Deoxynivalenol Induces Inflammation in IPEC-J2 Cells by Activating P38 Mapk And Erk1/2
Abstract
:1. Introduction
2. Results
2.1. DON Decreases the Viability and Induces Inflammation in IPEC-J2 Cells
2.2. Identification and Functional Enrichment Analysis of Differentially Expressed Genes (DEGs)
2.3. Integration of Protein-Protein Interaction (PPI) Network Analysis
2.4. Validation of the Expression Profile Analysis by RT-qPCR
2.5. DON Promotes the Expression of Inflammatory Factors and Induces Inflammation in IPEC-J2 Cells Through p38 and ERK1/2
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Cell Culture and Treatment
4.3. Cell Viability Assay
4.4. Quantitative Real-Time PCR (qRT-PCR) Assay
4.5. Cytokine Detection by ELISA
4.6. RNA-seq Analysis
4.7. PPI Network Analysis
4.8. Western Blot Analyses
4.9. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Wu, Q.; Wang, X.; Nepovimova, E.; Miron, A.; Liu, Q.; Wang, Y.; Su, D.; Yang, H.; Li, L.; Kuca, K. Trichothecenes: Immunomodulatory effects, mechanisms and anti-cancer potential. Arch. Toxicol. 2017, 91, 3737–3785. [Google Scholar] [CrossRef]
- Sobrova, P.; Adam, V.; Vasatkova, A.; Beklova, M.; Zeman, L.; Kizek, R. Deoxynivalenol and its toxicity. Interdiscip. Toxicol. 2010, 3, 94–99. [Google Scholar] [CrossRef]
- Pestka, J.J. Deoxynivalenol: Mechanisms of action, human exposure and toxicological relevance. Arch. Toxicol. 2010, 84, 663–679. [Google Scholar] [CrossRef]
- Pestka, J.J. Deoxynivalenol-induced proinflammatory gene expression: Mechanisms and pathological sequelae. Toxins 2010, 2, 1300–1317. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, W.; Zhang, H. Role of tumor necrosis factor-alpha and interleukin-1beta in anorexia induction following oral exposure to the trichothecene deoxynivalenol (vomitoxin) in the mouse. J. Toxicol. Sci. 2014, 39, 875–886. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, W.; He, K.; Zhou, H.R.; Berthiller, F.; Adam, G.; Sugita-Konishi, Y.; Watanabe, M.; Krantis, A.; Durst, T.; Zhang, H.; et al. Effects of oral exposure to naturally-occurring and synthetic deoxynivalenol congeners on proinflammatory cytokine and chemokine mRNA expression in the mouse. Toxicol. Appl. Pharmacol. 2014, 278, 107–115. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pinton, P.; Oswald, I.P. Effect of deoxynivalenol and other Type B trichothecenes on the intestine: A review. Toxins 2014, 6, 1615–1643. [Google Scholar] [CrossRef] [PubMed]
- Lucioli, J.; Pinton, P.; Callu, P.; Laffitte, J.; Grosjean, F.; Kolf-Clauw, M.; Oswald, I.P.; Bracarense, A.P. The food contaminant deoxynivalenol activates the mitogen activated protein kinases in the intestine: Interest of ex vivo models as an alternative to in vivo experiments. Toxicon Off. J. Int. Soc. Toxinol. 2013, 66, 31–36. [Google Scholar] [CrossRef] [Green Version]
- Pinton, P.; Tsybulskyy, D.; Lucioli, J.; Laffitte, J.; Callu, P.; Lyazhri, F.; Grosjean, F.; Bracarense, A.P.; Kolf-Clauw, M.; Oswald, I.P. Toxicity of deoxynivalenol and its acetylated derivatives on the intestine: Differential effects on morphology, barrier function, tight junction proteins and mitogen-activated protein kinases. Toxicol. Sci. Off. J. Soc. Toxicol. 2012, 130, 180–190. [Google Scholar] [CrossRef]
- Garcia, G.R.; Payros, D.; Pinton, P.; Dogi, C.A.; Laffitte, J.; Neves, M.; Gonzalez Pereyra, M.L.; Cavaglieri, L.R.; Oswald, I.P. Intestinal toxicity of deoxynivalenol is limited by Lactobacillus rhamnosus RC007 in pig jejunum explants. Arch. Toxicol. 2018, 92, 983–993. [Google Scholar] [CrossRef]
