Optical Monitoring of the Production Quality of Si-Nanoribbon Chips Intended for the Detection of ASD-Associated Oligonucleotides
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. Oligonucleotides
2.3. Fabrication of Si-NR Chips
2.4. SEM Analysis
2.5. Functionalization of Si-NR Chip Surface
2.6. Preparation of Buffered Solutions of Target oDNAs
2.7. Electrical Measurements
3. Results
3.1. Optical Control of Si-NR Chip Quality
3.2. Tests of the Si-NR Chip Performance
3.3. Biospecific Detection of oDNAs in Buffer with the Si-NR Chip
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- World Health Organization. Autism Spectrum Disorders. Available online: https://www.who.int/news-room/fact-sheets/detail/autism-spectrum-disorders (accessed on 10 November 2020).
- American Psychiatric Association. Diagnostic and Statistical Manual of Mental Disorders Source Information, 4th ed.; DSM-IV-TR Text Revision; American Psychiatric Association, Ed.; American Psychiatric Association: Washington, DC, USA, 2000; Available online: https://www.psychiatry.org/ (accessed on 5 September 2020).
- Myers, S.M.; Johnson, C.P.; The Council on Children with Disabilities. Management of children with autism spectrum disorders. Pediatrics 2007, 120, 1162–1182. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Elsabbagh, M.; Divan, G.; Koh, Y.-J.; Kim, Y.S.; Kauchali, S.; Marcín, C.; Montiel-Nava, C.; Patel, V.; Paula, C.S.; Wang, C.; et al. Global prevalence of autism and other pervasive developmental disorders. Autism Res. 2012, 5, 160–179. [Google Scholar] [CrossRef] [Green Version]
- Ristori, M.V.; Mortera, S.L.; Marzano, V.; Guerrera, S.; Vernocchi, P.; Ianiro, G.; Gardini, S.; Torre, G.; Valeri, G.; Vicari, S.; et al. Proteomics and metabolomics approaches towards a functional insight onto AUTISM spectrum Disorders: Phenotype stratification and biomarker discovery. Int. J. Mol. Sci. 2020, 21, 6274. [Google Scholar] [CrossRef] [PubMed]
- Abraham, J.R.; Szoko, N.; Barnard, J.; Rubin, R.A.; Schlatzer, D.; Lundberg, K.; Li, X.; Natowicz, M.R. Proteomic investigations of autism brain identify known and novel pathogenetic processes. Sci. Rep. 2019, 9, 13118. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kaysheva, A.L.; Kopylov, A.T.; Yurov, I.; Vorsanova, S.G.; Yurov, Y.; Galiullin, R.; Anashkina, A.; Archakov, A.; Ivanov, Y. Proteomic analysis of blood serum protein profiles in children with autism. Vopr. Prakt. Pediatr. 2016, 11, 12–17. [Google Scholar] [CrossRef]
- Kaysheva, A.L.; Pleshakova, T.O.; Kopylov, A.T.; Shumov, I.D.; Iourov, I.Y.; Vorsanova, S.G.; Yurov, Y.B.; Ziborov, V.S.; Archakov, A.I.; Ivanov, Y.D. Combination of atomic force microscopy and mass spectrometry for the detection of target protein in the serum samples of children with autism spectrum disorders. IOP Conf. Ser. Mater. Sci. Eng. 2017, 256, 012015. [Google Scholar] [CrossRef] [Green Version]
