Human Aquaporin-5 Facilitates Hydrogen Peroxide Permeation Affecting Adaption to Oxidative Stress and Cancer Cell Migration
Abstract
:1. Introduction
2. Results
2.1. Human AQP5 is Localized and Functional at the Yeast Plasma Membrane
2.2. S183 and H173 are Important Residues for AQP5 Gating
2.3. Human AQP5 Transports Hydrogen Peroxide
2.4. AQP5 Regulates Cellular Resistance to Oxidative Stress
2.5. AQP5 Shows High Peroxiporin Activity in Pancreatic Cancer Cells
2.6. Effect of AQP-Mediated H2O2 Transport on Cell Migration
3. Discussion
4. Materials and Methods
4.1. Yeast Strains and Growth Conditions
4.2. Cloning and Heterologous Expression of AQP5 in S. Cerevisiae
4.3. AQP5 Subcellular Localization by Fluorescence Microscopy
4.4. Cell Culture
4.5. Transfection with siRNA for AQP Silencing
4.6. RNA Isolation and Real Time RT-PCR
4.7. Migration Assay
4.8. Water Permeability Measurements
4.9. Hydrogen Peroxide Consumption
4.10. Intracellular ROS Analysis
4.11. Intracellular ROS Analysis
4.12. Preparation of Cell Lysates for Colorimetric Assay
4.13. Preparation of Cell Lysates for Colorimetric Assay
4.14. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Carbrey, J.M.; Agre, P. Discovery of the aquaporins and development of the field. Handb. Exp. Pharm. 2009, 190, 3–28. [Google Scholar] [CrossRef]
- Benga, G. On the definition, nomenclature and classification of water channel proteins (aquaporins and relatives). Mol. Asp. Med. 2012, 33, 514–517. [Google Scholar] [CrossRef] [PubMed]
- Bienert, G.P.; Moller, A.L.; Kristiansen, K.A.; Schulz, A.; Moller, I.M.; Schjoerring, J.K.; Jahn, T.P. Specific aquaporins facilitate the diffusion of hydrogen peroxide across membranes. J. Biol. Chem. 2007, 282, 1183–1192. [Google Scholar] [CrossRef] [PubMed]
- Miller, E.W.; Dickinson, B.C.; Chang, C.J. Aquaporin-3 mediates hydrogen peroxide uptake to regulate downstream intracellular signaling. Proc. Natl. Acad. Sci. USA 2010, 107, 15681–15686. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Prata, C.; Facchini, C.; Leoncini, E.; Lenzi, M.; Maraldi, T.; Angeloni, C.; Zambonin, L.; Hrelia, S.; Fiorentini, D. Sulforaphane Modulates AQP8-Linked Redox Signalling in Leukemia Cells. Oxid. Med. Cell Longev. 2018, 2018, 4125297. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, C.; Mosca, A.F.; Martins, A.P.; Nobre, T.; Prista, C.; Antunes, F.; Cipak Gasparovic, A.; Soveral, G. Rat Aquaporin-5 Is pH-Gated Induced by Phosphorylation and Is Implicated in Oxidative Stress. Int. J. Mol. Sci. 2016, 17, 2090. [Google Scholar] [CrossRef] [PubMed]
- Watanabe, S.; Moniaga, C.S.; Nielsen, S.; Hara-Chikuma, M. Aquaporin-9 facilitates membrane transport of hydrogen peroxide in mammalian cells. Biochem. Biophys. Res. Commun. 2016, 471, 191–197. [Google Scholar] [CrossRef] [PubMed]
- Verkman, A.S. Aquaporins in clinical medicine. Annu. Rev. Med. 2012, 63, 303–316. [Google Scholar] [CrossRef] [PubMed]
