Thyroid Hormone Enhances Angiogenesis and the Warburg Effect in Squamous Cell Carcinomas
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Cultures
2.2. DIO2 Targeted Mutagenesis
2.3. Constructs and Transfections
2.4. Conditional Dio2 Expression in SCC13 Cells
2.5. Protein Extraction from Skin and Western Blot Analysis
2.6. Real-Time PCR
2.7. Chromatin Immunoprecipitation (ChIP) Assay
2.8. Transwell Migration Assay
2.9. Hypoxia Experiments
2.10. Seahorse
2.11. Animals, Histology and Immunostaining
2.12. DMBA/TPA Carcinogenesis
2.13. Non-Invasive High Frequency Ultrasound of Xenograft and Lymph Nodes
2.14. Angiogenesis-Related Antibody Array
2.15. Statistics
3. Results
3.1. Thyroid Hormone Induces VEGF-A Expression in SCC Cells and Promotes VEGF-A-Dependent Angiogenesis
3.2. In Vivo D2-Depletion Reduces VEGF-A-Induced Angiogenesis
3.3. Loss of D2 Reduces Tumor Vascularization and Angiogenesis
3.4. Thyroid Hormone Promotes HIF1α Stabilization under Normoxic and Hypoxic Conditions
3.5. Thyroid Hormone Accelerates Glycolysis by Driving the Warburg Effect in Squamous Cell Carcinoma
4. Discussion
4.1. TH and the Warburg Effect
4.2. TH, Angiogenesis and Hypoxia
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Jung, Y.; Mansfield, P.; Akagi, M.; Takeda, A.; Liu, W.; Bucana, C.; Hicklin, D.; Ellis, L. Effects of combination anti-vascular endothelial growth factor receptor and anti-epidermal growth factor receptor therapies on the growth of gastric cancer in a nude mouse model. Eur. J. Cancer 2002, 38, 1133–1140. [Google Scholar] [CrossRef] [Scilit]
- Folkman, J. Role of angiogenesis in tumor growth and metastasis. Semin. Oncol. 2002, 29 (Suppl. 16), 15–18. [Google Scholar] [CrossRef] [Scilit]
- Kerbel, R.S.; Kamen, B.A. The anti-angiogenic basis of metronomic chemotherapy. Nat. Rev. Cancer 2004, 4, 423–436. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stupack, D.; Cheresh, D. Integrins and Angiogenesis. Curr. Top Dev. Biol. 2004, 64, 207–238. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adams, R.H.; Alitalo, K. Molecular regulation of angiogenesis and lymphangiogenesis. Nat. Rev. Mol. Cell Biol. 2007, 8, 464–478. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Herbert, S.P.; Stainier, D.Y.R. Molecular control of endothelial cell behaviour during blood vessel morphogenesis. Nat. Rev. Mol. Cell Biol. 2011, 12, 551–564. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Potente, M.; Gerhardt, H.; Carmeliet, P. Basic and Therapeutic Aspects of Angiogenesis. Cell 2011, 146, 873–887. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Warburg, O.; Wind, F.; Negelein, E. The Metabolism of Tumors in the Body. J. Gen. Physiol. 1927, 8, 519–530. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gereben, B.; Zavacki, A.M.; Ribich, S.; Kim, B.W.; Huang, S.A.; Simonides, W.S.; Zeöld, A.; Bianco, A.C. Cellular and Molecular Basis of Deiodinase-Regulated Thyroid Hormone Signaling. Endocr. Rev. 2008, 29, 898–938. [Google Scholar] [CrossRef] [Scilit]
