Assessing Larval Zebrafish Survival and Gene Expression Following Sodium Butyrate Exposure and Subsequent Lethal Bacterial Lipopolysaccharide (LPS) Endotoxin Challenge
Abstract
:1. Introduction
2. Results
2.1. Survival Following LPS Immune Challenge
2.2. qPCR Analysis
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Zebrafish Husbandry
5.2. Preparation and Determination of Nab and Lps Concentration
5.3. Larval Zebrafish NaB Exposure and Lethal LPS Immune Challenge
5.4. Zebrafish Collection and RNA Extraction
5.5. Gene Expression (qPCR)
5.6. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- FAO. The State of World Fisheries and Aquaculture 2022. Towards Blue Transformation; FAO: Rome, Italy, 2022. [Google Scholar] [CrossRef]
- Chambers, E.S.; Preston, T. Role of gut microbiota-generated short-chain fatty acids in metabolic and cardiovascular health. Curr. Nutr. Rep. 2018, 7, 198–206. [Google Scholar] [CrossRef] [PubMed]
- Abdel-Latif, H.M.; Abdel-Tawwab, M. Benefits of dietary butyric acid, sodium butyrate, and their protected forms in aquafeeds: A review. Rev. Fish. Sci. Aquac. 2020, 28, 421–448. [Google Scholar] [CrossRef]
- Wang, H.B.; Wang, P.Y. Butyrate enhances intestinal epithelial barrier function via up-regulation of tight junction protein Claudin-1 transcription. Dig. Dis. Sci. 2012, 57, 3126–3135. [Google Scholar] [CrossRef] [PubMed]
- Feng, Y.; Wang, Y. Short-chain fatty acids manifest stimulative and protective effects on intestinal barrier function through the inhibition of NLRP3 inflammasome and autophagy. Cell Physiol. Biochem. 2018, 49, 190–205. [Google Scholar] [CrossRef]
- Siddiqui, M.T.; Cresci, G.A. The immunomodulatory functions of butyrate. J. Inflammation Res. 2021, 14, 6025. [Google Scholar] [CrossRef]
- Meyers, J.R. Zebrafish: Development of a vertebrate model organism. Curr. Protoc. 2018, 16, e19. [Google Scholar] [CrossRef]
- Miao, K.Z.; Kim, G.Y. Tipping the scales with zebrafish to understand adaptive tumor immunity. Front. Cell Dev. Biol. 2021, 9, 1189. [Google Scholar] [CrossRef]
- Hal, A.M.; Manal, I. Gene expression and histopathological changes of Nile tilapia (Oreochromis niloticus) infected with Aeromonas hydrophila and Pseudomonas fluorescens. Aquaculture 2020, 526, 735392. [Google Scholar] [CrossRef]
- Zhao, X.L.; Wu, G. Analysis of virulence and immunogenic factors in Aeromonas hydrophila: Towards the development of live vaccines. J. Fish. Dis. 2020, 43, 747–755. [Google Scholar] [CrossRef]
- Pękala-Safińska, A. Contemporary threats of bacterial infections in freshwater fish. J. Vet. Res. 2018, 62, 261–267. [Google Scholar] [CrossRef]
- Chevalier, S.; Bouffartigues, E. Structure, function and regulation of Pseudomonas aeruginosa porins. FEMS Microbiol. Rev. 2017, 41, 698–722. [Google Scholar] [CrossRef] [PubMed]
- El-Bahar, H.M.; Ali, N.G. Virulence genes contributing to Aeromonas hydrophila pathogenicity in Oreochromis niloticus. Int. Microbiol. 2019, 22, 479–490. [Google Scholar] [CrossRef] [PubMed]
- Raj, N.S.; Swaminathan, T.R. Aeromonas veronii caused bilateral exophthalmia and mass mortality in cultured Nile tilapia, Oreochromis niloticus (L.) in India. Aquaculture 2019, 512, 734278. [Google Scholar] [CrossRef]
