Patterns of Diversity of Fusarium Fungi Contaminating Soybean Grains
Abstract
1. Introduction
2. Results
2.1. Identification of Fusaria by Species-Specific PCR Assays
2.2. Identification of Fusaria through Sequence Comparisons
2.3. Phylogenetic Analysis
3. Discussion
4. Materials and Methods
4.1. Field Isolates
4.2. DNA Extraction
4.3. Identification of Fusarium Species
4.4. DNA Sequencing and Assembly
4.5. BLAST Analysis
4.6. Phylogenetic Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Pagano, M.C.; Miransari, M. The importance of soybean production worldwide. Abiotic Biot. Stress. Soybean Prod. 2016, 1, 1–26. [Google Scholar] [CrossRef]
- Clemente, T.E.; Cahoon, E.B. Soybean oil: Genetic approaches for modification of functionality and total content. Plant Physiol. 2009, 151, 1030–1040. [Google Scholar] [CrossRef] [PubMed]
- Shea, Z.; Singer, W.M.; Zhang, B. Soybean production, versatility, and improvement. Legum. Crop. 2020. [Google Scholar] [CrossRef]
- Dorrance, A.E. Management of Phytophthora sojae of soybean: A review and future perspectives. Can. J. Plant Pathol. 2018, 40, 210–219. [Google Scholar] [CrossRef]
- Langenbach, C.; Campe, R.; Beyer, S.F.; Mueller, A.N.; Conrath, U. Fighting asian soybean rust. Front. Plant Sci. 2016, 7, 797. [Google Scholar] [CrossRef]
- Spampinato, C.P.; Scandiani, M.M.; Luque, A.G. Soybean sudden death syndrome: Fungal pathogenesis and plant response. Plant Pathol. 2021, 70, 3–12. [Google Scholar] [CrossRef]
- Cruz, D.R.; Leandro, L.F.S.; Munkvold, G.P. Effects of temperature and pH on Fusarium oxysporum and Soybean Seedling Disease. Plant Dis. 2019, 103, 3234–3243. [Google Scholar] [CrossRef] [PubMed]
- Nirenberg, H. Untersuchungen über die morphologische und biologische Differenzierung in der Fusarium-Section Liseola. Mitt. Biol. Bundesanst. Land Forstwirtsch. 1976, 169, 1–117. [Google Scholar]
- Sherbakoff, C.D. Fusaria of potatoes. Mem. Cornell Univ. Agric. Exp. Station 1915, 6, 87–270. [Google Scholar]
- Saccardo, P.A. Sylloge Hyphomycetum. Sylloge Fung. 1886, 4, 1–807. [Google Scholar]
- Berkeley, M.J. Notices of North American fungi. Grevillea 1875, 3, 97–112. [Google Scholar]
- Schwabe, S.H. Flora Anhaltina; Apud Georigum Reimerum: Berlin, Germany, 1839; Volume 2, pp. 1–425. [Google Scholar]
- Gutleb, A.C.; Caloni, F.; Giraud, F.; Cortinovis, C.; Pizzo, F.; Hoffmann, L.; Bohn, T.; Pasquali, M. Detection of multiple mycotoxin occurrences in soy animal feed by traditional mycological identification combined with molecular species identification. Toxicol. Rep. 2015, 2, 275–279. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Ivić, D.; Domijan, A.-M.; Peraica, M.; Milicević, T.; Cvjetković, B. Fusarium spp. contamination of wheat, maize, soybean, and pea grain in Croatia. Arh. Hig. Rada Toksikol. 2009, 60, 435–442. [Google Scholar] [CrossRef] [PubMed]
- Chiotta, M.L.; Alaniz Zanon, M.S.; Palazzini, J.M.; Alberione, E.; Barros, G.G.; Chulze, S.N. Fusarium graminearum species complex occurrence on soybean and F. graminearum sensu stricto inoculum maintenance on residues in soybean-wheat rotation under field conditions. J. Appl. Microbiol. 2021, 130, 208–216. [Google Scholar] [CrossRef]