- Gereben, B.; Zeöld, A.; Dentice, M.; Salvatore, D.; Bianco, A.C. Activation and inactivation of thyroid hormone by deiodinases: Local action with general consequences. Cell. Mol. Life Sci. 2007, 65, 570–590. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luongo, C.; Dentice, M.; Salvatore, D. Deiodinases and their intricate role in thyroid hormone homeostasis. Nat. Rev. Endocrinol. 2019, 15, 479–488. [Google Scholar] [CrossRef] [Scilit]
- Dentice, M.; Antonini, D.; Salvatore, D. Type 3 deiodinase and solid tumors: An intriguing pair. Expert Opin. Ther. Targets 2013, 17, 1369–1379. [Google Scholar] [CrossRef] [Scilit]
- Catalano, V.; Dentice, M.; Ambrosio, R.; Luongo, C.; Carollo, R.; Benfante, A.; Todaro, M.; Stassi, G.; Salvatore, D. Activated Thyroid Hormone Promotes Differentiation and Chemotherapeutic Sensitization of Colorectal Cancer Stem Cells by Regulating Wnt and BMP4 Signaling. Cancer Res. 2016, 76, 1237–1244. [Google Scholar] [CrossRef] [Scilit]
- Wolffe, A.P.; Collingwood, T.N.; Li, Q.; Yee, J.; Urnov, F.; Shi, Y.B. Thyroid hormone receptor, v-ErbA, and chromatin. Vitam. Horm. 2000, 58, 449–492. [Google Scholar] [PubMed]
- Mancino, G.; Miro, C.; Di Cicco, E.; Dentice, M. Thyroid hormone action in epidermal development and homeostasis and its implications in the pathophysiology of the skin. J. Endocrinol. Investig. 2021, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Miro, C.; Di Cicco, E.; Ambrosio, R.; Mancino, G.; Di Girolamo, D.; Cicatiello, A.G.; Sagliocchi, S.; Nappi, A.; De Stefano, M.A.; Luongo, C.; et al. Thyroid hormone induces progression and invasiveness of squamous cell carcinomas by promoting a ZEB-1/E-cadherin switch. Nat. Commun. 2019, 10, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Nappi, A.; Di Cicco, E.; Miro, C.; Cicatiello, A.G.; Sagliocchi, S.; Mancino, G.; Ambrosio, R.; Luongo, C.; Di Girolamo, D.; De Stefano, M.A.; et al. The NANOG Transcription Factor Induces Type 2 Deiodinase Expression and Regulates the Intracellular Activation of Thyroid Hormone in Keratinocyte Carcinomas. Cancers 2020, 12, 715. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alam, M.; Ratner, D. Cutaneous squamous-cell carcinoma. N. Engl. J. Med. 2001, 344, 975–983. [Google Scholar] [CrossRef] [Scilit]
- Owens, D.M.; Romero, M.R.; Gardner, C.; Watt, F.M. Suprabasal alpha6beta4 integrin expression in epidermis results in enhanced tumourigenesis and disruption of TGFbeta signalling. J. Cell Sci. 2003, 116, 3783–3791. [Google Scholar] [CrossRef] [Scilit]
- Kemp, C.J. Multistep skin cancer in mice as a model to study the evolution of cancer cells. Semin. Cancer Biol. 2005, 15, 460–473. [Google Scholar] [CrossRef] [Scilit]
- Otto, T.; Fandrey, J. Thyroid hormone induces hypoxia-inducible factor 1alpha gene expression through thyroid hormone receptor beta/retinoid x receptor alpha-dependent activation of hepatic leukemia factor. Endocrinology 2008, 149, 2241–2250. [Google Scholar] [CrossRef] [Scilit]