- Shahrokhi, G.R.; Rahimi, E. The prevalence rate, pattern of antibiotic resistance, and frequency of virulence factors of Pseudomonas aeruginosa strains isolated from fish in Iran. J. Food Qual. 2022, 2022, 8990912. [Google Scholar] [CrossRef]
- Elham, I.; Ismail, M. Studies on Pseudomonas septicemia in some tilapia in Ismailia. Suez Canal Vet. Med. J. SCVMJ 2017, 22, 107–117. [Google Scholar] [CrossRef]
- Huszczynski, S.M.; Lam, J.S. The role of Pseudomonas aeruginosa lipopolysaccharide in bacterial pathogenesis and physiology. Pathogens 2019, 9, 6. [Google Scholar] [CrossRef]
- Omosowone, O.; Dada, A. Comparison of dietary butyric acid supplementation effect on growth performance and body composition of Clarias gariepinus and Oreochromis niloticus fingerlings. Iran. J. Fish. Sci. 2018, 17, 403–412. [Google Scholar] [CrossRef]
- Bedford, A.; Gong, J. Implications of butyrate and its derivatives for gut health and animal production. Anim. Nutr. 2018, 4, 151–159. [Google Scholar] [CrossRef]
- Di Liddo, R.; Valente, S. Histone deacetylase inhibitors restore IL-10 expression in lipopolysaccharide-induced cell inflammation and reduce IL-1β and IL-6 production in breast silicone implant in C57BL/6J wild-type murine model. Autoimmunity 2016, 18, 1–11. [Google Scholar] [CrossRef]
- Leoni, F.; Zaliani, A. The antitumor histone deacetylase inhibitor suberoylanilide hydroxamic acid exhibits antiinflammatory properties via suppression of cytokines. Proc. Natl. Acad. Sci. USA 2002, 99, 2995–3000. [Google Scholar] [CrossRef]
- Bondarev, A.D.; Attwood, M.M. Recent developments of HDAC inhibitors: Emerging indications and novel molecules. Br. J. Clin. Pharmacol. 2021, 87, 4577–4597. [Google Scholar] [CrossRef] [PubMed]
- Fukae, J.; Amasaki, Y. Butyrate suppresses tumor necrosis factor α production by regulating specific messenger RNA degradation mediated through a cis-acting AU-rich element. Arthritis Rheum. 2005, 52, 2697–2707. [Google Scholar] [CrossRef] [PubMed]
- Schulthess, J.; Pandey, S. The short chain fatty acid butyrate imprints an antimicrobial program in macrophages. Immunity 2019, 50, 432–445. [Google Scholar] [CrossRef] [PubMed]
- Rimoldi, S.; Finzi, G. Butyrate and taurine exert a mitigating effect on the inflamed distal intestine of European sea bass fed with a high percentage of soybean meal. Fish. Aquat. Sci. 2016, 19, 40. [Google Scholar] [CrossRef]
- López Nadal, A.; Boekhorst, J. Omics and imaging combinatorial approach reveals butyrate-induced inflammatory effects in the zebrafish gut. Anim. Microbiome 2023, 5, 15. [Google Scholar] [CrossRef] [PubMed]
- Föh, B.; Buhre, J.S. Microbial metabolite butyrate promotes induction of IL-10+ IgM+ plasma cells. PLoS ONE 2022, 17, e0266071. [Google Scholar] [CrossRef]
- Yang, D.; Zheng, X. Sensing of cytosolic LPS through caspy2 pyrin domain mediates noncanonical inflammasome activation in zebrafish. Nat. Commun. 2018, 9, 3052. [Google Scholar] [CrossRef]
- Gauthier, A.E.; Rotjan, R.D. Lipopolysaccharide detection by the innate immune system may be an uncommon defence strategy used in nature. Open Biol. 2022, 12, 220146. [Google Scholar] [CrossRef]
- Zheng, L.; Kelly, C.J. Microbial-derived butyrate promotes epithelial barrier function through IL-10 receptor–dependent repression of claudin-2. J. Immunol. 2017, 199, 2976–2984. [Google Scholar] [CrossRef]
