A Novel and Efficient High-Yield Method for Preparing Bacterial Ghosts
Abstract
:1. Introduction
2. Results
2.1. Lysis Activity of Protein EW and EM with Plasmid pLysS in E. coli BL21(DE3)
2.2. Morphological Observation of BGs by SEM and TEM
2.3. Immunofluorescence Microscopy and Western Blot Analysis
2.4. Construction of an Engineered SE (∆lon) Strain Expressing T7 RNAP and Being Suitable for BG Formation
2.5. Growth, Lysis, and Characterization of SE Ghosts
3. Discussion
4. Materials and Methods
4.1. Organism, Plasmids, and Culture Conditions
4.2. Protein E Plasmid Construction
4.3. Construction of SE with Lon Deletion and T7 RNAP Insertion Mutation
4.4. Induction Expression of Lysis Genes
4.5. Scanning Electron Microscopy (SEM)
4.6. Transmission Electron Microscopy (TEM)
4.7. Immunofluorescence Microscopy
4.8. Western Blot Analysis
4.9. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Langemann, T.; Koller, V.J.; Muhammad, A.; Kudela, P.; Mayr, U.B.; Lubitz, W. The Bacterial Ghost platform system: Production and applications. Bioeng. Bugs 2010, 1, 326–336. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, X.; Lu, C. Mice orally vaccinated with Edwardsiella tarda ghosts are significantly protected against infection. Vaccine 2009, 27, 1571–1578. [Google Scholar] [CrossRef]
- Peng, W.; Si, W.; Yin, L.; Liu, H.; Yu, S.; Liu, S.; Wang, C.; Chang, Y.; Zhang, Z.; Hu, S. Salmonella enteritidis ghost vaccine induces effective protection against lethal challenge in specific-pathogen-free chicks. Immunobiology 2011, 216, 558–565. [Google Scholar] [CrossRef] [PubMed]
- Huter, V.; Szostak, M.P.; Gampfer, J.; Prethaler, S.; Wanner, G.; Gabor, F.; Lubitz, W. Bacterial ghosts as drug carrier and targeting vehicles. J. Control. Release 1999, 61, 51–63. [Google Scholar] [CrossRef]
- Lim, J.; Koh, V.H.Q.; Cho, S.S.L.; Periaswamy, B.; Choi, D.P.S.; Vacca, M.; De Sessions, P.F.; Kudela, P.; Lubitz, W.; Pastorin, G. Harnessing the Immunomodulatory Properties of Bacterial Ghosts to Boost the Anti-mycobacterial Protective Immunity. Front. Immunol. 2019, 10, 2737. [Google Scholar] [CrossRef] [PubMed]
- Paukner, S.; Kohl, G.; Lubitz, W. Bacterial ghosts as novel advanced drug delivery systems: Antiproliferative activity of loaded doxorubicin in human Caco-2 cells. J. Control. Release 2004, 94, 63–74. [Google Scholar] [CrossRef]
- Mayr, U.B.; Walcher, P.; Azimpour, C.; Riedmann, E.; Haller, C.; Lubitz, W. Bacterial ghosts as antigen delivery vehicles. Adv. Drug Deliv. Rev. 2005, 57, 1381–1391. [Google Scholar] [CrossRef]
- Won, G.; Eo, S.K.; Park, S.-Y.; Hur, J.; Lee, J.H. A Salmonella Typhi ghost induced by the E gene of phage phi X174 stimulates dendritic cells and efficiently activates the adaptive immune response. J. Vet. Sci. 2018, 19, 536–542. [Google Scholar] [CrossRef]
- Szostak, M.P.; Hensel, A.; Eko, F.O.; Klein, R.; Auer, T.; Mader, H.; Haslberger, A.; Bunka, S.; Wanner, G.; Lubitz, W. Bacterial ghosts: Non-living candidate vaccines. J. Biotechnol. 1996, 44, 161–170. [Google Scholar] [CrossRef]
- Witte, A.; Wanner, G.; Blasi, U.; Halfmann, G.; Szostak, M.; Lubitz, W. Endogenous transmembrane tunnel formation mediated by phi X174 lysis protein E. J. Bacteriol. 1990, 172, 4109–4114. [Google Scholar] [CrossRef] [Green Version]
- Hutchison, C.A., 3rd; Sinsheimer, R.L. The process of infection with bacteriophage phi-X174. X. Mutations in a phi-X Lysis gene. J. Biotechnol. 1966, 18, 429–447. [Google Scholar]
