Dietary l-Arginine Supplementation Protects Weanling Pigs from Deoxynivalenol-Induced Toxicity
Abstract
:1. Introduction
2. Results
2.1. Analysis of Moldy Corn
2.2. Free Amino Acid Concentration in Serum
Catalogue | AFB1 1 (ppb) | ZEN 2 (ppm) | OCH 3 (ppb) | FB1 4 (ppm) | T-2 (ppm) | DON 5 (ppm) |
---|---|---|---|---|---|---|
Limit of detection | 0.05 | 0.01 | 0.5 | 0.05 | 0.1 | 0.1 |
Basal feed | undetected | 0.863 | 3.74 | 0.65 | undetected | 0.52 |
Contaminated feed | undetected | 0.697 | 4.63 | 0.74 | undetected | - |
Items | Control 1 | DON 2 | DON + ARG 3 | SEM | p-Value |
---|---|---|---|---|---|
Arginine | 60.77 ± 11.86 b | 41.79 ± 6.76 a | 50.72 ± 6.76 ab | 2.707 | 0.007 |
Histidine | 40.27 ± 10.86 b | 25.66 ± 7.64 a | 30.70 ± 4.31 ab | 2.312 | 0.021 |
Isoleucine | 28.21 ± 6.59 b | 12.04 ± 6.36 a | 21.21 ± 4.58b | 2.072 | 0.001 |
Leucine | 49.18 ± 12.62 b | 31.83 ± 3.14 a | 36.84 ± 8.20 a | 2.644 | 0.012 |
Lysine | 85.28 ± 9.07 b | 66.07 ± 8.10 a | 69.10 ± 13.32 a | 3.083 | 0.013 |
Methionine | 32.93 ± 5.84 b | 21.38 ± 8.82 a | 26.77 ± 3.66 ab | 1.832 | 0.025 |
Phenylalanine | 28.29 ± 7.55 | 21.53 ± 3.69 | 23.90 ± 3.47 | 1.347 | 0.110 |
Threonine | 55.61 ± 17.86 b | 34.44 ± 8.56 a | 34.24 ± 16.89 ab | 4.121 | 0.040 |
Tryptophan | 38.17 ± 7.46 b | 22.19 ± 4.83 a | 25.30 ± 5.14 a | 2.130 | 0.001 |
Valine | 55.05 ± 20.95 b | 24.95 ± 7.36 a | 34.79 ± 10.88 a | 4.386 | 0.007 |
γ-amino-n-butyric acid | 0.08 ± 0.03 b | 0.11 ± 0.02 a | 0.10 ± 0.03 b | 0.007 | 0.108 |
Glycine | 156.07 ± 29.8 | 130.56 ± 20.5 | 136.14 ± 43.2 | 7.679 | 0.385 |
Serine | 34.94 ± 6.40 | 34.23 ± 14.11 | 33.07 ± 15.92 | 2.846 | 0.968 |
Taurine | 68.83 ± 12.01 | 50.72 ± 14.28 | 59.56 ± 15.74 | 3.599 | 0.118 |
Tyrosine | 32.82 ± 10.44 | 20.09 ± 5.74 | 26.91 ± 9.76 | 2.338 | 0.076 |
Asparagine | 21.72 ± 5.55 | 22.79 ± 12.02 | 23.79 ± 10.57 | 2.175 | 0.935 |
Aspartic acid | 5.80 ± 1.11 | 4.37 ± 0.98 | 6.33 ± 2.10 | 0.385 | 0.093 |
Citrulline | 18.25 ± 5.65 | 12.69 ± 4.34 | 15.48 ± 2.34 | 1.106 | 0.119 |
Glutamic acid | 48.45 ± 9.06 | 49.84 ± 4.69 | 44.39 ± 8.98 | 1.825 | 0.476 |
Glutamine | 326.46 ± 52.7 | 255.06 ± 50.0 | 309.51 ± 55.5 | 13.829 | 0.080 |
Ornithine | 23.36 ± 5.44 b | 14.66 ± 3.70 a | 17.30 ± 4.48 a | 1.347 | 0.015 |
Cystine | 1.02 ± 0.54 | 0.50 ± 0.29 | 0.63 ± 0.43 | 0.110 | 0.134 |
α-amino-n-butyric acid | 18.75 ± 7.81 | 16.30 ± 3.37 | 13.45 ± 6.16 | 1.442 | 0.343 |
Alanine | 131.44 ± 36.2 | 136.38 ± 39.3 | 138.11 ± 36.0 | 8.264 | 0.949 |
hydroxy-l-proline | 23.37 ± 7.88 | 21.28 ± 9.00 | 19.41 ± 11.35 | 2.144 | 0.775 |
