Potential Role of Individual and Combined Effects of T-2 Toxin, HT-2 Toxin and Neosolaniol on the Apoptosis of Porcine Leydig Cells
Abstract
1. Introduction
2. Results
2.1. ATP Content Analysis
2.2. ROS Level Analysis
2.3. Mitochondrial Membrane Potential (MMP)
2.4. Apoptosis Assay
2.5. Expression of Apoptosis-Related Genes
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Chemicals
5.2. Cell Culture and Treatment
5.3. Determination of Intracellular ATP Content
5.4. Determination of Intracellular ROS Content
5.5. Measurement of Mitochondrial Membrane Potential (MMP)
5.6. Measurement of Cellular Apoptosis
5.7. RNA Extraction and Real-Time Quantitative PCR
5.8. Data Preprocessing and Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Appendix A

References
- McCormick, S.P.; Stanley, A.M.; Stover, N.A.; Alexander, N.J. Trichothecenes: From Simple to Complex Mycotoxins. Toxins 2011, 3, 802–814. [Google Scholar] [CrossRef] [Scilit]
- Chaudhary, P.; Shank, R.A.; Montina, T.; Goettel, J.T.; Foroud, N.A.; Hazendonk, P.; Eudes, F. Hydrogen-Bonding Interactions in T-2 Toxin Studied Using Solution and Solid-State NMR. Toxins 2011, 3, 1310–1331. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Wang, Y.; Qiu, M.; Sun, L.; Wang, X.; Li, C.; Xu, D.; Gooneratne, R. Cytotoxicity of T-2 and modified T-2 toxins: Induction of JAK/STAT pathway in RAW264.7 cells by hepatopancreas and muscle extracts of shrimp fed with T-2 toxin. Toxicol. Res. 2017, 6, 144–151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Y.; Wang, Z.; Beier, R.C.; Shen, J.; De Smet, D.; De Saeger, S.; Zhang, S. T-2 Toxin, a Trichothecene Mycotoxin: Review of Toxicity, Metabolism, and Analytical Methods. J. Agric. Food Chem. 2011, 59, 3441–3453. [Google Scholar] [CrossRef] [Scilit]
- Adhikari, M.; Negi, B.; Kaushik, N.; Adhikari, A.; Al-Khedhairy, A.; Kaushik, N.K.; Choi, E.H. T-2 mycotoxin: Toxicological effects and decontamination strategies. Oncotarget 2017, 8, 33933–33952. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, X.; Liu, P.; Cui, Y.; Xiao, B.; Liu, M.; Song, M.; Huang, W.; Li, Y. Review of the Reproductive Toxicity of T-2 Toxin. J. Agric. Food Chem. 2020, 68, 727–734. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yin, H.; Han, S.; Chen, Y.; Wang, Y.; Li, D.; Zhu, Q. T-2 Toxin Induces Oxidative Stress, Apoptosis and Cytoprotective Autophagy in Chicken Hepatocytes. Toxins 2020, 12, 90. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, F.-F.; Lin, X.-L.; Wang, X.; Ping, Z.-G.; Guo, X. Comparison of Apoptosis and Autophagy in Human Chondrocytes Induced by the T-2 and HT-2 Toxins. Toxins 2019, 11, 260. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wachowska, U.; Packa, D.; Wiwart, M. Microbial Inhibition of Fusarium Pathogens and Biological Modification of Trichothecenes in Cereal Grains. Toxins 2017, 9, 408. [Google Scholar] [CrossRef] [Scilit]
