Immune Suppression Induced by Gallibacterium anatis GtxA During Interaction with Chicken Macrophage-Like HD11 Cells
Abstract
:1. Introduction
2. Results
2.1. Establishment of an Appropriate Multiplicity of Infection (MOI)
2.2. Bacterial Invasion and Intracellular Survival
2.3. Bacterial Growth
2.4. Viability of HD11 Cells Following Bacterial Exposure
2.5. Real-Time Relative Quantification of Cytokine Expressions
2.6. Real Time Relative Quantification of Apoptosis Gene Expression
2.7. Flow Cytometric Analysis of HD11 Cell Death
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Bacterial Strains and Growth Condition
5.2. Cell Lines and Culture Conditions
5.3. Establishment of an Appropriate Multiplicity of Infection (MOI)
5.4. Cell Invasion and Intracellular Survival Assay
5.5. Trypan Blue Exclusion Assay
5.6. Growth Assay
5.7. Flow Cytometric Analysis of HD11 Cell Death
5.8. Real-Time Quantitative RT-PCR
5.9. Statistical Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Christensen, H.; Bisgaard, M.; Bojesen, A.M.; Mutters, R.; Olsen, J.E. Genetic relationships among avian isolates classified as Pasteurella haemolytica, ‘Actinobacillus salpingitidis’ or Pasteurella anatis with proposal of Gallibacterium anatis gen. nov., comb. nov. and description of additional genomospecies within Gallibacterium gen. nov. Int. J. Syst. Evol. Microbiol. 2003, 53, 275–287. [Google Scholar] [PubMed]
- Bisgaard, M.; Korczak, B.M.; Busse, H.-J.; Kuhnert, P.; Bojesen, A.M.; Christensen, H. Classification of the taxon 2 and taxon 3 complex of Bisgaard within Gallibacterium and description of Gallibacterium melopsittaci sp. nov., Gallibacterium trehalosifermentans sp. nov. and Gallibacterium salpingitidis sp. nov. Int. J. Syst. Evol. Microbiol. 2009, 59, 735–744. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Frey, J.; Bosse, J.; Chang, Y.-F.; Cullen, J.; Fenwick, B.; Gerlach, G.; Gygi, D.; Haesebrouck, F.; Inzana, T.; Jansen, R. Actinobacillus pleuropneumoniae RTX-toxins: Uniform designation of haemolysins, cytolysins, pleurotoxin and their genes. Microbiology 1993, 139, 1723–1728. [Google Scholar] [CrossRef] [Green Version]
- McWhinney, D.; Chang, Y.; Young, R.; Struck, D. Separable domains define target cell specificities of an RTX hemolysin from Actinobacillus pleuropneumoniae. J. Bacteriol. 1992, 174, 291–297. [Google Scholar] [CrossRef] [Green Version]
- Bisgaard, M. Incidence of Pasteurella haemolytica in the respiratory tract of apparently healthy chickens and chickens with infectious bronchitis. Characterisation of 213 strains. Avian Pathol. 1977, 6, 285–292. [Google Scholar] [CrossRef]
- Mushin, R.; Weisman, Y.; Singer, N. Pasteurella haemolytica found in the respiratory tract of fowl. Avian Dis. 1980, 162–168. [Google Scholar] [CrossRef]
- Bojesen, A.M.; Nielsen, S.r.S.; Bisgaard, M. Prevalence and transmission of haemolytic Gallibacterium species in chicken production systems with different biosecurity levels. Avian Pathol. 2003, 32, 503–510. [Google Scholar] [CrossRef]
- Mirle, C. Studies into incidence of Pasteurella haemolytica infections and their relevance to hens, with particular reference to diseases of the egg-laying apparatus. Mon. Vet. 1991, 46, 545–549. [Google Scholar]
- Jordan, F.; Williams, N.; Wattret, A.; Jones, T. Observations on salpingitis, peritonitis and salpingoperitonitis in a layer breeder flock. Vet. Rec. 2005, 157, 573. [Google Scholar] [CrossRef]
- Neubauer, C.; De Souza-Pilz, M.; Bojesen, A.M.; Bisgaard, M.; Hess, M. Tissue distribution of haemolytic Gallibacterium anatis isolates in laying birds with reproductive disorders. Avian Pathol. 2009, 38, 1–7. [Google Scholar] [CrossRef] [Green Version]