1-methyl-l-histidine | 5.19 ± 1.29 b | 3.94 ± 2.06 a | 4.17 ± 0.32 a | 0.340 | 0.298 |
3-methyl-l-histidine | 0.86 ± 0.13 | 0.73 ± 0.37 | 0.84 ± 0.15 | 0.055 | 0.640 |
Proline | 49.11 ± 12.39 | 53.65 ± 12.41 | 39.29 ± 10.37 | 2.983 | 0.131 |
2.3. Free AA Concentrations in Ileum and Jejunum
Items | Control 1 | DON 2 | DON + ARG 3 | SEM | p-Value |
---|---|---|---|---|---|
Arginine | 18.30 ± 2.47 b | 13.59 ± 2.46 a | 14.67 ± 2.38 a | 0.728 | 0.011 |
Histidine | 6.44 ± 0.48 b | 5.12 ± 0.74 a | 5.23 ± 0.78 a | 0.208 | 0.007 |
Isoleucine | 6.67 ± 0.30 c | 4.42 ± 0.74 a | 5.20 ± 0.66 b | 0.262 | 0.000 |
Leucine | 15.61 ± 0.84 b | 11.64 ± 1.36 a | 12.80 ± 2.23 a | 0.535 | 0.002 |
Lysine | 27.47 ± 4.34 | 23.14 ± 6.05 | 23.39 ± 2.79 | 1.125 | 0.220 |
Methionine | 9.35 ± 0.61 b | 6.68 ± 0.97 a | 7.52 ± 1.67 a | 0.374 | 0.004 |
Phenylalanine | 8.68 ± 0.59 b | 6.83 ± 1.32 a | 7.11 ± 1.29 a | 0.318 | 0.025 |
Threonine | 14.31 ± 1.20 b | 10.98 ± 1.56 a | 12.08 ± 1.89 a | 0.484 | 0.007 |
Tryptophan | 1.50 ± 0.31 | 1.13 ± 0.25 | 1.34 ± 0.29 | 0.073 | 0.104 |
Valine | 12.51 ± 0.92 b | 8.17 ± 1.17 a | 8.96 ± 1.01 a | 0.512 | 0.000 |
γ-amino-n-butyric acid | 0.01 ± 0.00 | 0.02 ± 0.01 | 0.01 ± 0.00 | 0.002 | 0.327 |
Glycine | 53.28 ± 4.12 | 50.37 ± 11.81 | 48.60 ± 6.09 | 1.840 | 0.605 |
Serine | 24.59 ± 2.33 b | 19.66 ± 2.51 a | 19.76 ± 2.17 a | 0.762 | 0.003 |
Taurine | 45.72 ± 3.62 b | 35.96 ± 5.71 a | 34.28 ± 3.20 a | 1.552 | 0.001 |
Tyrosine | 9.44 ± 0.56 b | 6.64 ± 0.93 a | 6.99 ± 1.43 a | 0.379 | 0.001 |
Asparagine | 12.31 ± 1.17 | 10.28 ± 2.41 | 11.69 ± 2.37 | 0.502 | 0.250 |
Aspartic acid | 9.57 ± 2.17 | 8.91 ± 2.01 | 10.33 ± 1.70 | 0.458 | 0.477 |
Citrulline | 3.69 ± 0.95 b | 2.04 ± 0.51 a | 2.31 ± 0.42 a | 0.229 | 0.001 |
Glutamic acid | 42.43 ± 8.22 | 45.03 ± 9.81 | 45.66 ± 11.06 | 2.189 | 0.833 |
Glutamine | 271.15 ± 22.2 | 232.67 ± 57.6 | 227.00 ± 32.6 | 10.109 | 0.153 |
Ornithine | 4.58 ± 0.47 b | 2.79 ± 0.52 a | 2.86 ± 0.41 a | 0.226 | 0.000 |
Cystine | 0.66 ± 0.16 | 0.76 ± 0.18 | 0.55 ± 0.23 | 0.047 | 0.205 |
α-amino-n-butyric acid | 281.41 ± 87.9 | 211.73 ± 24.5 | 275.10 ± 59.1 | 15.863 | 0.139 |
Alanine | 32.10 ± 4.37 | 25.92 ± 7.66 | 30.41 ± 6.15 | 1.514 | 0.237 |
hydroxy-l-proline | 13.78 ± 2.24 | 13.00 ± 2.97 | 12.13 ± 1.67 | 0.547 | 0.498 |
1-methyl-l-histidine | 0.10 ± 0.05 | 0.07 ± 0.04 | 0.08 ± 0.04 | 0.010 | 0.540 |
3-methyl-l-histidine | 0.03 ± 0.01 | 0.02 ± 0.01 | 0.02 ± 0.01 | 0.004 | 0.493 |
Proline | 26.44 ± 2.30 | 23.83 ± 2.69 | 24.36 ± 2.40 | 0.612 | 0.188 |
Items | Control 1 | DON 2 | DON + ARG 3 | SEM | p-Value |
---|---|---|---|---|---|