- Sagliocchi, S.; Cicatiello, A.G.; Di Cicco, E.; Ambrosio, R.; Miro, C.; Di Girolamo, D.; Nappi, A.; Mancino, G.; De Stefano, M.A.; Luongo, C.; et al. The thyroid hormone activating enzyme, type 2 deiodinase, induces myogenic differentiation by regulating mitochondrial metabolism and reducing oxidative stress. Redox Biol. 2019, 24, 101228. [Google Scholar] [CrossRef] [Scilit]
- Rheinwald, J.G.; Beckett, M.A. Tumorigenic keratinocyte lines requiring anchorage and fibroblast support cultured from human squamous cell carcinomas. Cancer Res. 1981, 41, 1657–1663. [Google Scholar] [PubMed]
- Larsen, P.R. Triiodothyronine: Review of recent studies of its physiology and pathophysiology in man. Metab. -Clin. Exp. 1972, 21, 1073–1092. [Google Scholar] [CrossRef] [Scilit]
- Miro, C.; Ambrosio, R.; De Stefano, M.A.; Di Girolamo, D.; Di Cicco, E.; Cicatiello, A.G.; Mancino, G.; Porcelli, T.; Raia, M.; Del Vecchio, L.; et al. The Concerted Action of Type 2 and Type 3 Deiodinases Regulates the Cell Cycle and Survival of Basal Cell Carcinoma Cells. Thyroid 2017, 27, 567–576. [Google Scholar] [CrossRef] [Scilit]
- Bensaid, S.; Fabre, C.; Fourneau, J.; Cieniewski-Bernard, C. Impact of different methods of induction of cellular hypoxia: Focus on protein homeostasis signaling pathways and morphology of C2C12 skeletal muscle cells differentiated into myotubes. J. Physiol. Biochem. 2019, 75, 367–377. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sasso, E.; Vitale, M.; Monteleone, F.; Boffo, F.L.; Santoriello, M.; Sarnataro, D.; Garbi, C.; Sabatella, M.; Crifò, B.; Paolella, L.A.; et al. Binding of Carbonic Anhydrase IX to 45S rDNA Genes Is Prevented by Exportin-1 in Hypoxic Cells. BioMed Res. Int. 2015, 2015, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lapouge, G.; Beck, B.; Nassar, D.; Dubois, C.; Dekoninck, S.; Blanpain, C. Skin squamous cell carcinoma propagating cells increase with tumour progression and invasiveness. EMBO J. 2012, 31, 4563–4575. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Di Girolamo, D.; Ambrosio, R.; De Stefano, M.A.; Mancino, G.; Porcelli, T.; Luongo, C.; Di Cicco, E.; Scalia, G.; Del Vecchio, L.; Colao, A.; et al. Reciprocal interplay between thyroid hormone and microRNA-21 regulates hedgehog pathway–driven skin tumorigenesis. J. Clin. Investig. 2016, 126, 2308–2320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luongo, C.; Martin, C.; Vella, K.; Marsili, A.; Ambrosio, R.; Dentice, M.; Harney, J.W.; Salvatore, D.; Zavacki, A.M.; Larsen, P.R. The Selective Loss of the Type 2 Iodothyronine Deiodinase in Mouse Thyrotrophs Increases Basal TSH but Blunts the Thyrotropin Response to Hypothyroidism. Endocrinology 2015, 156, 745–754. [Google Scholar] [CrossRef] [Scilit]
- Castagna, M.G.; Dentice, M.; Cantara, S.; Ambrosio, R.; Maino, F.; Porcelli, T.; Marzocchi, C.; Garbi, C.; Pacini, F.; Salvatore, D. DIO2 Thr92Ala Reduces Deiodinase-2 Activity and Serum-T3 Levels in Thyroid-Deficient Patients. J. Clin. Endocrinol. Metab. 2017, 102, 1623–1630. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abel, E.; Angel, J.M.; Kiguchi, K.; DiGiovanni, J. Multi-stage chemical carcinogenesis in mouse skin: Fundamentals and applications. Nat. Protoc. 2009, 4, 1350–1362. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nelson, W.G.; Sun, T.-T. The 50- and 58-kdalton keratin classes as molecular markers for stratified squamous epithelia: Cell culture studies. J. Cell Biol. 1983, 97, 244–251. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- An, M.X.; Ogawa-Wong, A.; Carmody, M.C.; Ambrosio, R.; Cicatiello, A.G.; Luongo, C.; Salvatore, D.; Handy, D.E.; Larsen, P.R.; Wajner, S.M.; et al. A Type 2 Deiodinase-Dependent Increase in Vegfa Mediates Myoblast-Endothelial Cell Crosstalk During Skeletal Muscle Regeneration. Thyroid 2021, 31, 115–127. [Google Scholar] [CrossRef] [Scilit]
- Steinsapir, J.; Bianco, A.C.; Buettner, C.; Harney, J.; Larsen, P.R. Substrate-Induced Down-Regulation of Human Type 2 Deiodinase (hD2) Is Mediated through Proteasomal Degradation and Requires Interaction with the Enzyme’s Active Center. Endocrinology 2000, 141, 1127–1135. [Google Scholar] [CrossRef]
- Huang, P.Y.; Balmain, A. Modeling Cutaneous Squamous Carcinoma Development in the Mouse. Cold Spring Harb. Perspect. Med. 2014, 4, a013623. [Google Scholar] [CrossRef] [Scilit]
- Wculek, S.K.; Amores-Iniesta, J.; Conde-Garrosa, R.; Khouili, S.C.; Melero, I.; Sancho, D. Effective cancer immunotherapy by natural mouse conventional type-1 dendritic cells bearing dead tumor antigen. J. Immunother. Cancer 2019, 7, 100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Quail, D.F.; Joyce, J.A. Microenvironmental regulation of tumor progression and metastasis. Nat. Med. 2013, 19, 1423–1437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hanahan, D.; Weinberg, R.A. Hallmarks of Cancer: The Next Generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef] [Scilit]
- Mishra, D.; Banerjee, D. Lactate Dehydrogenases as Metabolic Links between Tumor and Stroma in the Tumor Microenvironment. Cancers 2019, 11, 750. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Belisario, D.C.; Kopecka, J.; Pasino, M.; Akman, M.; De Smaele, E.; Donadelli, M.; Riganti, C. Hypoxia Dictates Metabolic Rewiring of Tumors: Implications for Chemoresistance. Cells 2020, 9, 2598. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Fei, D.; Vanderlaan, M.; Song, A. Biological activity of bevacizumab, a humanized anti-VEGF antibody in vitro. Angiogenesis 2004, 7, 335–345. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Simonides, W.S.; van Hardeveld, C. Thyroid hormone as a determinant of metabolic and contractile phenotype of skeletal muscle. Thyroid 2008, 18, 205–216. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cicatiello, A.G.; Di Girolamo, D.; Dentice, M. Metabolic Effects of the Intracellular Regulation of Thyroid Hormone: Old Players, New Concepts. Front. Endocrinol. 2018, 9, 474. [Google Scholar] [CrossRef] [Scilit]