- Bojesen, A.M.; Nielsen, O.L.; Christensen, J.P.; Bisgaard, M. In vivo studies of Gallibacterium anatis infection in chickens. Avian Pathol. 2004, 33, 145–152. [Google Scholar] [CrossRef] [PubMed]
- Persson, G.; Bojesen, A.M. Bacterial determinants of importance in the virulence of Gallibacterium anatis in poultry. Vet. Res. 2015, 46, 57. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pedersen, I.J.; Pors, S.E.; Bager Skjerning, R.J.; Nielsen, S.S.; Bojesen, A.M. Immunogenic and protective efficacy of recombinant protein GtxA-N against Gallibacterium anatis challenge in chickens. Avian Pathol. 2015, 44, 386–391. [Google Scholar] [CrossRef]
- Soto, C.; Bugueño, I.; Hoare, A.; Gonzalez, S.; Venegas, D.; Salinas, D.; Melgar-Rodríguez, S.; Vernal, R.; Gamonal, J.; Quest, A. The Porphyromonas gingivalis O antigen is required for inhibition of apoptosis in gingival epithelial cells following bacterial infection. J. Periodontal Res. 2016, 51, 518–528. [Google Scholar] [CrossRef]
- Beachey, E.H. Bacterial adherence: Adhesin-receptor interactions mediating the attachment of bacteria to mucosal surfaces. J. Infect. Dis. 1981, 143, 325–345. [Google Scholar] [CrossRef]
- de Freitas Neto, O.C.; Setta, A.; Imre, A.; Bukovinski, A.; Elazomi, A.; Kaiser, P.; Junior, A.B.; Barrow, P.; Jones, M. A flagellated motile Salmonella Gallinarum mutant (SG Fla+) elicits a pro-inflammatory response from avian epithelial cells and macrophages and is less virulent to chickens. Vet. Microbiol. 2013, 165, 425–433. [Google Scholar] [CrossRef]
- Xu, H.; Ling, J.; Gao, Q.; He, H.; Mu, X.; Yan, Z.; Gao, S.; Liu, X. Role of the lpxM lipid A biosynthesis pathway gene in pathogenicity of avian pathogenic Escherichia coli strain E058 in a chicken infection model. Vet. Microbiol. 2013, 166, 516–526. [Google Scholar] [CrossRef]
- He, H.; Genovese, K.J.; Swaggerty, C.L.; Nisbet, D.J.; Kogut, M.H. A comparative study on invasion, survival, modulation of oxidative burst, and nitric oxide responses of macrophages (HD11), and systemic infection in chickens by prevalent poultry Salmonella serovars. Foodborne Pathog. Dis. 2012, 9, 1104–1110. [Google Scholar] [CrossRef] [Green Version]
- Kristensen, B.M.; Frees, D.; Bojesen, A.M. Expression and secretion of the RTX-toxin GtxA among members of the genus Gallibacterium. Vet. Microbiol. 2011, 153, 116–123. [Google Scholar] [CrossRef]
- Tang, B.; Pors, S.E.; Kristensen, B.M.; Skjerning, R.B.J.; Olsen, R.H.; Bojesen, A.M. GtxA is a virulence factor that promotes a Th2-like response during Gallibacterium anatis infection in laying hens. Vet. Res. 2020, 51, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Bager, R.J.; Nesta, B.; Pors, S.E.; Soriani, M.; Serino, L.; Boyce, J.D.; Adler, B.; Bojesen, A.M. The Fimbrial Protein GalF-A from Gallibacterium anatis is a Virulence Factor and Vaccine Candidate. Infect. Immun. 2013, 81, 1964–1973. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bager, R.J.; Persson, G.; Nesta, B.; Soriani, M.; Serino, L.; Jeppsson, M.; Nielsen, T.K.; Bojesen, A.M. Outer membrane vesicles reflect environmental cues in Gallibacterium anatis. Vet. Microbiol. 2013, 167, 565–572. [Google Scholar] [CrossRef] [PubMed]
- Bojesen, A.; Kristensen, B.; Pors, S. The role of the capsule in the pathogenesis of Gallibacterium anatis in chickens. In Proceedings of the International Pasteurellaceae Conference (IPC), Elsinore, Denmark, 24–27 August 2011; p. 27. [Google Scholar]
- Frey, J. The role of RTX toxins in host specificity of animal pathogenic Pasteurellaceae. Vet. Microbiol. 2011, 153, 51–58. [Google Scholar] [CrossRef]