Arginine | 17.08 ± 1.85 a | 11.46 ± 2.86 b | 12.62 ± 1.84 b | 0.769 | 0.001 |
Histidine | 5.20 ± 2.63 | 3.91 ± 1.04 | 4.39 ± 0.64 | 0.392 | 0.424 |
Isoleucine | 6.26 ± 1.01 a | 4.22 ± 1.06 b | 4.26 ± 0.70 b | 0.310 | 0.002 |
Leucine | 16.56 ± 2.09 a | 11.55 ± 2.96 b | 13.00 ± 2.47 b | 0.758 | 0.011 |
Lysine | 28.76 ± 5.27 a | 20.32 ± 3.96 b | 20.62 ± 2.19 b | 1.299 | 0.003 |
Methionine | 11.74 ± 1.63 a | 6.28 ± 1.93 b | 6.77 ± 1.64 b | 0.711 | 0.000 |
Phenylalanine | 8.70 ± 4.41 | 6.95 ± 1.87 | 7.43 ± 1.47 | 0.489 | 0.571 |
Threonine | 13.53 ± 1.17 a | 9.40 ± 2.01 b | 10.73 ± 2.34 b | 0.593 | 0.006 |
Tryptophan | 1.70 ± 0.23 a | 1.03 ± 0.43 b | 1.05 ± 0.39 b | 0.108 | 0.008 |
Valine | 13.74 ± 3.03 a | 8.25 ± 2.14 b | 8.37 ± 1.41 b | 0.802 | 0.001 |
γ-amino-n-butyric acid | 0.008 ± 0.004 | 0.008 ± 0.007 | 0.012 ± 0.008 | 0.002 | 0.609 |
Glycine | 43.57 ± 4.07 | 35.76 ± 5.37 | 42.45 ± 7.14 | 1.508 | 0.064 |
Serine | 24.45 ± 2.05 a | 17.89 ± 3.03 b | 20.72 ± 6.10 ab | 1.119 | 0.044 |
Taurine | 65.17 ± 9.73 a | 48.97 ± 2.13 b | 51.17 ± 7.73 b | 2.371 | 0.003 |
Tyrosine | 9.84 ± 0.69 a | 6.60 ± 1.40 b | 6.65 ± 1.23 b | 0.4.47 | 0.000 |
Asparagine | 14.08 ± 1.68 a | 8.93 ± 1.45 b | 10.21 ± 2.98 b | 0.712 | 0.002 |
Aspartic acid | 9.73 ± 2.75 | 8.09 ± 0.75 | 9.13 ± 1.74 | 0.457 | 0.354 |
Citrulline | 1.98 ± 0.39 | 2.04 ± 0.53 | 2.22 ± 0.56 | 0.113 | 0.711 |
Glutamic acid | 36.74 ± 1.82 a | 30.55 ± 3.86 b | 33.28 ± 5.22 ab | 1.058 | 0.046 |
Glutamine | 331.46 ± 51.9 a | 206.98 ± 41.1 b | 226.69 ± 40.2 b | 16.542 | 0.000 |
Ornithine | 4.16 ± 0.53 a | 2.80 ± 0.58 b | 3.12 ± 0.90 b | 0.208 | 0.010 |
Cystine | 1.11 ± 0.16 | 0.91 ± 0.32 | 0.84 ± 0.41 | 0.075 | 0.322 |
α-amino-n-butyric acid | 379.51 ± 120.9 | 281.96 ± 63.6 | 343.98 ± 66.4 | 21.738 | 0.184 |
Alanine | 32.66 ± 3.01 a | 26.33 ± 4.10 b | 29.81 ± 4.48 ab | 1.070 | 0.043 |
hydroxy-l-proline | 14.58 ± 0.97 | 15.55 ± 2.03 | 14.37 ± 1.26 | 0.352 | 0.362 |
1-methyl-l-histidine | 0.11 ± 0.05 | 0.10 ± 0.03 | 0.07 ± 0.02 | 0.009 | 0.188 |
3-methyl-l-histidine | 0.04 ± 0.01 a | 0.02 ± 0.01 b | 0.03 ± 0.02 ab | 0.004 | 0.028 |
Proline | 23.76 ± 1.55 a | 18.17 ± 3.36 b | 18.44 ± 4.38 b | 0.962 | 0.017 |
2.4. Jejunal Morphology Changes
Items | Control 1 | DON 2 | DON + ARG 3 | SEM | p-Value |
---|---|---|---|---|---|
villus height (μM) | 250.3 ± 23.2 a | 198.7 ± 31.4 b | 228.5 ± 26.8 ab | 14.955 | 0.0173 |
crypt depth (μM) | 102.4 ± 11.7 | 92.7 ± 14.2 | 97.6 ± 10.3 | 2.800 | 0.4080 |
villus height/crypt depth | 2.46 ± 0.21 a | 2.13 ± 0.19 b | 2.35 ± 0.15 ab | 0.096 | 0.0224 |