- Israelsen, W.J.; Dayton, T.L.; Davidson, S.M.; Fiske, B.; Hosios, A.M.; Bellinger, G.; Li, J.; Yu, Y.; Sasaki, M.; Horner, J.W.; et al. PKM2 Isoform-Specific Deletion Reveals a Differential Requirement for Pyruvate Kinase in Tumor Cells. Cell 2013, 155, 397–409. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, V.M.; Heiden, M.G.V. The Role of Pyruvate Kinase M2 in Cancer Metabolism. Brain Pathol. 2015, 25, 781–783. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- San-Millán, I.; Brooks, G.A. Reexamining cancer metabolism: Lactate production for carcinogenesis could be the purpose and explanation of the Warburg Effect. Carcinogenesis 2016, 38, 119–133. [Google Scholar] [CrossRef] [Scilit]
- Yetkin-Arik, B.; Vogels, I.M.C.; Nowak-Sliwinska, P.; Weiss, A.; Houtkooper, R.H.; Van Noorden, C.J.F.; Klaassen, I.; Schlingemann, R.O. The role of glycolysis and mitochondrial respiration in the formation and functioning of endothelial tip cells during angiogenesis. Sci. Rep. 2019, 9, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Jiang, F.; Ma, S.; Xue, Y.; Hou, J.; Zhang, Y. LDH-A promotes malignant progression via activation of epithelial-to-mesenchymal transition and conferring stemness in muscle-invasive bladder cancer. Biochem. Biophys. Res. Commun. 2016, 469, 985–992. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Giatromanolaki, A.; Sivridis, E.; Gatter, K.C.; Turley, H.; Harris, A.L.; Koukourakis, M.I. Lactate dehydrogenase 5 (LDH-5) expression in endometrial cancer relates to the activated VEGF/VEGFR2(KDR) pathway and prognosis. Gynecol. Oncol. 2006, 103, 912–918. [Google Scholar] [CrossRef] [Scilit]
- Valvona, C.J.; Fillmore, H.L. Oxamate, but Not Selective Targeting of LDH-A, Inhibits Medulloblastoma Cell Glycolysis, Growth and Motility. Brain Sci. 2018, 8, 56. [Google Scholar] [CrossRef] [Scilit]
- Gerhardt, H.; Betsholtz, C. Endothelial-pericyte interactions in angiogenesis. Cell Tissue Res. 2003, 314, 15–23. [Google Scholar] [CrossRef] [Scilit]
- Bottaro, D.P.; Liotta, L.A. Cancer: Out of air is not out of action. Nature 2003, 423, 593–595. [Google Scholar] [CrossRef] [Scilit]
- Davis, F.B.; Mousa, S.A.; O’Connor, L.; Mohamed, S.; Lin, H.-Y.; Cao, H.J.; Davis, P.J. Proangiogenic Action of Thyroid Hormone Is Fibroblast Growth Factor–Dependent and Is Initiated at the Cell Surface. Circ. Res. 2004, 94, 1500–1506. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luidens, M.K.; Mousa, S.; Davis, F.B.; Lin, H.-Y.; Davis, P.J. Thyroid hormone and angiogenesis. Vasc. Pharmacol. 2010, 52, 142–145. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kojima, Y.; Kondo, Y.; Fujishita, T.; Mishiro-Sato, E.; Kajino-Sakamoto, R.; Taketo, M.M.; Aoki, M. Stromal iodothyronine deiodinase 2 (DIO2) promotes the growth of intestinal tumors in Apc(Delta716) mutant mice. Cancer Sci. 2019, 110, 2520–2528. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Denko, N.C. Hypoxia, HIF1 and glucose metabolism in the solid tumour. Nat. Rev. Cancer 2008, 8, 705–713. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dupuy, F.; Tabariès, S.; Andrzejewski, S.; Dong, Z.; Blagih, J.; Annis, M.G.; Omeroglu, A.; Gao, D.; Leung, S.; Amir, E.; et al. PDK1-Dependent Metabolic Reprogramming Dictates Metastatic Potential in Breast Cancer. Cell Metab. 2015, 22, 577–589. [Google Scholar] [CrossRef] [Scilit]