- Khramova, T.V.; Kaysheva, A.L.; Ivanov, Y.D.; Pleshakova, T.O.; Iourov, I.Y.; Vorsanova, S.G.; Yurov, Y.B.; Schetkin, A.A.; Archakov, A.I. Serologic markers of autism spectrum disorder. J. Mol. Neurosci. 2017, 62, 420–429. [Google Scholar] [CrossRef] [PubMed]
- Kaysheva, A.L.; Stepanov, A.A.; Kopylov, A.T.; Butkova, T.V.; Pleshakovaa, T.; Ryabtsev, V.V.; Iourov, I.Y.; Vorsanova, S.G.; Ivanov, Y.D. Pilot data of serum proteins from children with autism spectrum disorders. Data Brief. 2019, 27, 104558. [Google Scholar] [CrossRef]
- Archakov, A.I.; Ivanov, Y.D.; Lisitsa, A.V.; Zgoda, V.G. AFM fishing nanotechnology is the way to reverse the Avogadro number in proteomics. Proteomics 2007, 7, 4–9. [Google Scholar] [CrossRef]
- Lord, C.; Risi, S.; DiLavore, P.S.; Shulman, C.; Thurm, A.; Pickles, A. Autism from 2 to 9 years of age. Arch. Gen. Psychiatry 2006, 63, 694–701. [Google Scholar] [CrossRef]
- Rissin, D.M.; Kan, C.W.; Campbell, T.G.; Howes, S.C.; Fournier, D.R.; Song, L.; Piech, T.; Patel, P.P.; Chang, L.; Rivnak, A.J.; et al. Single-molecule enzyme-linked immunosorbent assay detects serum proteins at subfemtomolar concentrations. Nat. Biotechnol. 2010, 28, 595–599. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Archakov, A.I.; Ivanov, Y.D. Analytical nanobiotechnology for medicine diagnostics. Mol. BioSyst. 2007, 3, 336–342. [Google Scholar] [CrossRef] [PubMed]
- Zheng, G.; Patolsky, F.; Cui, Y.; Wang, W.U.; Lieber, C.M. Multiplexed electrical detection of cancer markers with nanowire sensor arrays. Nat. Biotechnol. 2005, 23, 1294–1301. [Google Scholar] [CrossRef] [PubMed]
- Elfström, N.; Juhasz, R.; Sychugov, I.; Engfeldt, T.; Karlström, A.E.; Linnros, J. Surface charge sensitivity of silicon nanowires: Size dependence. Nano Lett. 2007, 7, 2608–2612. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hahm, J.-I.; Lieber, C.M. Direct ultrasensitive electrical detection of DNA and DNA sequence variations using nanowire nanosensors. Nano Lett. 2004, 4, 51–54. [Google Scholar] [CrossRef]
- Gupta, R.; Xiong, Q.; Adu, C.K.; Kim, U.J.; Eklund, P.C. Laser-induced fano resonance scattering in silicon nanowires. Nano Lett. 2003, 3, 627–631. [Google Scholar] [CrossRef]
- Hofmann, S.; Ducati, C.; Neill, R.J.; Piscanec, S.; Ferrari, A.C.; Geng, J.; Dunin-Borkowski, R.E.; Robertson, J. Gold catalyzed growth of silicon nanowires by plasma enhanced chemical vapor deposition. J. Appl. Phys. 2003, 94, 6005–6012. [Google Scholar] [CrossRef]
- Eklund, P.C. Proceedings of the XVIIIth International Conference on Raman Spectroscopy; Wiley: New York, NY, USA, 2020. [Google Scholar]
- Møller, H.G.; Rasmussen, A.P.; Andersen, H.H.; Johnsen, K.B.; Henriksen, M.; Duroux, M. A systematic review of MicroRNA in glioblastoma multiforme: Micro-modulators in the mesenchymal mode of migration and invasion. Mol. Neurobiol. 2013, 47, 131–144. [Google Scholar] [CrossRef] [Green Version]