- Nathanail, A.V.; Varga, E.; Meng-Reiterer, J.; Bueschl, C.; Michlmayr, H.; Malachova, A.; Fruhmann, P.; Jestoi, M.; Peltonen, K.; Adam, G.; et al. Metabolism of the Fusarium Mycotoxins T-2 Toxin and HT-2 Toxin in Wheat. J. Agric. Food Chem. 2015, 63, 7862–7872. [Google Scholar] [CrossRef] [Scilit]
- Alassane-Kpembi, I.; Kolf-Clauw, M.; Gauthier, T.; Abrami, R.; Abiola, F.A.; Oswald, I.P.; Puel, O. New insights into mycotoxin mixtures: The toxicity of low doses of Type B trichothecenes on intestinal epithelial cells is synergistic. Toxicol. Appl. Pharmacol. 2013, 272, 191–198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lippolis, V.; Porricelli, A.C.R.; Mancini, E.; Ciasca, B.; Lattanzio, V.M.T.; De Girolamo, A.; Maragos, C.M.; McCormick, S.; Li, P.; Logrieco, A.F.; et al. Fluorescence Polarization Immunoassay for the Determination of T-2 and HT-2 Toxins and Their Glucosides in Wheat. Toxins 2019, 11, 380. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoshinari, T.; Sakuda, S.; Furihata, K.; Furusawa, H.; Ohnishi, T.; Sugita-Konishi, Y.; Ishizaki, N.; Terajima, J. Structural Determination of a Nivalenol Glucoside and Development of an Analytical Method for the Simultaneous Determination of Nivalenol and Deoxynivalenol, and Their Glucosides, in Wheat. J. Agric. Food Chem. 2014, 62, 1174–1180. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Perkowski, J.; Kiecana, I.; Stachowiak, J.; Basinski, T. Natural occurrence of scirpentriol in cereals infected byFusariumspecies. Food Addit. Contam. 2003, 20, 572–578. [Google Scholar] [CrossRef] [Scilit]
- Sokolović, M.; Garaj-Vrhovac, V.; Šimpraga, B. T-2 Toxin: Incidence and Toxicity in Poultry. Arch. Ind. Hyg. Toxicol. 2008, 59, 43–52. [Google Scholar] [CrossRef] [Scilit]
- Sobral, M.M.; Faria, M.A.; Cunha, S.C.; Ferreira, I.M. Toxicological interactions between mycotoxins from ubiquitous fungi: Impact on hepatic and intestinal human epithelial cells. Chemosphere 2018, 202, 538–548. [Google Scholar] [CrossRef] [Scilit]
- Ling, A.; Sun, L.; Guo, W.; Sun, S.; Yang, J.; Zhao, Z. Individual and combined cytotoxic effects of T-2 toxin and its four metabolites on porcine Leydig cells. Food Chem. Toxicol. 2020, 139, 111277. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.F.; Yang, J.Y.; Meng, X.P.; Qiao, X.L. l-arginine protects against T-2 toxin-induced male reproductive impairments in mice. Theriogenology 2019, 126, 249–253. [Google Scholar] [CrossRef] [Scilit]
- Wu, J.; Huang, W.; Xiao, H.; Xie, Y.; Yuan, Z.; Yi, J.; Chen, J.; Tu, D.; Tian, Y. Procyanidins B2 reverses the T-2 toxin-induced mitochondrial apoptosis in TM3 Leydig cells. J. Funct. Foods 2017, 45, 118–128. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.F.; Yang, J.Y.; Li, Y.K.; Zhou, W. Toxicity and oxidative stress induced by T-2 toxin in cultured mouse Leydig cells. Toxicol. Mech. Methods 2017, 27, 100–106. [Google Scholar] [CrossRef] [Scilit]