- Culouscou, J.-M.; Remacle-Bonnet, M.; Carlton, G.W.; Plowman, G.D.; Shoyab, M. Colorectum Cell-Derived Growth Factor (CRDGF) is Homologous to Amphiregulin, a Member of the Epidermal Growth Factor Family. Growth Factors 1992, 7, 195–205. [Google Scholar] [CrossRef] [Scilit]
- Bogdanov, V.; Balasubramanian, V.; Hathcock, J.; Vele, O.; Lieb, M.; Nemerson, Y. Alternatively spliced human tissue factor: A circulating, soluble, thrombogenic protein. Nat. Med. 2003, 9, 458–462. [Google Scholar] [CrossRef] [Scilit]
- O’Reilly, M.S.; Boehm, T.; Shing, Y.; Fukai, N.; Vasios, G.; Lane, W.S.; Flynn, E.; Birkhead, J.R.; Olsen, B.R.; Folkman, J. Endostatin: An Endogenous Inhibitor of Angiogenesis and Tumor Growth. Cell 1997, 88, 277–285. [Google Scholar] [CrossRef] [Scilit]
- Azar, W.J.; Azar, S.H.X.; Higgins, S.; Hu, J.-F.; Hoffman, A.R.; Newgreen, D.F.; Werther, G.A.; Russo, V.C. IGFBP-2 Enhances VEGF Gene Promoter Activity and Consequent Promotion of Angiogenesis by Neuroblastoma Cells. Endocrinology 2011, 152, 3332–3342. [Google Scholar] [CrossRef] [Scilit]
- Cubbage, M.L.; Suwanichkul, A.; Powell, D.R. Insulin-like growth factor binding protein-3. Organization of the human chromosomal gene and demonstration of promoter activity. J. Biol. Chem. 1990, 265, 12642–12649. [Google Scholar] [CrossRef] [Scilit]
- Evoronov, E.; Ecarmi, Y.; Apte, R.N. The role IL-1 in tumor-mediated angiogenesis. Front. Physiol. 2014, 5, 114. [Google Scholar] [CrossRef] [Scilit]
- Strieter, R.M.; Polverini, P.J.; Kunkel, S.L.; Arenberg, D.; Burdick, M.D.; Kasper, J.; Dzuiba, J.; Van Damme, J.; Walz, A.; Marriott, D.; et al. The Functional Role of the ELR Motif in CXC Chemokine-mediated Angiogenesis. J. Biol. Chem. 1995, 270, 27348–27357. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nakasone, Y.; Fujimoto, M.; Matsushita, T.; Hamaguchi, Y.; Le Huu, D.; Yanaba, M.; Sato, S.; Takehara, K.; Hasegawa, M. Host-Derived MCP-1 and MIP-1α Regulate Protective Anti-Tumor Immunity to Localized and Metastatic B16 Melanoma. Am. J. Pathol. 2012, 180, 365–374. [Google Scholar] [CrossRef] [Scilit]
- Saleh, A.; Stathopoulou, M.G.; Dadé, S.; Ndiaye, N.C.; Azimi-Nezhad, M.; Murray, H.; Masson, C.; Lamont, J.V.; Fitzgerald, P.; Visvikis-Siest, S. Angiogenesis related genes NOS3, CD14, MMP3 and IL4R are associated to VEGF gene expression and circulating levels in healthy adults. BMC Med. Genet. 2015, 16, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maione, T.E.; Gray, G.S.; Petro, J.; Hunt, A.J.; Donner, A.L.; Bauer, S.I.; Carson, H.F.; Sharpe, R.J. Inhibition of angiogenesis by recombinant human platelet factor-4 and related peptides. Science 1990, 247, 77–79. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carmeliet, P.; Moons, L.; Luttun, A.; Vincenti, V.; Compernolle, V.; De Mol, M.; Wu, Y.; Bono, F.; Devy, L.; Beck, H.; et al. Synergism between vascular endothelial growth factor and placental growth factor contributes to angiogenesis and plasma extravasation in pathological conditions. Nat. Med. 2001, 7, 575–583. [Google Scholar] [CrossRef] [Scilit]