- Da Silva, I.V.; Rodrigues, J.S.; Rebelo, I.; Miranda, J.P.G.; Soveral, G. Revisiting the metabolic syndrome: the emerging role of aquaglyceroporins. Cell Mol. Life Sci. 2018, 75, 1973–1988. [Google Scholar] [CrossRef] [PubMed]
- Nico, B.; Ribatti, D. Aquaporins in tumor growth and angiogenesis. Cancer Lett. 2010, 294, 135–138. [Google Scholar] [CrossRef] [PubMed]
- Papadopoulos, M.C.; Saadoun, S. Key roles of aquaporins in tumor biology. Biochim. Biophys. Acta 2015, 1848, 2576–2583. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Acharya, A.; Das, I.; Chandhok, D.; Saha, T. Redox regulation in cancer: a double-edged sword with therapeutic potential. Oxid. Med. Cell Longev. 2010, 3, 23–34. [Google Scholar] [CrossRef] [PubMed]
- Schieber, M.; Chandel, N.S. ROS function in redox signaling and oxidative stress. Curr. Biol. 2014, 24, R453–R462. [Google Scholar] [CrossRef] [PubMed]
- Marinho, H.S.; Real, C.; Cyrne, L.; Soares, H.; Antunes, F. Hydrogen peroxide sensing, signaling and regulation of transcription factors. Redox Biol. 2014, 2, 535–562. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sies, H. Hydrogen peroxide as a central redox signaling molecule in physiological oxidative stress: Oxidative eustress. Redox Biol. 2017, 11, 613–619. [Google Scholar] [CrossRef] [PubMed]
- Direito, I.; Madeira, A.; Brito, M.A.; Soveral, G. Aquaporin-5: from structure to function and dysfunction in cancer. Cell Mol. Life Sci. 2016, 73, 1623–1640. [Google Scholar] [CrossRef] [PubMed]
- Direito, I.; Paulino, J.; Vigia, E.; Brito, M.A.; Soveral, G. Differential expression of aquaporin-3 and aquaporin-5 in pancreatic ductal adenocarcinoma. J. Surg. Oncol. 2017, 115, 980–996. [Google Scholar] [CrossRef] [PubMed]
- Satooka, H.; Hara-Chikuma, M. Aquaporin-3 Controls Breast Cancer Cell Migration by Regulating Hydrogen Peroxide Transport and Its Downstream Cell Signaling. Mol. Cell Biol. 2016, 36, 1206–1218. [Google Scholar] [CrossRef] [Green Version]
- Prata, C.; Hrelia, S.; Fiorentini, D. Peroxiporins in Cancer. Int. J. Mol. Sci. 2019, 20, 1371. [Google Scholar] [CrossRef]
- Fischer, G.; Kosinska-Eriksson, U.; Aponte-Santamaria, C.; Palmgren, M.; Geijer, C.; Hedfalk, K.; Hohmann, S.; de Groot, B.L.; Neutze, R.; Lindkvist-Petersson, K. Crystal structure of a yeast aquaporin at 1.15 angstrom reveals a novel gating mechanism. PLOS Biol. 2009, 7, e1000130. [Google Scholar] [CrossRef]
- Mosca, A.F.; de Almeida, A.; Wragg, D.; Martins, A.P.; Sabir, F.; Leoni, S.; Moura, T.F.; Prista, C.; Casini, A.; Soveral, G. Molecular Basis of Aquaporin-7 Permeability Regulation by pH. Cells 2018, 7, 207. [Google Scholar] [CrossRef] [PubMed]
- Kitchen, P.; Oberg, F.; Sjohamn, J.; Hedfalk, K.; Bill, R.M.; Conner, A.C.; Conner, M.T.; Tornroth-Horsefield, S. Plasma Membrane Abundance of Human Aquaporin 5 Is Dynamically Regulated by Multiple Pathways. PLoS ONE 2015, 10, e0143027. [Google Scholar] [CrossRef]