- Yang, J.Y.; Zhang, Y.F.; Meng, X.P.; Kong, X.F. Delayed effects of autophagy on T-2 toxin-induced apoptosis in mouse primary Leydig cells. Toxicol. Ind. Health 2019, 35, 256–263. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, C.-C.; Zhang, Y.; Duan, X.; Han, J.; Sun, S.-C. Toxic effects of HT-2 toxin on mouse oocytes and its possible mechanisms. Arch. Toxicol. 2016, 90, 1495–1505. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Okazaki, K.; Yoshizawa, T.; Kimura, S. Inhibition by trichothecene mycotoxins of replication of herpes simplex virus type 2. Agric. Biol. Chem. 1987, 52, 795–801. [Google Scholar] [CrossRef] [Scilit]
- Tian, J.; Huang, Y.; Wu, T.; Huang, H.-D.; Ko, K.M.; Zhu, B.T.; Chen, J. The Use of Chinese Yang/Qi-Invigorating Tonic Botanical Drugs/Herbal Formulations in Ameliorating Chronic Kidney Disease by Enhancing Mitochondrial Function. Front. Pharmacol. 2021, 12, 622948. [Google Scholar] [CrossRef] [Scilit]
- Mao, G.-X.; Xu, X.-G.; Wang, S.-Y.; Li, H.-F.; Zhang, J.; Zhang, Z.-S.; Su, H.-L.; Chen, S.-S.; Xing, W.-M.; Wang, Y.-Z.; et al. Salidroside Delays Cellular Senescence by Stimulating Mitochondrial Biogenesis Partly through a miR-22/SIRT-1 Pathway. Oxidative Med. Cell. Longev. 2019, 2019, 5276096. [Google Scholar] [CrossRef] [Scilit]
- Aoyama, K.; Nakaki, T. Glutathione in Cellular Redox Homeostasis: Association with the Excitatory Amino Acid Carrier 1 (EAAC1). Molecules 2015, 20, 8742–8758. [Google Scholar] [CrossRef] [Scilit]
- Longobardi, C.; Damiano, S.; Andretta, E.; Prisco, F.; Russo, V.; Pagnini, F.; Florio, S.; Ciarcia, R. Curcumin Modulates Nitrosative Stress, Inflammation, and DNA Damage and Protects against Ochratoxin A-Induced Hepatotoxicity and Nephrotoxicity in Rats. Antioxidants 2021, 10, 1239. [Google Scholar] [CrossRef] [Scilit]
- Silva, D.K.C.; Teixeira, J.S.; Moreira, D.R.M.; da Silva, T.F.; Barreiro, E.J.D.L.; de Freitas, H.F.; Pita, S.S.D.R.; Teles, A.L.B.; Guimarães, E.T.; Soares, M.B.P. In Vitro, In Vivo and In Silico Effectiveness of LASSBio-1386, an N-Acyl Hydrazone Derivative Phosphodiesterase-4 Inhibitor, Against Leishmania amazonensis. Front. Pharmacol. 2020, 11, 590544. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Wang, L.; Guo, X.; Pang, Q.; Wu, S.; Wu, C.; Xu, P.; Bai, Y. The Role of Mitochondria in T-2 Toxin-Induced Human Chondrocytes Apoptosis. PLoS ONE 2014, 9, e108394. [Google Scholar] [CrossRef] [Scilit]
- Fang, H.; Wu, Y.; Guo, J.; Rong, J.; Ma, L.; Zhao, Z.; Zuo, D.; Peng, S. T-2 toxin induces apoptosis in differentiated murine embryonic stem cells through reactive oxygen species-mediated mitochondrial pathway. Apoptosis 2012, 17, 895–907. [Google Scholar] [CrossRef] [Scilit]
- Lei, Y.; Guanghui, Z.; Xi, W.; Yingting, W.; Xialu, L.; FangFang, Y.; Goldring, M.B.; Xiong, G.; Lammi, M.J. Cellular responses to T-2 toxin and/or deoxynivalenol that induce cartilage damage are not specific to chondrocytes. Sci. Rep. 2017, 7, 2231. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Königs, M.; Mulac, D.; Schwerdt, G.; Gekle, M.; Humpf, H.