2.5. Expression of Nutrient Transporters
3. Discussion
Items | Control 1 | DON 2 | DON + ARG 3 | SEM | p-Value |
---|---|---|---|---|---|
SGLT-1 4 | 1.38 ± 0.08 a | 0.68 ± 0.05 c | 0.81 ± 0.09 b | 0.215 | <0.0001 |
GLUT-2 5 | 1.00 ± 0.08 a | 0.66 ± 0.13 b | 0.78 ± 0.15 b | 0.100 | 0.0009 |
y+LAT-1 6 | 1.00 ± 0.12 a | 0.75 ± 0.09 b | 0.97 ± 0.10 a | 0.079 | 0.0015 |
ASCT-2 7 | 1.07 ± 0.19 a | 0.98 ± 0.07 b | 1.02 ± 0.13 b | 0.026 | 0.5450 |
B0,+AT 8 | 1.26 ± 0.13 | 1.14 ± 0.080 | 1.12 ± 0.180 | 0.044 | 0.1909 |
PepT-1 9 | 1.16 ± 0.15 | 1.07 ± 0.12 | 1.21 ± 0.09 | 0.041 | 0.1681 |
4. Experimental Section
4.1. Preparation of Moldy Corn
4.2. Animals and Management
Ingredients | Contents (%) | Nutrient Levels | Contents |
---|---|---|---|
Extrusion corn | 60 | Digestive energy, MJ/kg | 14.48 |
Acidifier | 0.24 | Crude protein, % | 20.90 |
Additive premix 1 | 0.85 | Lysine·HCl, % | 1.48 |
Glucose | 3.2 | Methionine, % | 0.42 |
Fish meal | 2 | Threonine, % | 0.90 |
Soybean meal | 20 | Calcium, % | 0.80 |
CaHPO4 | 1.2 | Available phosphorus, % | 0.45 |
Limestone | 1.19 | ||
Soybean oil | 2 | ||
Lysine·HCl | 0.28 | ||
Threonine | 0.04 |
4.3. Sample Collection
4.4. Determination of Free Amino Acids Profile in Serum, Ileum and Jejunum
4.5. Determination of Jejunal Morphology
4.6. RNA Extraction and cDNA Synthesis
4.7. Quantification of mRNA by Real-Time RT-PCR Analysis
4.8. Statistical Analysis
Target Gene | Primer Sequence (5' to 3') | Accession No. | Size |
---|---|---|---|
B0,+AT-F1 1 | GCGAGTACCCGTACCTGATG | NM_001110171.1 | 173 |
B0,+AT-R1 | TTTCACGACGACTTGAGGGG | ||
SGLT1-F1 2 | TCATCATCGTCCTGGTCGTCTC | M34044.1 | 144 |
SGLT1-R1 | CTTCTGGGGCTTCTTGAATGTC | ||
GLUT2-F1 3 | ATTGTCACAGGCATTCTTGTTAGTCA | NM_001097417 | 273 |
GLUT2-R1 | TTCACTTGATGCTTCTTCCCTTTC | ||
y+LAT1-F1 4 | TTCTCTTACTCGGGCTGGGA | EU047705.1 | 400 |
y+LAT1-R1 | GCGCCATGAGACCATTGAAC | ||
GAPDH-F1 5 | AAGGAGTAAGAGCCCCTGGA | DQ845173 | 140 |
GAPDH-R1 | TCTGGGATGGAAACTGGAA | ||
ASCT2-F1 6 | CTGGTCTCCTGGATCATGTGG | DQ231578.1 | 172 |
ASCT2-R1 | CAGGAAGCGGTAGGGGTTTT | ||
PepT1-R1 7 | CAGACTTCGACCACAACGGA | NM_214347.1 | 99 |
PepT1-F1 | TTATCCCGCCAGTACCCAGA |
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Sobrova, P.; Adam, V.; Vasatkova, A.; Beklova, M.; Zeman, L.; Kizek, R. Deoxynivalenol and its toxicity. Interdiscip. Toxicol. 2010, 3, 94–99. [Google Scholar] [CrossRef] [PubMed]
- Yazar, S.; Omurtag, G.Z. Fumonisins, trichothecenes and zearalenone in cereals. Int. J. Mol. Sci. 2008, 9, 2062–2090. [Google Scholar] [CrossRef] [PubMed]