- Gruber-Dorninger, C.; Jenkins, T.; Schatzmayr, G. Global mycotoxin occurrence in feed: A ten-year survey. Toxins 2019, 11, 375. [Google Scholar] [CrossRef]
- Chilaka, C.A.; De Boevre, M.; Atanda, O.O.; De Saeger, S. Fate of Fusarium mycotoxins during processing of Nigerian traditional infant foods (ogi and soybean powder). Food Res. Int. 2019, 116, 408–418. [Google Scholar] [CrossRef]
- Naeem, M.; Li, H.; Yan, L.; Raza, M.A.; Gong, G.; Chen, H.; Yang, C.; Zhang, M.; Shang, J.; Liu, T.; et al. Characterization and pathogenicity of Fusarium species associated with soybean pods in maize/soybean strip intercropping. Pathogen 2019, 8, 245. [Google Scholar] [CrossRef]
- Lu, D.Y.; Qiu, D.J.; Wang, M.S.; Xu, P.J.; Ma, P.G.; Shi, D.J.; Bao, P.Z. Species diversity and toxigenic potential of Fusarium incarnatum-equiseti species complex isolates from rice and soybean in China. Plant Dis. 2021, 105, 9. [Google Scholar] [CrossRef]
- Vogelgsang, S.; Beyer, M.; Pasquali, M.; Jenny, E.; Musa, T.; Bucheli, T.D.; Wettstein, F.E.; Forrer, H.R. An eight-year survey of wheat shows distinctive effects of cropping factors on different Fusarium species and associated mycotoxins. Eur. J. Agron. 2019, 105, 62–77. [Google Scholar] [CrossRef]
- Morcia, C.; Tumino, G.; Ghizzoni, R.; Badeck, F.W.; Lattanzio, V.M.T.; Pascale, M.; Terzi, V. Occurrence of Fusarium langsethiae and T-2 and HT-2 Toxins in Italian Malting Barley. Toxins 2016, 8, 247. [Google Scholar] [CrossRef] [PubMed]
- Castañares, E.; Martínez, M.; Cristos, D.; Rojas, D.; Lara, B.; Stenglein, S.; Dinolfo, M.I. Fusarium species and mycotoxin contamination in maize in Buenos Aires province, Argentina. Eur. J. Plant Pathol. 2019, 155, 1265–1275. [Google Scholar] [CrossRef]
- Saccardo, P.A. Supplementum Universale, Pars. III. Sylloge Fung. 1895, 11, 1–753. [Google Scholar]
- Kristensen, R.; Torp, M.; Kosiak, B.; Holst-Jensen, A. Phylogeny and toxigenic potential is correlated in Fusarium species as revealed by partial translation elongation factor 1 alpha gene sequences. Mycol. Res. 2005, 109, 173–186. [Google Scholar] [CrossRef]
- Stielow, J.; Lévesque, C.; Seifert, K.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.; Groenewald, M.; Chaduli, D.; et al. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes. Persoonia 2015, 35, 242–263. [Google Scholar] [CrossRef] [PubMed]
- Geiser, D.M.; Al-Hatmi, A.M.S.; Aoki, T.; Arie, T.; Balmas, V.; Barnes, I.; Bergstrom, G.C.; Bhattacharyya, M.K.; Blomquist, C.L.; Bowden, R.L.; et al. Phylogenomic analysis of a 55.1-kb 19-gene dataset resolves a monophyletic Fusarium that includes the Fusarium solani Species Complex. Phytopathology 2021, 111, 7–1064. [Google Scholar] [CrossRef]
- Xia, J.W.; Sandoval-Denis, M.; Crous, P.W.; Zhang, X.G.; Lombard, L. Numbers to names–restyling the Fusarium incarnatum-equiseti species complex. Pers. Mol. Phylogeny Evol. Fungi 2019, 43, 186. [Google Scholar] [CrossRef]