-U. Metabolism and cytotoxic effects of T-2 toxin and its metabolites on human cells in primary culture. Toxicology 2009, 258, 106–115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weidner, M.; Welsch, T.; Hübner, F.; Schwerdt, G.; Gekle, M.; Humpf, H.-U. Identification and Apoptotic Potential of T-2 Toxin Metabolites in Human Cells. J. Agric. Food Chem. 2012, 60, 5676–5684. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, X.; Wang, Z.; Wang, X.; Yan, X.; He, Q.; Liu, S.; Ye, M.; Li, X.; Yuan, Z.; Wu, J.; et al. Involvement of endoplasmic reticulum stress-activated PERK-eIF2α-ATF4 signaling pathway in T-2 toxin-induced apoptosis of porcine renal epithelial cells. Toxicol. Appl. Pharmacol. 2021, 432, 115753. [Google Scholar] [CrossRef] [Scilit]
- Yang, L.; Tu, D.; Zhao, Z.; Cui, J. Cytotoxicity and apoptosis induced by mixed mycotoxins (T-2 and HT-2 toxin) on primary hepatocytes of broilers in vitro. Toxicon 2017, 129, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Wei, Y.; Xie, Y.; Yan, C.; Du, H.; Li, Z. Ochratoxin A and fumonisin B1 exhibit synergistic cytotoxic effects by inducing apoptosis on rat liver cells. Toxicon 2020, 181, 19–27. [Google Scholar] [CrossRef] [Scilit]
- Babaei, Z.; Panjehpour, M.; Parsian, H.; Aghaei, M. SAR131675 Receptor Tyrosine Kinase Inhibitor Induces Apoptosis through Bcl-2/Bax/Cyto c Mitochondrial Pathway in Human Umbilical Vein Endothelial Cells. Anti-Cancer Agents Med. Chem. 2021, 21, 1. [Google Scholar] [CrossRef] [Scilit]
- Li, D.; Ma, H.; Ye, Y.; Ji, C.; Tang, X.; Ouyang, D.; Chen, J.; Li, Y.; Ma, Y. Deoxynivalenol induces apoptosis in mouse thymic epithelial cells through mitochondria-mediated pathway. Environ. Toxicol. Pharmacol. 2014, 38, 163–171. [Google Scholar] [CrossRef] [Scilit]
- Huang, W.; Liao, C.-C.; Han, Y.; Lv, J.; Lei, M.; Li, Y.; Lv, Q.; Dong, D.; Zhang, S.; Pan, Y.-H.; et al. Co-activation of Akt, Nrf2, and NF-κB signals under UPRER in torpid Myotis ricketti bats for survival. Commun. Biol. 2020, 3, 658. [Google Scholar] [CrossRef] [Scilit]
- Orzaez, M.; Medina, M.S.; Perezpaya, E. Cyclin-Dependent Kinase (CDK) Inhibitors. Methods Mol. Biol. 2016, 1336. [Google Scholar] [CrossRef] [Scilit]
- Tian, J.; Guo, S.; Chen, H.; Peng, J.-J.; Jia, M.-M.; Li, N.-S.; Zhang, X.-J.; Yang, J.; Luo, X.-J.; Peng, J. Combination of Emricasan with Ponatinib Synergistically Reduces Ischemia/Reperfusion Injury in Rat Brain Through Simultaneous Prevention of Apoptosis and Necroptosis. Transl. Stroke Res. 2018, 9, 382–392. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Galluzzi, L.; López-Soto, A.; Kumar, S.; Kroemer, G. Caspases Connect Cell-Death Signaling to Organismal Homeostasis. Immunity 2016, 44, 221–231. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, J.; Cai, Q.; Jiang, M.; Liu, Y.; Gu, H.; Guo, J.; Sun, H.; Fang, J.; Jin, L. Mesencephalic astrocyte-derived neurotrophic factor alleviated 6-OHDA-induced cell damage via ROS-AMPK/mTOR mediated autophagic inhibition. Exp. Gerontol. 2017, 89, 45–56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, W.; Zhang, S.; Zhang, M.; Yang, L.; Cheng, B.; Li, J.; Shan, A. Individual and combined effects of Fusarium toxins on apoptosis in PK15 cells and the protective role of N-acetylcysteine. Food Chem. Toxicol. 2018, 111, 27–43. [Google Scholar] [CrossRef] [Scilit]