- Lu, Z.Y.; Feng, L. An Antioxidant Supplement Function Exploration: Rescue of Intestinal Structure Injury by Mannan Oligosaccharides after Aeromonas hydrophila Infection in Grass Carp (Ctenopharyngodon idella). Antioxidants 2022, 11, 806. [Google Scholar] [CrossRef]
- Cholan, P.M.; Han, A. Conserved anti-inflammatory effects and sensing of butyrate in zebrafish. Gut Microbes 2020, 12, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Jiang, L.; Wang, J. Sodium butyrate alleviates lipopolysaccharide-induced inflammatory responses by down-regulation of NF-κB, NLRP3 signaling pathway, and activating histone acetylation in bovine macrophages. Front. Vet. Sci. 2020, 7, 579674. [Google Scholar] [CrossRef] [PubMed]
- Zhang, F.; Shan, S. Molecular characterization and expression analysis of two peptidoglycan recognition proteins (CcPGRP5, CcPGRP6) in larvae ontogeny of common carp Cyprinus carpio L. and upon immune stimulation by bacteria. BMC Vet. Res. 2019, 15, 10. [Google Scholar] [CrossRef]
- Guryev, V.; Koudijs, M.J. Genetic variation in the zebrafish. Genome Res. 2006, 16, 491–497. [Google Scholar] [CrossRef]
- Banerjee, S.; Leptin, M. Systemic response to ultraviolet radiation involves induction of leukocytic IL-1β and inflammation in zebrafish. J. Immunol. 2014, 193, 1408–1415. [Google Scholar] [CrossRef]
- Kumai, Y.; Bahubeshi, A. Strategies for maintaining Na+ balance in zebrafish (Danio rerio) during prolonged exposure to acidic water. Comp. Biochem. Physiol. Part. A Mol. Integr. Physiol. 2011, 160, 52–62. [Google Scholar] [CrossRef]
- Sullivan, C.; Charette, J. The gene history of zebrafish tlr4a and tlr4b is predictive of their divergent functions. J. Immunol. 2009, 183, 5896–5908. [Google Scholar] [CrossRef]
- Karrow, N.A.; Li, Z. Endotoxin Tolerance: Fishing for Answers. Adv. Med. Biol. 2016, 99, 5–11. [Google Scholar]
- Dziarski, R. Peptidoglycan recognition proteins (PGRPs). Mol. Immunol. 2004, 40, 877–886. [Google Scholar] [CrossRef]
- Silhavy, T.J.; Kahne, D. The bacterial cell envelope. Cold Spring Harbor Perspect. Biol. 2010, 2, a000414. [Google Scholar] [CrossRef]
- Meijer, A.H.; Krens, S.G. Expression analysis of the Toll-like receptor and TIR domain adaptor families of zebrafish. Mol. Immunol. 2004, 40, 773–783. [Google Scholar] [CrossRef]
- Núñez-Acuña, G.; Aballay, A.E. Transcriptional responses of Mytilus chilensis exposed in vivo to saxitoxin (STX). J. Molluscan Stud. 2013, 79, 323–331. [Google Scholar] [CrossRef]
- Spead, O.; Verreet, T. Characterization of the caspase family in zebrafish. PLoS ONE 2018, 13, e0197966. [Google Scholar] [CrossRef] [PubMed]
- O’Sullivan, L.A.; Noor, S.M. Suppressor of cytokine signaling 1 regulates embryonic myelopoiesis independently of its effects on T cell development. J. Immunol. 2011, 186, 4751–4761. [Google Scholar] [CrossRef]
- Bas, A.; Forsberg, G. Utility of the housekeeping genes 18S rRNA, β-actin and glyceraldehyde-3-phosphate-dehydrogenase for normalization in real-time quantitative reverse transcriptase-polymerase chain reaction analysis of gene expression in human T lymphocytes. Scand. J. Immunol. 2004, 59, 566–573. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Deng, H. Inflammatory responses and inflammation-associated diseases in organs. Oncotarget 2018, 9, 7204. [Google Scholar] [CrossRef] [PubMed]