- Kulik, T.; Abarenkov, K.; Buśko, M.; Bilska, K.; Diepeningen, A.D. van Ostrowska-Kołodziejczak, A.; Krawczyk, K.; Brankovics, B.; Stenglein, S.; Sawicki, J.; et al. ToxGen: An improved reference database for the identification of type B-trichothecene genotypes in Fusarium. PeerJ 2017, 5, e2992. [Google Scholar] [CrossRef] [PubMed]
- Crous, P.W.; Groenewald, J.Z.; Slippers, B.; Wingfield, M.J. Global food and fibre security threatened by current inefficiencies in fungal identification. Philos. Trans. Soc. Biol. Sci. 2016, 371, 20160024. [Google Scholar] [CrossRef] [PubMed]
- Chang, K.F.; Hwang, S.F.; Conner, R.L.; Ahmed, H.U.; Zhou, Q.; Fu, H.; Turnbull, G.D.; Nyandoro, R.; Strelkov, S.E.; McLaren, D.L.; et al. Effects of Fusarium avenaceum and Rhizoctonia solani on the growth of soybean in saline soils. Can. J. Plant. 2018, 99, 128–137. [Google Scholar] [CrossRef]
- Żelechowski, M.; Olszewski, J.; Kulik, T. A preliminary survey of cultured Fusaria from symptomatic legume grains in north-eastern Poland. Toxins 2019, 11, 569. [Google Scholar] [CrossRef]
- Stèpień, L.; Jestoi, M.; Chełkowski, J. Cyclic hexadepsipeptides in wheat field samples and esyn1 gene divergence among enniatin producing Fusarium avenaceum strains. World Mycotoxin. J. 2013, 6, 399–409. [Google Scholar] [CrossRef]
- Bilska, K.; Jurczak, S.; Kulik, T.; Ropelewska, E.; Olszewski, J.; Żelechowski, M.; Zapotoczny, P. Species composition and trichothecene genotype profiling of Fusarium field isolates recovered from wheat in Poland. Toxins 2018, 10, 325. [Google Scholar] [CrossRef]
- O’Donnell, K.; Sutton, D.A.; Rinaldi, M.G.; Gueidan, C.; Crous, P.W.; Geiser, D.M. Novel multilocus sequence typing scheme reveals high genetic diversity of human pathogenic members of the Fusarium incarnatum-F. equiseti and F. chlamydosporum species complexes within the United States. J. Clin. Microbiol. 2009, 47, 3851–3861. [Google Scholar] [CrossRef]
- O’Donnell, K.; Rooney, A.P.; Proctor, R.H.; Brown, D.W.; McCormick, S.P.; Ward, T.J.; Frandsen, R.J.N.; Lysøe, E.; Rehner, S.A.; Aoki, T.; et al. Phylogenetic analyses of RPB1 and RPB2 support a middle Cretaceous origin for a clade comprising all agriculturally and medically important fusaria. Fungal Genet. Biol. 2013, 52, 20–31. [Google Scholar] [CrossRef]
- Wang, M.M.; Chen, Q.; Diao, Y.Z.; Duan, W.J.; Cai, L. Fusarium incarnatum-equiseti complex from China. Persoonia 2019, 43, 70–89. [Google Scholar] [CrossRef]
- Hartman, G.L.; McCormick, S.P.; O’Donnell, K. Trichothecene-producing Fusarium species isolated from soybean roots in Ethiopia and Ghana and their pathogenicity on soybean. Plant Dis. 2019, 103, 2070–2075. [Google Scholar] [CrossRef]
- Maryani, N.; Sandoval-Denis, M.; Lombard, L.; Crous, P.W.; Kema, G.H.J. New endemic Fusarium species hitch-hiking with pathogenic Fusarium strains causing Panama disease in small-holder banana plots in Indonesia. Persoonia 2019, 43, 48–69. [Google Scholar] [CrossRef] [PubMed]
- Villani, A.; Moretti, A.; De Saeger, S.; Han, Z.; Di Mavungu, J.D.; Soares, C.M.G.; Proctor, R.H.; Venâncio, A.; Lima, N.; Stea, G.; et al. A polyphasic approach for characterization of a collection of cereal isolates of the Fusarium incarnatum-equiseti species complex. Int. J. Food Microbiol. 2016, 234, 24–35. [Google Scholar] [CrossRef] [PubMed]