- Li, N.; Chen, X.W.; Deng, W.-J.; Giesy, J.P.; Zheng, H.-L. PBDEs and Dechlorane Plus in the environment of Guiyu, Southeast China: A historical location for E-waste recycling (2004, 2014). Chemosphere 2018, 199, 603–611. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Liu, Q.; Sun, J.; Wang, J.; Liu, X.; Gao, J. Mitochondrial protective mechanism of simvastatin protects against amyloid β peptide-induced injury in SH-SY5Y cells. Int. J. Mol. Med. 2018, 41, 2997–3005. [Google Scholar] [CrossRef] [Scilit]
- Sun, S.; Zhao, Z.; Rao, Q.; Li, X.; Ruan, Z.; Yang, J. BDE-47 induces nephrotoxicity through ROS-dependent pathways of mitochondrial dynamics in PK15 cells. Ecotoxicol. Environ. Saf. 2021, 222, 112549. [Google Scholar] [CrossRef] [Scilit]
- Masui, T.; Ota, I.; Kanno, M.; Yane, K.; Hosoi, H. Low-intensity ultrasound enhances the anticancer activity of cetuximab in human head and neck cancer cells. Exp. Ther. Med. 2013, 5, 11–16. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]




| Gene | Accession No. | Sequence of Primer Pairs (5′ → 3′) | Product Size/bp |
|---|---|---|---|
| Bax | XM_003355975.2 | F: AGCTGAGCGAGTGTCTCAAG | 95 |
| R: AGAAGAGACCACTCCTGGGT | |||
| Bcl-2 | XM_003121700.4 | F: ACACCTGGATCCAGGATAAC | 94 |
| R: AGAGACAGCCAGGAGAAATC | |||
| caspase 3 | NM_214131.1 | F: TTGGACTGTGGGATTGAGAC | 154 |
| R: GTGACTGGATGAACCAGGATC | |||
| caspase 8 | NM_001031779.2 | F: ACTGTCTGGGAGAACAGGAC | 147 |
| R: CCTTAATGTTGTGAAGTCTGG | |||
| Cytc | NM_001129970.1 | F: CTGGATTCTCTTACACAGATGC | 156 |
| R: CTATCAAGTCTTCCCTTTCTCC | |||
| GADPH | NM_001206359 | F: CACGATGGTGAAGGTCGGAG | 180 |
| R: TTGACTGTGCCGTGGAACTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, J.; Zhao, Z.; Guo, W.; Ling, A.; Wang, J.; Wang, X.; Yang, J. Potential Role of Individual and Combined Effects of T-2 Toxin, HT-2 Toxin and Neosolaniol on the Apoptosis of Porcine Leydig Cells. Toxins 2022, 14, 145. https://doi.org/10.3390/toxins14020145
Xu J, Zhao Z, Guo W, Ling A, Wang J, Wang X, Yang J. Potential Role of Individual and Combined Effects of T-2 Toxin, HT-2 Toxin and Neosolaniol on the Apoptosis of Porcine Leydig Cells. Toxins. 2022; 14(2):145. https://doi.org/10.3390/toxins14020145
Chicago/Turabian StyleXu, Jingru, Zhihui Zhao, Wenbo Guo, Aru Ling, Jianhua Wang, Xichun Wang, and Junhua Yang. 2022. "Potential Role of Individual and Combined Effects of T-2 Toxin, HT-2 Toxin and Neosolaniol on the Apoptosis of Porcine Leydig Cells" Toxins 14, no. 2: 145. https://doi.org/10.3390/toxins14020145
APA StyleXu, J., Zhao, Z., Guo, W., Ling, A., Wang, J., Wang, X., & Yang, J. (2022). Potential Role of Individual and Combined Effects of T-2 Toxin, HT-2 Toxin and Neosolaniol on the Apoptosis of Porcine Leydig Cells. Toxins, 14(2), 145. https://doi.org/10.3390/toxins14020145