- Ying, C.; Hong, W.; Nianhui, Z.; Chunlei, W.; Kehe, H.; Cuiling, P. Nontoxic concentrations of OTA aggravate DON-induced intestinal barrier dysfunction in IPEC-J2 cells via activation of NF-kappaB signaling pathway. Toxicol. Lett. 2019, 311, 114–124. [Google Scholar] [CrossRef] [PubMed]
- Yang, W.; Huang, L.; Wang, P.; Wu, Z.; Li, F.; Wang, C. The Effect of Low and High Dose Deoxynivalenol on Intestinal Morphology, Distribution and Expression of Inflammatory Cytokines of Weaning Rabbits. Toxins 2019, 11, 473. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alassane-Kpembi, I.; Puel, O.; Pinton, P.; Cossalter, A.M.; Chou, T.C.; Oswald, I.P. Co-exposure to low doses of the food contaminants deoxynivalenol and nivalenol has a synergistic inflammatory effect on intestinal explants. Arch. Toxicol. 2017, 91, 2677–2687. [Google Scholar] [CrossRef] [PubMed]
- Pearson, G.; Robinson, F.; Beers Gibson, T.; Xu, B.E.; Karandikar, M.; Berman, K.; Cobb, M.H. Mitogen-activated protein (MAP) kinase pathways: Regulation and physiological functions. Endocr. Rev. 2001, 22, 153–183. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Z.Q.; Wang, S.B.; Wang, R.G.; Zhang, W.; Wang, P.L.; Su, X.O. Phosphoproteome Analysis Reveals the Molecular Mechanisms Underlying Deoxynivalenol-Induced Intestinal Toxicity in IPEC-J2 Cells. Toxins 2016, 8, 270. [Google Scholar] [CrossRef] [Green Version]
- Wang, H.; Li, H.; Chen, X.; Huang, K. ERK1/2-mediated autophagy is essential for cell survival under Ochratoxin A exposure in IPEC-J2 cells. Toxicol. Appl. Pharmacol. 2018, 360, 38–44. [Google Scholar] [CrossRef] [PubMed]
- Springler, A.; Hessenberger, S.; Schatzmayr, G.; Mayer, E. Early Activation of MAPK p44/42 Is Partially Involved in DON-Induced Disruption of the Intestinal Barrier Function and Tight Junction Network. Toxins 2016, 8, 264. [Google Scholar] [CrossRef] [Green Version]
- Maresca, M. From the gut to the brain: Journey and pathophysiological effects of the food-associated trichothecene mycotoxin deoxynivalenol. Toxins 2013, 5, 784–820. [Google Scholar] [CrossRef]
- Kang, R.; Li, R.; Dai, P.; Li, Z.; Li, Y.; Li, C. Deoxynivalenol induced apoptosis and inflammation of IPEC-J2 cells by promoting ROS production. Environ. Pollut. 2019, 251, 689–698. [Google Scholar] [CrossRef]
- Dong, N.; Xu, X.; Xue, C.; Wang, C.; Li, X.; Bi, C.; Shan, A. Ethyl pyruvate inhibits LPS induced IPEC-J2 inflammation and apoptosis through p38 and ERK1/2 pathways. Cell Cycle 2019, 18, 2614–2628. [Google Scholar] [CrossRef]
- Sugimoto, M.; Yamaoka, Y.; Furuta, T. Influence of interleukin polymorphisms on development of gastric cancer and peptic ulcer. World J. Gastroenterol. 2010, 16, 1188–1200. [Google Scholar] [CrossRef] [PubMed]
- Ishiguro, Y. Mucosal proinflammatory cytokine production correlates with endoscopic activity of ulcerative colitis. J. Gastroenterol. 1999, 34, 66–74. [Google Scholar] [CrossRef] [PubMed]
- He, K.; Pan, X.; Zhou, H.R.; Pestka, J.J. Modulation of inflammatory gene expression by the ribotoxin deoxynivalenol involves coordinate regulation of the transcriptome and translatome. Toxicol. Sci. Off. J. Soc. Toxicol. 2013, 131, 153–163. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nagashima, H.; Nakagawa, H. Differences in the Toxicities of Trichothecene Mycotoxins, Deoxynivalenol and Nivalenol, in Cultured Cells. Jpn. Agric. Res. Q. 2014, 48, 393–397. [Google Scholar] [CrossRef] [Green Version]