- Pestka, J.J.; Smolinski, A.T. Deoxynivalenol: Toxicology and potential effects on humans. J. Toxicol. Environ. Health B Crit. Rev. 2005, 8, 39–69. [Google Scholar] [CrossRef] [PubMed]
- Pinton, P.; Accensi, F.; Beauchamp, E.; Cossalter, A.M.; Callu, P.; Grosjean, F.; Oswald, I.P. Ingestion of deoxynivalenol (DON) contaminated feed alters the pig vaccinal immune responses. Toxicol. Lett. 2008, 177, 215–222. [Google Scholar] [CrossRef] [PubMed]
- Oswald, I.P. Role of intestinal epithelial cells in the innate immune defence of the pig intestine. Vet. Res. 2006, 37, 359–368. [Google Scholar] [CrossRef] [PubMed]
- Pinton, P.; Tsybulskyy, D.; Lucioli, J.; Laffitte, J.; Callu, P.; Lyazhri, F.; Grosjean, F.; Bracarense, A.P.; Kolf-Clauw, M.; Oswald, I.P. Toxicity of deoxynivalenol and its acetylated derivatives on the intestine: Differential effects on morphology, barrier function, tight junction proteins, and mitogen-activated protein kinases. Toxicol. Sci. 2012, 130, 180–190. [Google Scholar] [CrossRef] [PubMed]
- Pinton, P.; Nougayrede, J.P.; Del Rio, J.C.; Moreno, C.; Marin, D.E.; Ferrier, L.; Bracarense, A.P.; Kolf-Clauw, M.; Oswald, I.P. The food contaminant deoxynivalenol, decreases intestinal barrier permeability and reduces claudin expression. Toxicol. Appl. Pharmacol. 2009, 237, 41–48. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hou, Y.; Wang, L.; Zhang, W.; Yang, Z.; Ding, B.; Zhu, H.; Liu, Y.; Qiu, Y.; Yin, Y.; Wu, G. Protective effects of n-acetylcysteine on intestinal functions of piglets challenged with lipopolysaccharide. Amino Acids 2012, 43, 1233–1242. [Google Scholar] [CrossRef] [PubMed]
- Wu, G.Y.; Bazer, F.W.; Cudd, T.A.; Meininger, C.J.; Spencer, T.E. Maternal nutrition and fetal development. J. Nutr. 2004, 134, 2169–2172. [Google Scholar] [PubMed]
- Wu, G.Y. Functional amino acids in growth, reproduction, and health. Adv. Nutr. 2010, 1, 31–37. [Google Scholar] [CrossRef] [PubMed]
- Adjei, A.A.; Yamauchi, K.; Nakasone, Y.; Konishi, M.; Yamamoto, S. Arginine-supplemented diets inhibit endotoxin-induced bacterial translocation in mice. Nutrition 1995, 11, 371–374. [Google Scholar] [PubMed]
- He, Q.; Kong, X.; Wu, G.; Ren, P.; Tang, H.; Hao, F.; Huang, R.; Li, T.; Tan, B.; Li, P.; et al. Metabolomic analysis of the response of growing pigs to dietary L-arginine supplementation. Amino Acids 2009, 37, 199–208. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Huang, J.; Hou, Y.; Zhu, H.; Zhao, S.; Ding, B.; Yin, Y.; Yi, G.; Shi, J.; Fan, W. Dietary arginine supplementation alleviates intestinal mucosal disruption induced by escherichia coli lipopolysaccharide in weaned pigs. Br. J. Nutr. 2008, 100, 552–560. [Google Scholar] [CrossRef] [PubMed]
