.B.; Yoon, Y. The Short Variant of the Mitochondrial Dynamin OPA1 Maintains Mitochondrial Energetics and Cristae Structure. J. Biol. Chem. 2017, 292, 7115–7130. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Son, J.M.; Sarsour, E.H.; Kakkerla Balaraju, A.; Fussell, J.; Kalen, A.L.; Wagner, B.A.; Buettner, G.R.; Goswami, P.C. Mitofusin 1 and Optic Atrophy 1 Shift Metabolism to Mitochondrial Respiration during Aging. Aging Cell 2017, 16, 1136–1145. [Google Scholar] [CrossRef] [Green Version]
- Rehman, J.; Zhang, H.J.; Toth, P.T.; Zhang, Y.; Marsboom, G.; Hong, Z.; Salgia, R.; Husain, A.N.; Wietholt, C.; Archer, S.L. Inhibition of Mitochondrial Fission Prevents Cell Cycle Progression in Lung Cancer. FASEB J. 2012, 26, 2175–2186. [Google Scholar] [CrossRef] [Green Version]
- Courtois, S.; de Luxán-Delgado, B.; Penin-Peyta, L.; Royo-García, A.; Parejo-Alonso, B.; Jagust, P.; Alcalá, S.; Rubiolo, J.A.; Sánchez, L.; Sainz, B.; et al. Inhibition of Mitochondrial Dynamics Preferentially Targets Pancreatic Cancer Cells with Enhanced Tumorigenic and Invasive Potential. Cancers 2021, 13, 698. [Google Scholar] [CrossRef]
- del Dotto, V.; Fogazza, M.; Carelli, V.; Rugolo, M.; Zanna, C. Eight Human OPA1 Isoforms, Long and Short: What Are They For? Biochim. Biophys. Acta Bioenerg. 2018, 1859, 263–269. [Google Scholar] [CrossRef]
- Li, M.; Wang, L.; Wang, Y.; Zhang, S.; Zhou, G.; Lieshout, R.; Ma, B.; Liu, J.; Qu, C.; Verstegen, M.M.A.; et al. Mitochondrial Fusion Via OPA1 and MFN1 Supports Liver Tumor Cell Metabolism and Growth. Cells 2020, 9, 121. [Google Scholar] [CrossRef] [Green Version]
- Herkenne, S.; Ek, O.; Zamberlan, M.; Pellattiero, A.; Chergova, M.; Chivite, I.; Novotná, E.; Rigoni, G.; Fonseca, T.B.; Samardzic, D.; et al. Developmental and Tumor Angiogenesis Requires the Mitochondria-Shaping Protein Opa1. Cell Metab. 2020, 31, 987–1003.e8. [Google Scholar] [CrossRef]
- Letts, J.A.; Sazanov, L.A. Clarifying the Supercomplex: The Higher-Order Organization of the Mitochondrial Electron Transport Chain. Nat. Struct. Mol. Biol. 2017, 24, 800–808. [Google Scholar] [CrossRef]
- García, J.J.; Morales-Ríos, E.; Cortés-Hernández, P.; Rodríguez-Zavala, J.S. The Inhibitor Protein (IF1) Promotes Dimerization of the Mitochondrial F1F0-ATP Synthase. Biochemistry 2006, 45, 12695–12703. [Google Scholar] [CrossRef] [PubMed]
- Santacatterina, F.; Sánchez-Cenizo, L.; Formentini, L.; Mobasher, M.A.; Casas, E.; Rueda, C.B.; Martínez-Reyes, I.; de Arenas, C.N.; García-Bermúdez, J.; Zapata, J.M.; et al. Down-Regulation of Oxidative Phosphorylation in the Liver by Expression of the ATPase Inhibitory Factor 1 Induces a Tumorpromoter Metabolic State. Oncotarget 2016, 7, 490–508. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Esparza-Moltó, P.B.; Romero-Carramiñana, I.; de Arenas, C.N.; Pereira, M.P.; Blanco, N.; Pardo, B.; Bates, G.R.; Sánchez-Castillo, C.; Artuch, R.; Murphy, M.P.; et al. Generation of Mitochondrial Reactive Oxygen Species Is Controlled by ATPase Inhibitory Factor 1 and Regulates Cognition. PLoS Biol. 2021, 19, e3001252. [Google Scholar] [CrossRef] [PubMed]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Carmona-Carmona, C.A.; Dalla Pozza, E.; Ambrosini, G.; Cisterna, B.; Palmieri, M.; Decimo, I.; Cuezva, J.M.; Bottani, E.; Dando, I. Mitochondrial Elongation and OPA1 Play Crucial Roles during the Stemness Acquisition Process in Pancreatic Ductal Adenocarcinoma. Cancers 2022, 14, 3432. https://doi.org/10.3390/cancers14143432
Carmona-Carmona CA, Dalla Pozza E, Ambrosini G, Cisterna B, Palmieri M, Decimo I, Cuezva JM, Bottani E, Dando I. Mitochondrial Elongation and OPA1 Play Crucial Roles during the Stemness Acquisition Process in Pancreatic Ductal Adenocarcinoma. Cancers. 2022; 14(14):3432. https://doi.org/10.3390/cancers14143432
Chicago/Turabian StyleCarmona-Carmona, Cristian Andres, Elisa Dalla Pozza, Giulia Ambrosini, Barbara Cisterna, Marta Palmieri, Ilaria Decimo, José M. Cuezva, Emanuela Bottani, and Ilaria Dando. 2022. "Mitochondrial Elongation and OPA1 Play Crucial Roles during the Stemness Acquisition Process in Pancreatic Ductal Adenocarcinoma" Cancers 14, no. 14: 3432. https://doi.org/10.3390/cancers14143432
APA StyleCarmona-Carmona, C. A., Dalla Pozza, E., Ambrosini, G., Cisterna, B., Palmieri, M., Decimo, I., Cuezva, J. M., Bottani, E., & Dando, I. (2022). Mitochondrial Elongation and OPA1 Play Crucial Roles during the Stemness Acquisition Process in Pancreatic Ductal Adenocarcinoma. Cancers, 14(14), 3432. https://doi.org/10.3390/cancers14143432