- Al-Alwan, L.A.; Chang, Y.; Mogas, A.; Halayko, A.J.; Baglole, C.J.; Martin, J.G.; Rousseau, S.; Eidelman, D.H.; Hamid, Q. Differential roles of CXCL2 and CXCL3 and their receptors in regulating normal and asthmatic airway smooth muscle cell migration. J. Immunol. 2013, 191, 2731–2741. [Google Scholar] [CrossRef] [Green Version]
- Pestka, J.J.; Uzarski, R.L.; Islam, Z. Induction of apoptosis and cytokine production in the Jurkat human T cells by deoxynivalenol: Role of mitogen-activated protein kinases and comparison to other 8-ketotrichothecenes. Toxicology 2005, 206, 207–219. [Google Scholar] [CrossRef]
- Bystry, R.S.; Aluvihare, V.; Welch, K.A.; Kallikourdis, M.; Betz, A.G. B cells and professional APCs recruit regulatory T cells via CCL4. Nat. Immunol. 2001, 2, 1126–1132. [Google Scholar] [CrossRef]
- Hieshima, K.; Imai, T.; Opdenakker, G.; Van Damme, J.; Kusuda, J.; Tei, H.; Sakaki, Y.; Takatsuki, K.; Miura, R.; Yoshie, O.; et al. Molecular cloning of a novel human CC chemokine liver and activation-regulated chemokine (LARC) expressed in liver. Chemotactic activity for lymphocytes and gene localization on chromosome 2. J. Biol. Chem. 1997, 272, 5846–5853. [Google Scholar] [CrossRef] [Green Version]
- Van De Walle, J.; Romier, B.; Larondelle, Y.; Schneider, Y.J. Influence of deoxynivalenol on NF-kappaB activation and IL-8 secretion in human intestinal Caco-2 cells. Toxicol. Lett. 2008, 177, 205–214. [Google Scholar] [CrossRef]
- Moon, Y.; Yang, H.; Lee, S.H. Modulation of early growth response gene 1 and interleukin-8 expression by ribotoxin deoxynivalenol (vomitoxin) via ERK1/2 in human epithelial intestine 407 cells. Biochem. Biophys. Res. Commun. 2007, 362, 256–262. [Google Scholar] [CrossRef]
- Fecher, L.A.; Amaravadi, R.K.; Flaherty, K.T. The MAPK pathway in melanoma. Curr. Opin. Oncol. 2008, 20, 183–189. [Google Scholar] [CrossRef] [PubMed]
- Qi, M.; Elion, E.A. MAP kinase pathways. J. Cell Sci. 2005, 118, 3569–3572. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Miyake, Z.; Takekawa, M.; Ge, Q.; Saito, H. Activation of MTK1/MEKK4 by GADD45 through induced N-C dissociation and dimerization-mediated trans autophosphorylation of the MTK1 kinase domain. Mol. Cell. Biol. 2007, 27, 2765–2776. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Slack, D.N.; Seternes, O.M.; Gabrielsen, M.; Keyse, S.M. Distinct binding determinants for ERK2/p38alpha and JNK map kinases mediate catalytic activation and substrate selectivity of map kinase phosphatase-1. J. Biol. Chem. 2001, 276, 16491–16500. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Patterson, K.I.; Brummer, T.; O’Brien, P.M.; Daly, R.J. Dual-specificity phosphatases: Critical regulators with diverse cellular targets. Biochem. J. 2009, 418, 475–489. [Google Scholar] [CrossRef] [Green Version]
- Moon, Y.; Pestka, J.J. Vomitoxin-induced cyclooxygenase-2 gene expression in macrophages mediated by activation of ERK and p38 but not JNK mitogen-activated protein kinases. Toxicol. Sci. 2002, 69, 373–382. [Google Scholar] [CrossRef]