- Yao, K.; Guan, S.; Li, T.J.; Huang, R.L.; Wu, G.Y.; Ruan, Z.; Yin, Y.L. Dietary L-arginine supplementation enhances intestinal development and expression of vascular endothelial growth factor in weanling piglets. Br. J. Nutr. 2011, 105, 703–709. [Google Scholar] [CrossRef] [PubMed]
- He, J.W.; Zhou, T.; Young, J.C.; Boland, G.J.; Scott, P.A. Chemical and biological transformations for detoxification of trichothecene mycotoxins in human and animal food chains: A review. Trends Food Sci. Technol. 2010, 21, 67–76. [Google Scholar] [CrossRef]
- Hou, Y.; Yao, K.; Wang, L.; Ding, B.; Fu, D.; Liu, Y.; Zhu, H.; Liu, J.; Li, Y.; Kang, P.; et al. Effects of alpha-ketoglutarate on energy status in the intestinal mucosa of weaned piglets chronically challenged with lipopolysaccharide. Br. J. Nutr. 2011, 106, 357–363. [Google Scholar] [CrossRef] [PubMed]
- Moayyedi, P.; O’Mahony, S.; Jackson, P.; Lynch, D.A.; Dixon, M.F.; Axon, A.T. Small intestine in lymphocytic and collagenous colitis: Mucosal morphology, permeability, and secretory immunity to gliadin. J. Clin. Pathol. 1997, 50, 527–529. [Google Scholar] [CrossRef] [PubMed]
- Fan, M.Z.; Stoll, B.; Jiang, R.; Burrin, D.G. Enterocyte digestive enzyme activity along the crypt-villus and longitudinal axes in the neonatal pig small intestine. J. Anim. Sci. 2001, 79, 371–381. [Google Scholar] [PubMed]
- Gurbuz, A.T.; Kunzelman, J.; Ratzer, E.E. Supplemental dietary arginine accelerates intestinal mucosal regeneration and enhances bacterial clearance following radiation enteritis in rats. J. Surg. Res. 1998, 74, 149–154. [Google Scholar] [CrossRef] [PubMed]
- Tan, B.; Li, X.G.; Kong, X.; Huang, R.; Ruan, Z.; Yao, K.; Deng, Z.; Xie, M.; Shinzato, I.; Yin, Y.; et al. Dietary L-arginine supplementation enhances the immune status in early-weaned piglets. Amino Acids 2009, 37, 323–331. [Google Scholar] [CrossRef] [PubMed]
- Murphy, M.E.; Brayden, J.E. Nitric oxide hyperpolarizes rabbit mesenteric arteries via atp-sensitive potassium channels. J. Physiol. 1995, 486, 47–58. [Google Scholar] [CrossRef] [PubMed]
- Maresca, M.; Mahfoud, R.; Garmy, N.; Fantini, J. The mycotoxin deoxynivalenol affects nutrient absorption in human intestinal epithelial cells. J. Nutr. 2002, 132, 2723–2731. [Google Scholar] [PubMed]
- Meloche, J.L.; Smith, T.K. Altered tissue amino acid metabolism in acute t-2 toxicosis. Proc. Soc. Exp. Biol. Med. 1995, 210, 260–265. [Google Scholar] [CrossRef] [PubMed]