- Tanaka, S.; Clemons, W.M., Jr. Minimal requirements for inhibition of MraY by lysis protein E from bacteriophage Phi X174. Mol. Microbiol. 2012, 85, 975–985. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schon, P.; Schrot, G.; Wanner, G.; Lubitz, W.; Witte, A. Two-stage model for integration of the lysis protein E of phi X174 into the cell envelope of Escherichia coli. FEMS Microbiol. Rev. 1995, 17, 207–212. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hajam, I.A.; Dar, P.A.; Appavoo, E.; Kishore, S.; Bhanuprakash, V.; Ganesh, K. Bacterial Ghosts of Escherichia coli Drive Efficient Maturation of Bovine Monocyte-Derived Dendritic Cells. PLoS ONE 2015, 10, e0144397. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fu, L.; Lu, C. A Novel Dual Vector Coexpressing PhiX174 Lysis E Gene and Staphylococcal Nuclease A Gene on the Basis of Lambda Promoter pR and pL, Respectively. Mol. Biotechnol. 2013, 54, 436–444. [Google Scholar] [CrossRef] [PubMed]
- Zhu, W.; Zhang, Y.; Liu, X. Efficient production of safety-enhanced Escherichia coli ghosts by tandem expression of PhiX 174 mutant gene E and staphylococcal nuclease A gene. Microbiol. Res. 2015, 176, 7–13. [Google Scholar] [CrossRef] [PubMed]
- Talebkhan, Y.; Bababeik, M.; Esmaeili, M.; Oghalaei, A.; Saberi, S.; Karimi, Z.; Afkhami, N.; Mohammadi, M. Helicobacter pylori bacterial ghost containing recombinant Omp18 as a putative vaccine. J. Microbiol. Methods 2010, 82, 334–337. [Google Scholar] [CrossRef]
- Yu, S.-y.; Peng, W.; Si, W.; Yin, L.; Liu, S.-g.; Liu, H.-f.; Zhao, H.-l.; Wang, C.-l.; Chang, Y.-H.; Lin, Y.-Z. Enhancement of bacteriolysis of Shuffled phage PhiX174 gene E. Virol. J. 2011, 8, 206. [Google Scholar] [CrossRef] [Green Version]
- Amara, A.A.; Salem-Bekhit, M.M.; Alanazi, F.K. Sponge-Like: A New Protocol for Preparing Bacterial Ghosts. Sci. World J. 2013, 545741. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vinod, N.; Oh, S.; Kim, S.; Choi, C.W.; Kim, S.C.; Jung, C.-H. Chemically induced Salmonella enteritidis ghosts as a novel vaccine candidate against virulent challenge in a rat model. Vaccine 2014, 32, 3249–3255. [Google Scholar] [CrossRef]
- Simon, R.; Tennant, S.M.; Wang, J.Y.; Schmidlein, P.J.; Lees, A.; Ernst, R.K.; Pasetti, M.F.; Galen, J.E.; Levine, M.M. Salmonella enterica Serovar Enteritidis Core O Polysaccharide Conjugated to H:g,m Flagellin as a Candidate Vaccine for Protection against Invasive Infection with S. Enteritidis. Infect. Immun. 2011, 79, 4240–4249. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jung, P.H.; Sung, O.; Nagarajan, V.; Seongmi, J.; Byul, N.H.; Mo, K.J.; Hyeong, L.S.; Chang, K.S.; Ki-Sung, L.; Won, C.C. Characterization of Chemically-Induced Bacterial Ghosts (BGs) Using Sodium Hydroxide-Induced Vibrio parahaemolyticus Ghosts (VPGs). Int. J. Mol. Sci. 2016, 17, 1904. [Google Scholar]
- Marchart, J.; Rehagen, M.; Dropmann, G.; Szostak, M.P.; Alldinger, S.; Lechleitner, S.; Schlapp, T.; Resch, S.; Lubitz, W. Protective immunity against pasteurellosis in cattle, induced by Pasteurella haemolytica ghosts. Vaccine 2003, 21, 1415–1422. [Google Scholar] [CrossRef]