- Desjardins, A.E.; Proctor, R.H. Molecular biology of Fusarium mycotoxins. Int. J. Food Microbiol. 2007, 119, 47–50. [Google Scholar] [CrossRef] [PubMed]
- Tralamazza, S.M.; Rocha, L.O.; Oggenfuss, U.; Corrêa, B.; Croll, D.; Rose, L. Complex evolutionary origins of specialized metabolite gene cluster diversity among the plant pathogenic fungi of the Fusarium graminearum species complex. Genome Biol. Evol. 2019, 11, 3106–3122. [Google Scholar] [CrossRef] [PubMed]
- Jestoi, M.J.; Rokka, M.; Yli-Mattila, T.; Parikka, P.; Rizzo, A.; Peltonen, K. Presence and concentrations of the Fusarium-related mycotoxins beauvericin, enniatins and moniliformin in finnish grain samples. Food Addit. Contam. 2007, 21, 794–802. [Google Scholar] [CrossRef] [PubMed]
- Barros, G.; Zanon, M.S.A.; Palazzini, J.M.; Haidukowski, M.; Pascale, M.; Chulze, S. Trichothecenes and zearalenone production by Fusarium equiseti and Fusarium semitectum species isolated from Argentinean soybean. Food Addit. Contam. Part Chem. Anal. Control. Expo. Risk Assess. 2012, 29, 1436–1442. [Google Scholar] [CrossRef]
- Liu, C.M.; Kachur, S.; Dwan, M.G.; Abraham, A.G.; Aziz, M.; Hsueh, P.-R.; Huang, Y.-T.; Busch, J.D.; Lamit, L.J.; Gehring, C.A.; et al. FungiQuant: A broad-coverage fungal quantitative real-time PCR assay. BMC Microbiol. 2012, 12, 255. [Google Scholar] [CrossRef] [PubMed]
- Waalwijk, C.; van der Heide, R.; de Vries, I.; van der Lee, T.; Schoen, C.; Costrel-de Corainville, G.; Häuser-Hahn, I.; Kastelein, P.; Köhl, J.; Lonnet, P.; et al. Quantitative detection of Fusarium species in wheat using TaqMan. Eur. J. Plant Pathol. 2004, 110, 481–494. [Google Scholar] [CrossRef]
- Bilska, K.; Kulik, T.; Ostrowska-Kołodziejczak, A.; Buśko, M.; Pasquali, M.; Beyer, M.; Baturo-Cieśniewska, A.; Juda, M.; Załuski, D.; Treder, K.; et al. Development of a highly sensitive FcMito qPCR assay for the quantification of the toxigenic fungal plant pathogen Fusarium culmorum. Toxins 2018, 10, 211. [Google Scholar] [CrossRef]
- Nicolaisen, M.; Suproniene, S.; Nielsen, L.K.; Lazzaro, I.; Spliid, N.H.; Justesen, A.F. Real-time PCR for quantification of eleven individual Fusarium species in cereals. J. Microbiol. Methods 2009, 76, 234–240. [Google Scholar] [CrossRef] [PubMed]
- Kulik, T.; Ostrowska, A.; Buśko, M.; Pasquali, M.; Beyer, M.; Stenglein, S.; Załuski, D.; Sawicki, J.; Treder, K.; Perkowski, J. Development of an FgMito assay: A highly sensitive mitochondrial based qPCR assay for quantification of Fusarium graminearum sensu stricto. Int. J. Food Microbiol. 2015, 210, 16–23. [Google Scholar] [CrossRef]
- Kulik, T.; Jestoi, M.; Okorski, A. Development of TaqMan assays for the quantitative detection of Fusarium avenaceum/Fusarium tricinctum and Fusarium poae esyn1 genotypes from cereal grain. FEMS Microbiol. Lett. 2011, 314, 49–56. [Google Scholar] [CrossRef] [PubMed]
- Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data. Available online: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 1 August 2021).