- Mohyeldin, A.; Chiocca, E.A. Gene and viral therapy for glioblastoma: A review of clinical trials and future directions. Cancer J. 2012, 18, 82–88. [Google Scholar] [CrossRef]
- Shimomura, A.; Shiino, S.; Kawauchi, J.; Takizawa, S.; Sakamoto, H.; Matsuzaki, J.; Ono, M.; Takeshita, F.; Niida, S.; Shimizu, C.; et al. Novel combination of serum microRNA for detecting breast cancer in the early stage. Cancer Sci. 2016, 107, 326–334. [Google Scholar] [CrossRef]
- Wu, H.; Mo, Y.-Y. Targeting miR-205 in breast cancer. Expert Opin. Ther. Targets 2009, 13, 1439–1448. [Google Scholar] [CrossRef] [PubMed]
- Tonacci, A.; Bagnato, G.L.; Pandolfo, G.; Billeci, L.; Sansone, F.; Conte, R.; Gangemi, S. MicroRNA cross-involvement in autism spectrum disorders and atopic dermatitis: A literature review. J. Clin. Med. 2019, 8, 88. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vasu, M.M.; Anitha, A.; Thanseem, I.; Suzuki, K.; Yamada, K.; Takahashi, T.; Wakuda, T.; Iwata, K.; Tsujii, M.; Sugiyama, T.; et al. Serum microRNA profiles in children with autism. Mol. Autism 2014, 5, 40. [Google Scholar] [CrossRef] [Green Version]
- Malsagova, K.; Pleshakova, T.O.; Galiullin, R.A.; Shumov, I.D.; Kozlov, A.F.; Romanova, T.S.; Popov, V.P.; Glukhov, A.V.; Konev, V.A.; Archakov, A.I.; et al. Nanowire aptamer-sensitized biosensor chips with gas plasma-treated surface for the detection of hepatitis C virus core antigen. Coatings 2020, 10, 753. [Google Scholar] [CrossRef]
- Malsagova, K.A.; Pleshakova, T.O.; Galiullin, R.A.; Kozlov, A.F.; Romanova, T.S.; Shumov, I.D.; Popov, V.P.; Tikhonenko, F.V.; Glukhov, A.V.; Smirnov, A.Y.; et al. SOI-nanowire biosensor for the detection of glioma-associated miRNAs in plasma. Chemosensors 2020, 8, 95. [Google Scholar] [CrossRef]
- Ivanov, Y.D.; Pleshakova, T.O.; Kozlov, A.F.; Malsagova, K.A.; Krohin, N.V.; Shumyantseva, V.V.; Shumov, I.D.; Popov, V.P.; Naumova, O.V.; Fomin, B.I.; et al. SOI nanowire for the high-sensitive detection of HBsAg and α-fetoprotein. Lab Chip Miniat. Chem. Biol. 2012, 12, 5104–5111. [Google Scholar] [CrossRef] [PubMed]
- Popov, V.P.; Antonova, A.I.; Frantsuzov, A.A.; Safronov, L.N.; Feofanov, G.N.; Naumova, O.V.; Kilanov, D.V. Properties of silicon-on-insulator structures and devices. Semiconductors 2001, 35, 1030–1037. [Google Scholar] [CrossRef]
- Naumova, O.V.; Fomin, B.I.; Nasimov, D.A.; Dudchenko, N.V.; Devyatova, S.F.; Zhanaev, E.D.; Popov, V.P.; Latyshev, A.V.; Aseev, A.L.; Ivanov, Y.D.; et al. SOI nanowires as sensors for charge detection. Semicond. Sci. Technol. 2010, 25. [Google Scholar] [CrossRef]
- Laborde, C.; Pittino, F.; Verhoeven, H.A.; Lemay, S.J.G.; Selmi, L.; Jongsma, M.A.; Widdershoven, F.P. Real-time imaging of microparticles and living cells with CMOS nanocapacitor arrays. Nat. Nanotechnol. 2015, 10, 791–795. [Google Scholar] [CrossRef] [Green Version]
- Stern, E.; Wagner, R.; Sigworth, F.J.; Breaker, R.; Fahmy, T.M.; Reed, M.A. Importance of the debye screening length on nanowire field effect transistor sensors. Nano Lett. 2007, 7, 3405–3409. [Google Scholar] [CrossRef] [Green Version]