- Wu, G. Amino acids: Metabolism, functions, and nutrition. Amino Acids 2009, 37, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Wu, G.Y.; Wu, Z.L.; Dai, Z.L.; Yang, Y.; Wang, W.W.; Liu, C.; Wang, B.; Wang, J.J.; Yin, Y.L. Dietary requirements of “nutritionally non-essential amino acids” by animals and humans. Amino Acids 2013, 44, 1107–1113. [Google Scholar] [CrossRef] [PubMed]
- Rhoads, J.M.; Liu, Y.; Niu, X.; Surendran, S.; Wu, G. Arginine stimulates cdx2-transformed intestinal epithelial cell migration via a mechanism requiring both nitric oxide and phosphorylation of p70 S6 kinase. J. Nutr. 2008, 138, 1652–1657. [Google Scholar] [PubMed]
- Fukuhara, D.; Kanai, Y.; Chairoungdua, A.; Babu, E.; Bessho, F.; Kawano, T.; Akimoto, Y.; Endou, H.; Yan, K. Protein characterization of Na+-independent system L amino acid transporter 3 in mice: A potential role in supply of branched-chain amino acids under nutrient starvation. Am. J. Pathol. 2007, 170, 888–898. [Google Scholar] [CrossRef] [PubMed]
- Wu, L.; Wang, W.; Yao, K.; Zhou, T.; Yin, J.; Li, T.; Yang, L.; He, L.; Yang, X.; Zhang, H.; et al. Effects of dietary arginine and glutamine on alleviating the impairment induced by deoxynivalenol stress and immune relevant cytokines in growing pigs. PLoS One 2013, 8, e69502. [Google Scholar] [CrossRef] [PubMed]
- Nakamura, E.; Sato, M.; Yang, H.; Miyagawa, F.; Harasaki, M.; Tomita, K.; Matsuoka, S.; Noma, A.; Iwai, K.; Minato, N. 4F2 (CD98) heavy chain is associated covalently with an amino acid transporter and controls intracellular trafficking and membrane topology of 4F2 heterodimer. J. Biol. Chem. 1999, 274, 3009–3016. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.M.; Reyna, S.V.; Ensenat, D.; Peyton, K.J.; Wang, H.; Schafer, A.I.; Durante, W. Platelet-derived growth factor stimulates LAT1 gene expression in vascular smooth muscle: Role in cell growth. FASEB J. 2004, 18, 768–770. [Google Scholar] [CrossRef] [PubMed]
- Naftalin, R.J. Osmotic water transport with glucose in GLUT2 and SGLT. Biophys. J. 2008, 94, 3912–3923. [Google Scholar] [CrossRef] [PubMed]
- Garriga, C.; Planas, J.M.; Moreto, M. Aldosterone mediates the changes in hexose transport induced by low sodium intake in chicken distal intestine. J. Physiol. 2001, 535, 197–205. [Google Scholar] [CrossRef] [PubMed]
- Mace, O.J.; Lister, N.; Morgan, E.; Shepherd, E.; Affleck, J.; Helliwell, P.; Bronk, J.R.; Kellett, G.L.; Meredith, D.; Boyd, R.; et al. An energy supply network of nutrient absorption coordinated by calcium and T1R taste receptors in rat small intestine. J. Physiol. 2009, 587, 195–210. [Google Scholar] [CrossRef] [PubMed]