- Muhammad, A.; Kassmannhuber, J.; Raucher, M.; Falcon, A.A.; Wheeler, D.W.; Zhang, A.A.; Lubitz, P.; Lubitz, W. Subcutaneous Immunization of Dogs with Bordetella bronchiseptica Bacterial Ghost Vaccine. Front. Immunol. 2019, 10, 1377. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lamas, A.; Manuel Miranda, J.; Regal, P.; Vazquez, B.; Manuel Franco, C.; Cepeda, A. A comprehensive review of non-enterica subspecies of Salmonella enterica. Microbiol. Res. 2018, 206, 60–73. [Google Scholar] [CrossRef] [PubMed]
- Thompson Bastin, M.L.; Neville, N.R.; Parsons, R.E.; Flannery, A.H.; Tennant, S.J.; Johnson, C.A. An unusual case of Salmonella Enteritidis causing pneumonia, septic shock and multiple organ failure in an immunocompetent patient. IDCases 2016, 6, 85–89. [Google Scholar] [CrossRef] [Green Version]
- Jawale, C.V.; Chaudhari, A.A.; Jeon, B.W.; Nandre, R.M.; Lee, J.H. Characterization of a Novel Inactivated Salmonella enterica Serovar Enteritidis Vaccine Candidate Generated Using a Modified cI857/lambda P-R/Gene E Expression System. Infect. Immun. 2012, 80, 1502–1509. [Google Scholar] [CrossRef] [Green Version]
- Takaya, A.; Tomoyasu, T.; Tokumitsu, A.; Morioka, M.; Yamamoto, T. The ATP-dependent Lon protease of Salmonella enterica serovar Typhimurium regulates invasion and expression of genes carried on Salmonella pathogenicity island 1. J. Bacteriol. 2002, 184, 224–232. [Google Scholar] [CrossRef] [Green Version]
- Won, G.; Senevirathne, A.; Lee, J.H. Salmonella Enteritidis ghost vaccine carrying the hemagglutinin globular head (HA1) domain from H1N1 virus protects against salmonellosis and influenza in chickens. Vaccine 2020, 38, 4387–4394. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.C.; Kwon, S.; Lee, S.Y.; Chang, H.N. Improved production of a bioadhesive precursor protein by fed-batch cultivation of a recombinant Escherichia coli with a pLysS vector. Biotechnol. Lett. 1998, 20, 799–803. [Google Scholar] [CrossRef]
- O’Mahony, D.J.; Wang, H.Y.; McConnell, D.J.; Jia, F.; Zhou, S.W.; Yin, D.; Qi, S. The effect of phage T7 lysozyme on the production of biologically active porcine somatotropin in Escherichia coli from a gene transcribed by T7 RNA polymerase. Gene 1990, 91, 275–279. [Google Scholar] [CrossRef]
- Hoft, D.F.; Lottenbach, K.R.; Blazevic, A.; Turan, A.; Blevins, T.P.; Pacatte, T.P.; Yu, Y.; Mitchell, M.C.; Hoft, S.G.; Belshe, R.B. Comparisons of the Humoral and Cellular Immune Responses Induced by Live Attenuated Influenza Vaccine and Inactivated Influenza Vaccine in Adults. Clin. Vaccine Immunol. 2017, 24, e00414-16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, X.-F.; Dong, H.-L.; Wang, H.-J.; Huang, X.-Y.; Qiu, Y.-F.; Ji, X.; Ye, Q.; Li, C.; Liu, Y.; Deng, Y.-Q.; et al. Development of a chimeric Zika vaccine using a licensed live-attenuated flavivirus vaccine as backbone. Nat. Commun. 2018, 9, 673. [Google Scholar] [CrossRef] [Green Version]
- Batah, A.M.; Ahmad, T.A. The development of ghost vaccines trials. Expert Rev. Vaccines 2020, 19, 549–562. [Google Scholar] [CrossRef]
- Ebensen, T.; Paukner, S.; Link, C.; Kudela, P.; De Domenico, C.; Lubitz, W.; Guzman, C.A. Bacterial ghosts are an efficient delivery system for DNA vaccines. J. Immunol. 2004, 172, 6858–6865. [Google Scholar] [CrossRef] [Green Version]
- Xia, S.L.; Lei, J.L.; Du, M.L.; Wang, Y.M.; Cong, X.; Xiang, G.T.; Li, L.F.; Yu, S.Y.; Du, E.Q.; Liu, S.G.; et al. Enhanced protective immunity of the chimeric vector-based vaccine rAdV-SFV-E2 against classical swine fever in pigs by a Salmonella bacterial ghost adjuvant. Vet. Res. 2016, 47, 1–7. [Google Scholar] [CrossRef] [Green Version]