- Knopfmacher, O.; Tarasov, A.; Fu, W.; Wipf, M.; Niesen, B.; Calame, M.; Schoenenberger, C. Nernst limit in dual-gated si-nanowire FET sensors. Nano Lett. 2010, 10, 2268–2274. [Google Scholar] [CrossRef] [PubMed]
- Patolsky, F.; Zheng, G.; Hayden, O.; Lakadamyali, M.; Zhuang, X.; Lieber, C.M. Electrical detection of single viruses. Proc. Natl. Acad. Sci. USA 2004, 101, 14017–14022. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stern, E.W.; Klemic, J.F.; Routenberg, D.A.; Wyrembak, P.N.; Turner-Evans, D.B.; Hamilton, A.D.; LaVan, D.A.; Fahmy, T.M.; Reed, M.A. Label-free immunodetection with CMOS-compatible semiconducting nanowires. Nature 2007, 445, 519–522. [Google Scholar] [CrossRef] [PubMed]
- Wittmann, J.; Jäck, H.-M. Serum microRNAs as powerful cancer biomarkers. Biochim. Biophys. Acta 2010, 1806, 200–207. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Li, C.; Ma, J.; Wu, Y.; Ni, Z.; Chen, Y. Theoretical and experimental studies on ionic currents in nanopore-based biosensors. IET Nanobiotechnol. 2014, 8, 247–256. [Google Scholar] [CrossRef]
- Hartvig, R.A.; Van De Weert, M.; Ostergaard, J.; Jorgensen, L.; Jensen, H. Protein adsorption at charged surfaces: The role of electrostatic interactions and interfacial charge regulation. Langmuir 2011, 27, 2634–2643. [Google Scholar] [CrossRef]
No. | oDNA Probe | oDNA Sequence Complementary to the Probe («cs», Complementary Sequence) | Corresponding miRNA |
---|---|---|---|
1. | (NH2)-(T)10-CTACCTGCACTGTAAGCACTTTT (probe_1) | AAAAGTGCTTACAGTGCAGGTAG | miR-106a-5p [25] |
2. | (NH2)-(T)10-CGGCGCGACCGGCCCGGGG (probe_2) (control) | CCCCGGGCCGGTCGCGCCG | hsa-miR-4634 [23] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Malsagova, K.A.; Pleshakova, T.O.; Popov, V.P.; Kupriyanov, I.N.; Galiullin, R.A.; Kozlov, A.F.; Shumov, I.D.; Kaysheva, A.L.; Tikhonenko, F.V.; Archakov, A.I.; et al. Optical Monitoring of the Production Quality of Si-Nanoribbon Chips Intended for the Detection of ASD-Associated Oligonucleotides. Micromachines 2021, 12, 147. https://doi.org/10.3390/mi12020147
Malsagova KA, Pleshakova TO, Popov VP, Kupriyanov IN, Galiullin RA, Kozlov AF, Shumov ID, Kaysheva AL, Tikhonenko FV, Archakov AI, et al. Optical Monitoring of the Production Quality of Si-Nanoribbon Chips Intended for the Detection of ASD-Associated Oligonucleotides. Micromachines. 2021; 12(2):147. https://doi.org/10.3390/mi12020147
Chicago/Turabian StyleMalsagova, Kristina A., Tatyana O. Pleshakova, Vladimir P. Popov, Igor N. Kupriyanov, Rafael A. Galiullin, Andrey F. Kozlov, Ivan D. Shumov, Anna L. Kaysheva, Fedor V. Tikhonenko, Alexander I. Archakov, and et al. 2021. "Optical Monitoring of the Production Quality of Si-Nanoribbon Chips Intended for the Detection of ASD-Associated Oligonucleotides" Micromachines 12, no. 2: 147. https://doi.org/10.3390/mi12020147