- Sharma, J.; Larkin III, J. Therapeutic implication of SOCS1 modulation in the treatment of autoimmunity and cancer. Front. Pharmacol. 2019, 10, 324. [Google Scholar] [CrossRef]
- Zhou, J.; Gu, X. Anti-inflammatory and regulatory effects of Huanglian Jiedu Decoction on lipid homeostasis and the TLR4/MyD88 signaling pathway in LPS-induced zebrafish. Front. Physiol. 2019, 10, 1241. [Google Scholar] [CrossRef]
- Kwong, R.W.; Perry, S.F. The tight junction protein claudin-b regulates epithelial permeability and sodium handling in larval zebrafish, Danio rerio. Am. J. Physciol Regul. Integr. Comp. Physiol. 2013, 304, R504–R513. [Google Scholar] [CrossRef]
Function | Gene | Primer(s) | Annealing Temperature (°C) | Accession Number | |
---|---|---|---|---|---|
Housekeeping | β-actin [22] | forward | CGAGCAGGAGATGGGAACC | 61.8 | NM_131031 |
reverse | CAACGGAAACGCTCATTGC | ||||
18S rRNA [23] | forward | TCGCTAGTTGGCATCGTTTATG | 60 | BX296557.35 | |
reverse | CGGAGGTTCGAAGACGATCA | ||||
Immune function | MyD88 [20] | forward | TCCACAGGGACTGACACCTGAGA | 61.8 | NM_212814 |
reverse | GCTGAGTCTTCAGCACAGCAGAT | ||||
SOCS1 [25] | forward | TGGAAGCGGCGACGAGAGTT | 60 | NM_001003467 | |
reverse | CGGCTTGAAATGTGTCTGG | ||||
IL-1β [22] | forward | ATGCTCATGGCGAACGTC | 61.8 | NM_212844 | |
reverse | TGGTTTTAGTGTAAGACGGCACT | ||||
TNF-alpha [22] | forward | AGGCAATTTCACTTCCAAGG | 60 | NM_212859 | |
reverse | AGGTCTTTGATTCAGAGTTGTATCC | ||||
IL-10 [22] | forward | AAGCGGGATATGGTGAAATG | 60 | NM_001020785 | |
reverse | CCCCCTTTTCCTTCATCTTT | ||||
Tight junction function | claudin-b [23] | forward | AGACAGCGGAAAATACACAGC | 60 | NM_131763 |
reverse | TGAGCCTCAATGTCCAACAA | ||||
occludin-a [23] | forward | GGGTCTGCTGGCTGACTATC | 61.8 | NM_212832 | |
reverse | GAATCTCCACGGGACTTTCA | ||||
occludin-b [23] | forward | GACCATTAAGGATGGCCTCA | 60 | XM_005171844 | |
reverse | GCTGAGCAGCACTGACTTTG | ||||
LPS recognition | Caspase b [24] | forward | ATGGAGGATATTACCCAG | 63 | NM_152884 |
reverse | TCACAGTCCAGGAAAC | ||||
PGRP [21] | forward | TGGACAATCGAACATGGGACGA | 60 | MGC04209 | |
reverse | CCGTACGTATGTGCCCCGAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, M.X.; Shandilya, U.K.; Wu, X.; Huyben, D.; Karrow, N.A. Assessing Larval Zebrafish Survival and Gene Expression Following Sodium Butyrate Exposure and Subsequent Lethal Bacterial Lipopolysaccharide (LPS) Endotoxin Challenge. Toxins 2023, 15, 588. https://doi.org/10.3390/toxins15100588
Wang MX, Shandilya UK, Wu X, Huyben D, Karrow NA. Assessing Larval Zebrafish Survival and Gene Expression Following Sodium Butyrate Exposure and Subsequent Lethal Bacterial Lipopolysaccharide (LPS) Endotoxin Challenge. Toxins. 2023; 15(10):588. https://doi.org/10.3390/toxins15100588
Chicago/Turabian StyleWang, Mary X., Umesh K. Shandilya, Xiang Wu, David Huyben, and Niel A. Karrow. 2023. "Assessing Larval Zebrafish Survival and Gene Expression Following Sodium Butyrate Exposure and Subsequent Lethal Bacterial Lipopolysaccharide (LPS) Endotoxin Challenge" Toxins 15, no. 10: 588. https://doi.org/10.3390/toxins15100588
APA StyleWang, M. X., Shandilya, U. K., Wu, X., Huyben, D., & Karrow, N. A. (2023). Assessing Larval Zebrafish Survival and Gene Expression Following Sodium Butyrate Exposure and Subsequent Lethal Bacterial Lipopolysaccharide (LPS) Endotoxin Challenge. Toxins, 15(10), 588. https://doi.org/10.3390/toxins15100588