- Kang, S.K.; Chae, Y.K.; Woo, J.; Kim, M.S.; Park, J.C.; Lee, J.; Soria, J.C.; Jang, S.J.; Sidransky, D.; Moon, C. Role of human aquaporin 5 in colorectal carcinogenesis. Am. J. Pathol. 2008, 173, 518–525. [Google Scholar] [CrossRef] [PubMed]
- Janosi, L.; Ceccarelli, M. The gating mechanism of the human aquaporin 5 revealed by molecular dynamics simulations. PLoS ONE 2013, 8, e59897. [Google Scholar] [CrossRef] [PubMed]
- Hub, J.S.; de Groot, B.L. Mechanism of selectivity in aquaporins and aquaglyceroporins. Proc. Natl. Acad. Sci. USA 2008, 105, 1198–1203. [Google Scholar] [CrossRef] [Green Version]
- Bertolotti, M.; Bestetti, S.; Garcia-Manteiga, J.M.; Medrano-Fernandez, I.; Dal Mas, A.; Malosio, M.L.; Sitia, R. Tyrosine kinase signal modulation: a matter of H2O2 membrane permeability? Antioxid. Redox Signal. 2013, 19, 1447–1451. [Google Scholar] [CrossRef] [PubMed]
- Halliwell, B. Oxidative stress and cancer: have we moved forward? Biochem. J. 2007, 401, 1–11. [Google Scholar] [CrossRef]
- Martins, A.P.; Marrone, A.; Ciancetta, A.; Galan Cobo, A.; Echevarria, M.; Moura, T.F.; Re, N.; Casini, A.; Soveral, G. Targeting aquaporin function: potent inhibition of aquaglyceroporin-3 by a gold-based compound. PLoS ONE 2012, 7, e37435. [Google Scholar] [CrossRef]
- Hara-Chikuma, M.; Verkman, A.S. Aquaporin-3 facilitates epidermal cell migration and proliferation during wound healing. J. Mol. Med. (Berl.) 2008, 86, 221–231. [Google Scholar] [CrossRef]
- Stroka, K.M.; Jiang, H.; Chen, S.H.; Tong, Z.; Wirtz, D.; Sun, S.X.; Konstantopoulos, K. Water permeation drives tumor cell migration in confined microenvironments. Cell 2014, 157, 611–623. [Google Scholar] [CrossRef]
- Huang, B.K.; Sikes, H.D. Quantifying intracellular hydrogen peroxide perturbations in terms of concentration. Redox Biol. 2014, 2, 955–962. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Domenech, A.; Ayte, J.; Antunes, F.; Hidalgo, E. Using in vivo oxidation status of one- and two-component redox relays to determine H2O2 levels linked to signaling and toxicity. BMC Biol. 2018, 16, 61. [Google Scholar] [CrossRef] [PubMed]
- Lyublinskaya, O.; Antunes, F. Measuring intracellular concentration of hydrogen peroxide with the use of genetically encoded H2O2 biosensor HyPer. Redox Biol. 2019, 24, 101200. [Google Scholar] [CrossRef] [PubMed]
- Pronk, J.T. Auxotrophic yeast strains in fundamental and applied research. Appl. Environ. Microbiol. 2002, 68, 2095–2100. [Google Scholar] [CrossRef] [PubMed]