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
- Nurk, S.; Bankevich, A.; Antipov, D.; Gurevich, A.A.; Korobeynikov, A.; Lapidus, A.; Prjibelski, A.D.; Pyshkin, A.; Sirotkin, A.; Sirotkin, Y.; et al. Assembling single-cell genomes and mini-metagenomes from chimeric MDA products. J. Comput. Biol. 2013, 20, 714–737. [Google Scholar] [CrossRef]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [PubMed]
- Lanfear, R.; Frandsen, P.B.; Wright, A.M.; Senfeld, T.; Calcott, B. PartitionFinder 2: New methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Mol. Biol. Evol. 2017, 34, 772–773. [Google Scholar] [CrossRef]
- Huelsenbeck, J.P.; Ronquist, F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinf. Appl. Note 2001, 17, 754–755. [Google Scholar] [CrossRef]
- Rambaut, A.; Drummond, A.J.; Xie, D.; Baele, G.; Suchard, M.A. Posterior summarization in bayesian phylogenetics using Tracer 1.7. Syst. Biol. 2018, 67, 901–904. [Google Scholar] [CrossRef] [PubMed]
- Bradbury, P.J.; Zhang, Z.; Kroon, D.E.; Casstevens, T.M.; Ramdoss, Y.; Buckler, E.S. TASSEL: Software for association mapping of complex traits in diverse samples. Bioinformatics 2007, 23, 2633–2635. [Google Scholar] [CrossRef] [PubMed]


| Fusarium Species Reported on Soybean Grains | Fusarium Mycotoxins Reported On Soybean Grains | Location, Year of Analysis | References |
|---|---|---|---|
| F. verticillioides | fumonisins, type B trichothecenes | Italy, 2008–2010 | [13] |
| F. sporotrichioides, F. verticillioides, F. equiseti, F. semitectum | Croatia, 2002–2008 | [14] | |
| F. graminearum species complex | type B trichothecenes | Argentina, 2012–2014 | [15] |
| fumonisins, zearalenone, type A and type B trichothecenes | Worldwide sample collection, 2008–2017 | [16] | |
| fumonisins, zearalenone, type A and type B trichothecenes | Nigeria, 2019 | [17] | |
| F. fujikuroi, F. graminearum, F. proliferatum, F. incarnatum-equiseti species complex | China, 2019 | [18] | |
| F. incarnatum-equiseti species complex | China, 2020 | [19] |
| Gene | Length (bp) | SNPs | Indels * | %PS | π |
| tef-1α | 727 | 30 | 3 | 4.55 | 0.03 |
| top1 | 818 | 17 | 4 | 2.57 | 0.01 |
| rpb1 | 1606 | 39 | 0 | 2.43 | 0.01 |
| rpb2 | 1853 | 24 | 0 | 1.3 | 0.01 |
| tub2 | 1352 | 15 | 79 | 6.95 | 0.04 |
| pgk | 889 | 47 | 2 | 5.51 | 0.03 |
| cam | 712 | 92 | 129 | 31.04 | 0.05 |
| lsu | 1074 | 14 | 201 | 20.02 | 0.05 |
| qPCR Assay | Primer/Probe Sequence | Reaction Reagents | Reaction Conditions | References |
|---|---|---|---|---|
| FungiQuant | GGRAAACTCACCAGGTCCAG | A | 95 °C for 20 s, (95 °C for 1 s, 60 °C for 30 s) × 40 | [44] |
| GSWCTATCCCCAKCACGA | ||||
| Probe:FAM-TGGTGCATGGCCGTT-MGB | ||||
| Species | ||||
| F. avenaceum | CCATCGCCGTGGCTTTC CAAGCCCACAGACACGTTGT Probe: FAM-ACGCAATTGACTATTGC-MGB | B | 95 °C for 20 s, (95 °C for 1 s, 60 °C for 50 s) × 40 | [45] |