- Kellett, G.L.; Brot-Laroche, E.; Mace, O.J.; Leturque, A. Sugar absorption in the intestine: The role of GLUT2. Annu. Rev. Nutr. 2008, 28, 35–54. [Google Scholar] [CrossRef] [PubMed]
- Shepherd, E.J.; Helliwell, P.A.; Mace, O.J.; Morgan, E.L.; Patel, N.; Kellett, G.L. Stress and glucocorticoid inhibit apical GLUT2-trafficking and intestinal glucose absorption in rat small intestine. J. Physiol. 2004, 560, 281–290. [Google Scholar] [CrossRef] [PubMed]
- Wu, G.Y.; Bazer, F.W.; Davis, T.A.; Kim, S.W.; Li, P.; Rhoads, J.M.; Satterfield, M.C.; Smith, S.B.; Spencer, T.E.; Yin, Y.L. Arginine metabolism and nutrition in growth, health and disease. Amino Acids 2009, 37, 153–168. [Google Scholar] [CrossRef] [PubMed]
- Robinson, T.M.; Sewell, D.A.; Greenhaff, P.L. l-arginine ingestion after rest and exercise: Effects on glucose disposal. Med. Sci. Sports Exerc. 2003, 35, 1309–1315. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.H.; Wu, X.; Yin, Y.L.; Zhang, C.; He, L.Q. Preventive oral supplementation with glutamine and arginine has beneficial effects on the intestinal mucosa and inflammatory cytokines in endotoxemic rats. Amino Acids 2012, 43, 813–821. [Google Scholar] [CrossRef] [PubMed]
- Wu, G.Y. Intestinal mucosal amino acid catabolism. J. Nutr. 1998, 128, 1249–1252. [Google Scholar] [PubMed]
- Wu, G. Functional amino acids in nutrition and health. Amino Acids 2013, 45, 407–411. [Google Scholar] [CrossRef] [PubMed]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, L.; Liao, P.; He, L.; Feng, Z.; Ren, W.; Yin, J.; Duan, J.; Li, T.; Yin, Y. Dietary l-Arginine Supplementation Protects Weanling Pigs from Deoxynivalenol-Induced Toxicity. Toxins 2015, 7, 1341-1354. https://doi.org/10.3390/toxins7041341
Wu L, Liao P, He L, Feng Z, Ren W, Yin J, Duan J, Li T, Yin Y. Dietary l-Arginine Supplementation Protects Weanling Pigs from Deoxynivalenol-Induced Toxicity. Toxins. 2015; 7(4):1341-1354. https://doi.org/10.3390/toxins7041341
Chicago/Turabian StyleWu, Li, Peng Liao, Liuqin He, Zemeng Feng, Wenkai Ren, Jie Yin, Jielin Duan, Tiejun Li, and Yulong Yin. 2015. "Dietary l-Arginine Supplementation Protects Weanling Pigs from Deoxynivalenol-Induced Toxicity" Toxins 7, no. 4: 1341-1354. https://doi.org/10.3390/toxins7041341
APA StyleWu, L., Liao, P., He, L., Feng, Z., Ren, W., Yin, J., Duan, J., Li, T., & Yin, Y. (2015). Dietary l-Arginine Supplementation Protects Weanling Pigs from Deoxynivalenol-Induced Toxicity. Toxins, 7(4), 1341-1354. https://doi.org/10.3390/toxins7041341