- Gotfryd, K.; Mosca, A.F.; Missel, J.W.; Truelsen, S.F.; Wang, K.; Spulber, M.; Krabbe, S.; Helix-Nielsen, C.; Laforenza, U.; Soveral, G.; et al. Human adipose glycerol flux is regulated by a pH gate in AQP10. Nat. Commun. 2018, 9, 4749. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Da Silva, I.V.; Barroso, M.; Moura, T.; Castro, R.; Soveral, G. Endothelial Aquaporins and Hypomethylation: Potential Implications for Atherosclerosis and Cardiovascular Disease. Int. J. Mol. Sci. 2018, 19, 130. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Soveral, G.; Madeira, A.; Loureiro-Dias, M.C.; Moura, T.F. Water transport in intact yeast cells as assessed by fluorescence self-quenching. Appl. Environ. Microbiol. 2007, 73, 2341–2343. [Google Scholar] [CrossRef]
- Antunes, F.; Cadenas, E. Estimation of H2O2 gradients across biomembranes. FEBS Lett. 2000, 475, 121–126. [Google Scholar] [CrossRef]
- Noronha, H.; Araujo, D.; Conde, C.; Martins, A.P.; Soveral, G.; Chaumont, F.; Delrot, S.; Geros, H. The Grapevine Uncharacterized Intrinsic Protein 1 (VvXIP1) Is Regulated by Drought Stress and Transports Glycerol, Hydrogen Peroxide, Heavy Metals but Not Water. PLoS ONE 2016, 11, e0160976. [Google Scholar] [CrossRef]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Goth, L. A simple method for determination of serum catalase activity and revision of reference range. Clin. Chim. Acta 1991, 196, 143–151. [Google Scholar] [CrossRef]
AQP5UG35fw: 5’ ATACATAGATACAATTCTATTACCCCCATCCATACTAAGATAATTATGAAGAAGGAGGTGTGCTC 3’ |
AQP5UG35rv: 5’ ACAACACCAGTGAATAATTCTTCACCTTTAGACATTCAGCGGGTGGTCAGCTC 3’ |
AQP5UG35GFPrv: 5’ ACAACACCAGTGAATAATTCTTCACCTTTAGACATGCGGGTGGTCAGCTCCA 3’ |
H173AAqp5fw: 5’ ACCCTGGGCGCACTTGTCGGAATC 3’ |
H173AAqp5rv: 5’ GATTCCGACAAGTGCGCCCAGGGT 3’ |
H173WAqp5fw: 5’ ACCCTGGGCTGGCTTGTCGGAATC 3’ |
H173WAqp5rv: 5’ GATTCCGACAAGCCAGCCCAGGGT 3’ |
S156AAqp5fw: 5’ CGCCGCACCGCACCTGTGGGCT 3’ |
S156AAqp5rv: 5’ AGCCCACAGGTGCGGTGCGGCG 3’ |
S156EAqp5fw: 5’ CGCCGCACCGAACCTGTGGGCT 3’ |
S156EAqp5rv: 5’ AGCCCACAGGTTCGGTGCGGCG 3’ |
S183AAqp5fw: 5’ CACTGGCTGCGCAATGAACCCAGC 3’ |
S183AAqp5rv: 5’ GCTGGGTTCATTGCGCAGCCAGTG 3’ |
S183EAqp5fw: 5’ CACTGGCTGCGAAATGAACCCAGC 3’ |
S183EAqp5rv: 5’ GCTGGGTTCATTTCGCAGCCAGTG 3’ |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rodrigues, C.; Pimpão, C.; Mósca, A.F.; Coxixo, A.S.; Lopes, D.; da Silva, I.V.; Pedersen, P.A.; Antunes, F.; Soveral, G. Human Aquaporin-5 Facilitates Hydrogen Peroxide Permeation Affecting Adaption to Oxidative Stress and Cancer Cell Migration. Cancers 2019, 11, 932. https://doi.org/10.3390/cancers11070932
Rodrigues C, Pimpão C, Mósca AF, Coxixo AS, Lopes D, da Silva IV, Pedersen PA, Antunes F, Soveral G. Human Aquaporin-5 Facilitates Hydrogen Peroxide Permeation Affecting Adaption to Oxidative Stress and Cancer Cell Migration. Cancers. 2019; 11(7):932. https://doi.org/10.3390/cancers11070932
Chicago/Turabian StyleRodrigues, Claudia, Catarina Pimpão, Andreia F. Mósca, Ana S. Coxixo, Duarte Lopes, Inês Vieira da Silva, Per Amstrup Pedersen, Fernando Antunes, and Graça Soveral. 2019. "Human Aquaporin-5 Facilitates Hydrogen Peroxide Permeation Affecting Adaption to Oxidative Stress and Cancer Cell Migration" Cancers 11, no. 7: 932. https://doi.org/10.3390/cancers11070932