- Wiles, T.J.; Mulvey, M.A. The RTX pore-forming toxin α-hemolysin of uropathogenic Escherichia coli: Progress and perspectives. Future Microbiol. 2013, 8, 73–84. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Horn, F.; Corrêa, A.M.R.; Barbieri, N.L.; Glodde, S.; Weyrauch, K.D.; Kaspers, B.; Driemeier, D.; Ewers, C.; Wieler, L.H. Infections with avian pathogenic and fecal Escherichia coli strains display similar lung histopathology and macrophage apoptosis. PLoS ONE 2012, 7, e41031. [Google Scholar] [CrossRef] [Green Version]
- Kristensen, B.M.; Frees, D.; Bojesen, A.M. GtxA from Gallibacterium anatis, a cytolytic RTX-toxin with a novel domain organisation. Vet. Res. 2010, 41, 25. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.-P.; Lu, C.-J.; Li, Y.-T.; Yang, X.; Wang, X.-W.; Chang, H.-T.; Liu, H.-Y.; Chen, L.; Zhao, J.; Wang, C.-Q. In vitro adherence and invasion of primary chicken oviduct epithelial cells by Gallibacterium anatis. Vet. Microbiol. 2017, 203, 136–142. [Google Scholar] [CrossRef]
- Wisner, A.L.; Potter, A.A.; Köster, W. Effect of the Salmonella pathogenicity island 2 type III secretion system on Salmonella survival in activated chicken macrophage-like HD11 cells. PLoS ONE 2011, 6, e29787. [Google Scholar] [CrossRef]
- Persson, G.; Pors, S.E.; Thøfner, I.C.; Bojesen, A.M. Vaccination with outer membrane vesicles and the fimbrial protein FlfA offers improved protection against lesions following challenge with Gallibacterium anatis. Vet. Microbiol. 2018, 217, 104–111. [Google Scholar] [CrossRef]
- Arayan, L.T.; Reyes, A.W.B.; Hop, H.T.; Xuan, H.T.; Baek, E.J.; Min, W.; Kim, S. The Bactericidal Effect of High Temperature Is an Essential Resistance Mechanism of Chicken Macrophage against Brucella abortus Infection. J. Microbiol. Biotechnol. 2017, 27, 1837–1843. [Google Scholar] [CrossRef]
- Tahoun, A.; Masutani, H.; El-Sharkawy, H.; Gillespie, T.; Honda, R.P.; Kuwata, K.; Inagaki, M.; Yabe, T.; Nomura, I.; Suzuki, T. Capsular polysaccharide inhibits adhesion of Bifidobacterium longum 105-A to enterocyte-like Caco-2 cells and phagocytosis by macrophages. Gut Pathog. 2017, 9, 27. [Google Scholar] [CrossRef] [PubMed]
- de Paiva, J.B.; Leite, J.L.; da Silva, L.P.M.; Rojas, T.C.G.; de Pace, F.; Conceição, R.A.; Sperandio, V.; da Silveira, W.D. Influence of the major nitrite transporter NirC on the virulence of a Swollen Head Syndrome avian pathogenic E. coli (APEC) strain. Vet. Microbiol. 2015, 175, 123–131. [Google Scholar] [CrossRef]
- Chen, Z.-W.; Chien, M.-S.; Chang, N.-Y.; Chen, T.-H.; Wu, C.-M.; Huang, C.; Lee, W.-C.; Hsuan, S.-L. Mechanisms underlying Actinobacillus pleuropneumoniae exotoxin ApxI induced expression of IL-1β, IL-8 and TNF-α in porcine alveolar macrophages. Vet. Res. 2011, 42, 25. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Faherty, C.S.; Maurelli, A.T. Staying alive: Bacterial inhibition of apoptosis during infection. Trends Microbiol. 2008, 16, 173–180. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tatum, F.M.; Briggs, R.E.; Sreevatsan, S.S.; Zehr, E.S.; Hsuan, S.L.; Whiteley, L.O.; Ames, T.R.; Maheswaran, S.K. Construction of an isogenic leukotoxin deletion mutant ofPasteurella haemolyticaserotype 1: Characterization and virulence. Microb. Pathog. 1998, 24, 37–46. [Google Scholar] [CrossRef]
- Welch, R. RTX toxin structure and function: A story of numerous anomalies and few analogies in toxin biology. In Pore-Forming Toxins; Springer: Berlin, Germany, 2001; pp. 85–111. [Google Scholar]