- Ziegler, M.E.; Hatch, M.M.S.; Wu, N.; Muawad, S.A.; Hughes, C.C.W. mTORC2 mediates CXCL12-induced angiogenesis. Angiogenesis 2016, 19, 359–371. [Google Scholar] [CrossRef] [Scilit]
- Good, D.J.; Polverini, P.J.; Rastinejad, F.; Le Beau, M.M.; Lemons, R.S.; Frazier, W.A.; Bouck, N.P. A tumor suppressor-dependent inhibitor of angiogenesis is immunologically and functionally indistinguishable from a fragment of thrombospondin. Proc. Natl. Acad. Sci. USA 1990, 87, 6624–6628. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Gene | Forward Primer (5′ → 3′) | Reverse Primer (5′ → 3′) |
|---|---|---|
| Cyclophilin A | CGCCACTGTCGCTTTTCG | AACTTTGTCTGCAAACAGCTC |
| CYCLOPHILIN A | AGTCCATCTATGGGGAGAAATTTG | GCCTCCACAATATTCATGCCTTC |
| CYCLIN D1 | GCTCCTGTGCTGCGAAGTGGA | TCATGGCCAGCGGGAAGACCT |
| HIF1α | CAGTCGACACAGCCTGGATA | CCACCTCTTTTGGCAAGCAT |
| PHD2 | TGGAGATGGAAGATGTGTGA | GCTCTCTCATCTGCATCAAA |
| Vegf-a | GCACATAGGAGAGATGAGCTTCC | CTCCGCTCTGAACAAGGCT |
| VEGF-A | GCACATAGGAGAGATGAGCTTCC | CTCCGCTCTGAGCAAGGCC |
| Vegfr-1 | GCACATGACGGAAGGAAGAC | TTCGCAGTTCAGCAGTCCTA |
| VEGFR-2 | ACAAGTGCTTCTACCGGGAA | GGACCCGAGACATGGAATCA |
| Vegfr-2 | TTGTTGGCGATGAACTCACC | TCCATAGGCGAGATCAAGGC |
| GLUT-1 | ATCCTGCCCACCACGCTCAC | CACGAAGGCCAGCAGGTTCA |
| MCT-1 | TCGGGTGGCTCAGCTCCGTA | AGATACCTGAAATAATTAGG |
| Keratin 6 | GGCTGAGGAGCGGCGTGAACAG | AAGGAGGCAAACTTGTTGTTGAG |
| Keratin 8 | ACAACAAGTTCGCCTCCTTC | TCTCCATCTCTGTACGCTTGT |
| LDHA | CAACATGGCAGCCTTTTCCT | ACCCACCCATGACAGCTTAA |
| LDHB | GCGTGATTGGAAGTGGATGT | AACACCTGCCACATTCACAC |
| PKM1 | CAGCCAAAGGGGACTATCCT | GAGGCTCGCACAAGTTCTTC |
| PKM2 | CTATCCTCTGGAGGCTGTGC | GTGGGGTCGCTGGTAATG |
| VEGFA-TRE-ChIP | CCCAAAAGCAGGTCACTCAC | CGGCTTGGGGAGATTGCTCTA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Miro, C.; Nappi, A.; Cicatiello, A.G.; Di Cicco, E.; Sagliocchi, S.; Murolo, M.; Belli, V.; Troiani, T.; Albanese, S.; Amiranda, S.; et al. Thyroid Hormone Enhances Angiogenesis and the Warburg Effect in Squamous Cell Carcinomas. Cancers 2021, 13, 2743. https://doi.org/10.3390/cancers13112743
Miro C, Nappi A, Cicatiello AG, Di Cicco E, Sagliocchi S, Murolo M, Belli V, Troiani T, Albanese S, Amiranda S, et al. Thyroid Hormone Enhances Angiogenesis and the Warburg Effect in Squamous Cell Carcinomas. Cancers. 2021; 13(11):2743. https://doi.org/10.3390/cancers13112743
Chicago/Turabian StyleMiro, Caterina, Annarita Nappi, Annunziata Gaetana Cicatiello, Emery Di Cicco, Serena Sagliocchi, Melania Murolo, Valentina Belli, Teresa Troiani, Sandra Albanese, Sara Amiranda, and et al. 2021. "Thyroid Hormone Enhances Angiogenesis and the Warburg Effect in Squamous Cell Carcinomas" Cancers 13, no. 11: 2743. https://doi.org/10.3390/cancers13112743
APA StyleMiro, C., Nappi, A., Cicatiello, A. G., Di Cicco, E., Sagliocchi, S., Murolo, M., Belli, V., Troiani, T., Albanese, S., Amiranda, S., Zavacki, A. M., Stornaiuolo, M., Mancini, M., Salvatore, D., & Dentice, M. (2021). Thyroid Hormone Enhances Angiogenesis and the Warburg Effect in Squamous Cell Carcinomas. Cancers, 13(11), 2743. https://doi.org/10.3390/cancers13112743