- Witte, A.; Brand, E.; Mayrhofer, P.; Narendja, F.; Lubitz, W. Mutations in cell division proteins FtsZ and FtsA inhibit phi X174 protein-E-mediated lysis of Escherichia coli. Arch. Microbiol. 1998, 170, 259–268. [Google Scholar] [CrossRef] [PubMed]
- Studier, F.W. Use of bacteriophage T7 lysozyme to improve an inducible T7 expression system. J. Mol. Biol. 1991, 219, 37–44. [Google Scholar] [CrossRef]
- Sezonov, G.; Joseleau-Petit, D.; D’Ari, R. Escherichia coli physiology in Luria-Bertani broth. J. Bacteriol. 2007, 189, 8746–8749. [Google Scholar] [CrossRef] [Green Version]
- Van Den Ent, F.; Lowe, J. RF cloning: A restriction-free method for inserting target genes into plasmids. J. Biochem. Bioph. Meth. 2006, 67, 67–74. [Google Scholar] [CrossRef] [PubMed]
- Yu, S.; Zhao, H.; Wang, H.; Wang, X.; Shao, G.; Xu, L.; Si, W.; Chen, L.; Zhang, W.; Liu, S. Production and characterization of mouse monoclonal antibodies against lysis protein E of phiX174. J. Virol. Methods. 2013, 189, 355–361. [Google Scholar] [CrossRef] [PubMed]
- Harry, E.J.; Pogliano, K.; Losick, R. Use of immunofluorescence to visualize cell-specific gene expression during sporulation in Bacillus subtilis. J. Bacteriol. 1995, 177, 3386–3393. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, H.; Liu, H.; Du, Y.; Liu, S.; Ni, H.; Wang, Y.; Wang, C.; Si, W.; Yang, J.; Ling, J. Development and evaluation of an indirect enzyme-linked immunosorbent assay for the detection of antibodies against Campylobacter fetus in cattle. Res. Vet. Sci. 2010, 88, 446–451. [Google Scholar] [CrossRef] [PubMed]
0 min | 120 min | Lysis Efficiency (%) | ||
---|---|---|---|---|
OD600 Value | CFU/mL | OD600 Value | CFU/mL | |
0.41 | 1.06 × 108 | 0.11 | 2.65 × 103 | 99.998 |
0.98 | 1.76 × 109 | 0.22 | 2.33 × 104 | 99.999 |
1.99 | 3.60 × 1010 | 0.43 | 4.97 × 104 | Nearly 100% |
Strains Plasmids Primers | Description | Source |
---|---|---|
Strains | ||
DH5α | Host cells for plasmid amplification | Our lab |
BL21(DE3) | Host cells for protein expression | Our lab |
SE | Wild type of Salmonella enterica subsp. enterica serovar Pullorum str. ATCC 9120 | Our lab |
SEΔlon::T7 RNAP | Deletion of lon and insertion of T7 RNAP in SE | This study |
Plasmids | ||
pUC57-EW | Template of lysis gene EW | BGI |
pET28a-EW | Lysis plasmid used in this study | This study |
PET28a-EM | Lysis plasmid used in this study | This study |
pLysS | Assisted lysis plasmid | Our lab |
pKD46 | Plasmid for λ Red homologous recombination | Our lab |
Primers | ||
P1 | ggtatggagcacagctatactatctgattacctggcggacactaaactaaTTTACACTTTATGCTTCCGG | |
P2 | cgaaatagcctgccagccctgtttttattagcgctatttgcgcgaggtcaTTACGCGAACGCGAAGTCC | |
P3 | GCAGGCTTCTGGCGAATAATT | |
P4 | CGCACCTGAATCCTTCGAAGTA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ma, Y.; Cui, L.; Wang, M.; Sun, Q.; Liu, K.; Wang, J. A Novel and Efficient High-Yield Method for Preparing Bacterial Ghosts. Toxins 2021, 13, 420. https://doi.org/10.3390/toxins13060420
Ma Y, Cui L, Wang M, Sun Q, Liu K, Wang J. A Novel and Efficient High-Yield Method for Preparing Bacterial Ghosts. Toxins. 2021; 13(6):420. https://doi.org/10.3390/toxins13060420
Chicago/Turabian StyleMa, Yi, Liu Cui, Meng Wang, Qiuli Sun, Kaisheng Liu, and Jufang Wang. 2021. "A Novel and Efficient High-Yield Method for Preparing Bacterial Ghosts" Toxins 13, no. 6: 420. https://doi.org/10.3390/toxins13060420