- Desagher, S.; Martinou, J.-C. Mitochondria as the central control point of apoptosis. Trends Cell Biol. 2000, 10, 369–377. [Google Scholar] [CrossRef]
- Brenner, C.; Kroemer, G. Mitochondria—The death Signal integrators. Science 2000, 289, 1150–1151. [Google Scholar] [CrossRef]
- Atapattu, D.N.; Czuprynski, C.J. Mannheimia haemolytica leukotoxin induces apoptosis of bovine lymphoblastoid cells (BL-3) via a caspase-9-dependent mitochondrial pathway. Infect. Immun. 2005, 73, 5504–5513. [Google Scholar] [CrossRef] [Green Version]
- Antonsson, B. Mitochondria and the Bcl-2 family proteins in apoptosis signaling pathways. Mol. Cell. Biochem. 2004, 256, 141–155. [Google Scholar] [CrossRef]
- Beug, H.; von Kirchbach, A.; Döderlein, G.; Conscience, J.-F.; Graf, T. Chicken hematopoietic cells transformed by seven strains of defective avian leukemia viruses display three distinct phenotypes of differentiation. Cell 1979, 18, 375–390. [Google Scholar] [CrossRef]
- Amy, M.t.; Velge, P.; Senocq, D.; Bottreau, E.; Mompart, F.; Virlogeux-Payant, I. Identification of a new Salmonella enterica serovar Enteritidis locus involved in cell invasion and in the colonisation of chicks. Res. Microbiol. 2004, 155, 543–552. [Google Scholar] [CrossRef] [PubMed]
- Avelar-Freitas, B.; Almeida, V.G.; Pinto, M.C.X.; Mourão, F.A.G.; Massensini, A.R.; Martins-Filho, O.A.; Rocha-Vieira, E.; Brito-Melo, G. Trypan blue exclusion assay by flow cytometry. Braz. J. Med Biol. Res. 2014, 47, 307–315. [Google Scholar] [CrossRef] [PubMed]
- Uzuner, S.Ç. Development of a Direct Trypan Blue Exclusion Method to Detect Cell Viability of Adherent Cells into ELISA Plates. Celal Bayar Üniversitesi Fen Bilimleri Derg. 2018, 14, 99–104. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Name of Primer | Primer | Primer Sequence (5′–3′) | Accession | Conc. Used |
---|---|---|---|---|
Bcl-2 | Forward | GATGACCGAGTACCTGAACC | NM205339 | 0.2 mM |
Reverse | CAGGAGAAATCGAACAAAGGC | |||
Bax | Forward | TCCTCATCGCCATGCTCAT | XM422067 | 0.4 mM |
Reverse | CCTTGGTCTGGAAGCAGAAGA | |||
Caspase-8 | Forward | TGGCCCTCTTGAACTGAAAG | AY057940 | 0.4 mM |
Reverse | TCCACTGTCTGCTTCAATACC | |||
Caspase-9 | Forward | CGAAGGAGCAAGCACGACAG | AY057940 | 0.2 mM |
Reverse | CCGCAGCCCTCATCTAGCAT | |||
Caspase-3 | Forward | TGGCCCTCTTGAACTGAAAG | AY057940 | 0.4 mM |
Reverse | TCCACTGTCTGCTTCAATACC | |||
β-actin | Forward | TGCTGTGTTCCCATCTATCG | L08165 | 0.2 mM |
Reverse | TTGGTGACAATACCGTGTTCA |
Name of Primer | Primer | Primer Sequence(5′–3′) | Accession | Conc. Used |
---|---|---|---|---|
IL-6 | Forward | GCTCGCCGGCTTCGA | AJ250838 | 0.2 mM |
Reverse | GGTAGGTCTGAAAGGCGAACAG | |||
IL-10 | Forward | CATGCTGCTGGGCCTGAA | J621614 | 0.4 mM |
Reverse | CGTCTCCTTGATCTGCTTGATG | |||
β-actin | Forward | CCGCTCTATGAAGGCTACGC | L08165 | 0.4 mM |
Reverse | CTCTCGGCTGTGGTGGTGAA | |||
TNF-α | Forward | GCCCTTCCTGTAACCAGATG | NM_204267 | 0.2 mM |
Reverse | ACACGACAGCCAAGTCAACG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tang, B.; Bojesen, A.M. Immune Suppression Induced by Gallibacterium anatis GtxA During Interaction with Chicken Macrophage-Like HD11 Cells. Toxins 2020, 12, 536. https://doi.org/10.3390/toxins12090536
Tang B, Bojesen AM. Immune Suppression Induced by Gallibacterium anatis GtxA During Interaction with Chicken Macrophage-Like HD11 Cells. Toxins. 2020; 12(9):536. https://doi.org/10.3390/toxins12090536
Chicago/Turabian StyleTang, Bo, and Anders M. Bojesen. 2020. "Immune Suppression Induced by Gallibacterium anatis GtxA During Interaction with Chicken Macrophage-Like HD11 Cells" Toxins 12, no. 9: 536. https://doi.org/10.3390/toxins12090536