| F. culmorum | TCGTTGACGGTGAGGGTTGT GACTCGAACACGTCAACCAACT Probe:FAM-CGGTTATTATTTCGAAAAGT-MGB | A | 95 °C for 20 s, (95 °C for 1 s, 60 °C for 30 s) × 40 | [46] |
| F. equiseti | CACCGTCATTGGTATGTTGTCATC TGTTAGCATGAGAAGGTCATGAGTG | C | 95 °C for 5 min, (95 °C for 15 s, 65 °C for 60 s) × 40, dissociation curve analysis at 60–95 °C. | [47] |
| F. graminearum s.s. | TGGCCTGAATGAAGGATTTCTAG CATCGTTGTTAACTTATTGGAGATG Probe:FAM-TTAAACACTCAAACACTACA-MGB | A | 95 °C for 20 s, (95 °C for 1 s, 60 °C for 30 s) × 40 | [48] |
| F. langsethiae | CAAGTCGACCACTGTGAGTACCTCT TGTCAAAGCATGTCAGTAAAGATGAC | C | 95 °C for 5 min, (95 °C for 15 s, 65 °C for 60 s) × 40, dissociation curve analysis at 60–95 °C. | [47] |
| F. poae | AAATCGGCGTATAGGGTTGAGATA GCTCACACAGAGTAACCGAAACCT Probe:FAM-CAAAATCACCCAACCGACCCTTTC-TAMRA | B | 50 °C for 2 min, 95 °C for 10 min, (95 °C for 15 s, 60 °C for 60 s) × 40 | [45] |
| F. proliferatum | CTTCGATCGCGCGTCCT CACGTTTCGAATCGCAAGTG | C | 95 °C for 5 min, (95 °C for 15 s, 65 °C for 60 s) × 40, dissociation curve analysis at 60–95 °C. | [47] |
| F. sporotrichioides | GCAAGTCGACCACTGTGAGTACA CTGTCAAAGCATGTCAGTAAAAATGAT | C | 95 °C for 5 min, (95 °C for 15 s, 65 °C for 60 s) × 40, dissociation curve analysis at 60–95 °C. | [47] |
| F. subglutinans | TCATTGGTATGTTGTCGCTCATG GTGATATGTTAGTACGAATAAAGGGAGAAC | C | 95 °C for 5 min, (95 °C for 15 s, 65 °C for 60 s) × 40, dissociation curve analysis at 60–95 °C. | [47] |
| F. verticillioides | CGTTTCTGCCCTCTCCCA TGCTTGACACGTGACGATGA | C | 95 °C for 5 min, (95 °C for 15 s, 65 °C for 60 s) × 40, dissociation curve analysis at 60–95 °C. | [47] |
| Enniatin genotype | AGCAGTCGAGTTCGTCAACAGA GGCYTTTCCTGCGAACTTG Probe: FAM-CCGTCGAGTCCTCT-MGB | B | 95 °C for 20 s, (95 °C for 3 s, 60 °C for 30 s) × 40 | [49] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Żelechowski, M.; Molcan, T.; Bilska, K.; Myszczyński, K.; Olszewski, J.; Karpiesiuk, K.; Wyrębek, J.; Kulik, T. Patterns of Diversity of Fusarium Fungi Contaminating Soybean Grains. Toxins 2021, 13, 884. https://doi.org/10.3390/toxins13120884
Żelechowski M, Molcan T, Bilska K, Myszczyński K, Olszewski J, Karpiesiuk K, Wyrębek J, Kulik T. Patterns of Diversity of Fusarium Fungi Contaminating Soybean Grains. Toxins. 2021; 13(12):884. https://doi.org/10.3390/toxins13120884
Chicago/Turabian StyleŻelechowski, Maciej, Tomasz Molcan, Katarzyna Bilska, Kamil Myszczyński, Jacek Olszewski, Krzysztof Karpiesiuk, Joanna Wyrębek, and Tomasz Kulik. 2021. "Patterns of Diversity of Fusarium Fungi Contaminating Soybean Grains" Toxins 13, no. 12: 884. https://doi.org/10.3390/toxins13120884
APA StyleŻelechowski, M., Molcan, T., Bilska, K., Myszczyński, K., Olszewski, J., Karpiesiuk, K., Wyrębek, J., & Kulik, T. (2021). Patterns of Diversity of Fusarium Fungi Contaminating Soybean Grains. Toxins, 13(12), 884. https://doi.org/10.3390/toxins13120884