- Zhou, H.R.; Islam, Z.; Pestka, J.J. Rapid, sequential activation of mitogen-activated protein kinases and transcription factors precedes proinflammatory cytokine mRNA expression in spleens of mice exposed to the trichothecene vomitoxin. Toxicol. Sci. 2003, 72, 130–142. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van De Walle, J.; During, A.; Piront, N.; Toussaint, O.; Schneider, Y.J.; Larondelle, Y. Physio-pathological parameters affect the activation of inflammatory pathways by deoxynivalenol in Caco-2 cells. Toxicol. In Vitro 2010, 24, 1890–1898. [Google Scholar] [CrossRef]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef] [Green Version]
- Szklarczyk, D.; Franceschini, A.; Wyder, S.; Forslund, K.; Heller, D.; Huerta-Cepas, J.; Simonovic, M.; Roth, A.; Santos, A.; Tsafou, K.P.; et al. STRING v10: Protein-protein interaction networks, integrated over the tree of life. Nucleic Acids Res. 2015, 43, D447–D452. [Google Scholar] [CrossRef]
- Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef] [PubMed]
Pathways | Number | Gene upregulation | Gene downregulation | Q-value |
---|---|---|---|---|
TNF signaling pathway | 21 | TNFAIP3, MAP3K8, CCL20, CSF2, LIF, EDN1, CXCL2, IL15, NFKBIA, FOS, MAP3K14, CSF1, TNF, IL6, VCAM1, JUN, MAP3K5, PTGS2, SOCS3, BIRC3, JUNB | - | 2.03 × 10−14 |
HTLV-I infection | 17 | FZD5, EGR1, CSF2, ATF3, MYC, IL15 NFKBIA, FOS, MAP3K14, TNF, IL6, VCAM1, FOSL1, JUN, EGR2, ETS1, ETS2 | - | 3.47 × 10−05 |
MAPK signaling pathway | 15 | RASA1, GADD45G, DUSP1, MAP3K8, DUSP5, IL1A, GADD45B, MYC, FOS, MAP3K14, TNF, JUN, DUSP10, MAP3K5, DUSP6 | - | 0.000375 |
Cytokine-cytokine receptor interaction | 13 | CCL4, IL6, IL1A, CCL20, CSF2, KDR, TSLP, IL12A, LIF, IL15, CSF1, TNF, CXCL8 | - | 0.000191 |
NF-kappa B signaling pathway | 10 | VCAM1, TNF, PTGS2, CXCL8, NFKBIA, BIRC3, PLAU, CCL4, TNFAIP3, MAPK3K14 | - | 6.84 × 10−05 |
Jak-STAT signaling pathway | 10 | CSF2, TSLP, IL12A, LIF, MYC, MCL1, IL15, PIM1, IL6, SOCS3 | - | 0.001979 |
Rheumatoid arthritis | 10 | IL1A, CCL20, CSF2, IL15, FOS, CSF1, TNF, IL6, CXCL8, JUN | - | 5.21 × 10−05 |
Toll-like receptor signaling pathway | 9 | CCL4, IL12A, NFKBIA, FOS, TNF, IL6, CXCL8, JUN, SPP1 | - | 0.000926 |
Gene | Primer sequence (5′-3′) | |
---|---|---|
Sense | Antisense | |
GAPDH | CGTCAAGCTCATTTCCTGGT | TGGGATGGAAACTGGAAGTC |
IL6 | AGCAAGGAGGTACTGGCAGA | CAGGGTCTGGATCAGTGCTT |
TNF-α | AACCTCCTCTCTGCCATCAA | TAGACCTGCCCAGATTCAGC |
CXCL2 | CACAGACCCTCCGAGCTAAG | TGACTTCCGTTTGGTCACAG |
CXCL8 | GCCTCATTCCTGTGCTGGTCAG | AACAACGTGCATGGGACACTGG |
IL12A | AAGCCCTCCCTGGAAGAACTGG | TCACCGCACGAATTCTGAAGGC |
IL1A | CGAACCCGTGTTGCTGAAGGAG | TGGATGGGCGGCTGATTTGAAG |
CCL20 | GATGTCGGTGCTGCTGCTCTAC | ATTGGCGAGCTGCTGTGTGAAG |
CCL2 | CACCAGCAGCAAGTGTCCTA | GGGCAAGTTAGAAGGAAATGAA |
CCL4 | TGGTCCTGGTCGCTGCCTTC | TTCCGCACGGTGTATGTGAAGC |
IL15 | TGCATCCAGTGCTACTTGTGTT | GACCTGCACTGATACAGCCC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, H.; Deng, X.; Zhou, C.; Wu, W.; Zhang, H. Deoxynivalenol Induces Inflammation in IPEC-J2 Cells by Activating P38 Mapk And Erk1/2. Toxins 2020, 12, 180. https://doi.org/10.3390/toxins12030180
Zhang H, Deng X, Zhou C, Wu W, Zhang H. Deoxynivalenol Induces Inflammation in IPEC-J2 Cells by Activating P38 Mapk And Erk1/2. Toxins. 2020; 12(3):180. https://doi.org/10.3390/toxins12030180
Chicago/Turabian StyleZhang, Hua, Xiwen Deng, Chuang Zhou, Wenda Wu, and Haibin Zhang. 2020. "Deoxynivalenol Induces Inflammation in IPEC-J2 Cells by Activating P38 Mapk And Erk1/2" Toxins 12, no. 3: 180. https://doi.org/10.3390/toxins12030180
APA StyleZhang, H., Deng, X., Zhou, C., Wu, W., & Zhang, H. (2020). Deoxynivalenol Induces Inflammation in IPEC-J2 Cells by Activating P38 Mapk And Erk1/2. Toxins, 12(3), 180. https://doi.org/10.3390/toxins12030180