The Replacement of five Consecutive Amino Acids in the Cyt1A Protein of Bacillus thuringiensis Enhances its Cytotoxic Activity against Lung Epithelial Cancer Cells
Abstract
1. Introduction
2. Results
2.1. Determination of Cytotoxicity of Qatari Bt Strain Proteins against Lung Cancer Cells
2.2. Investigation of Genes Encoding Endotoxins, Parasporin, and Cyt Proteins
2.3. Investigation of the cyt1A Gene of Qatari Bt subsp. israelensis Strain QBT229
2.4. Translation and Amino Acid Sequence Alignment to Study the Cyt1A Protein
2.5. Chemical Differences Due to Amino Acid Replacements by Protein Modelling
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Bt Isolates and Culture Conditions
5.2. Parasporal Crystal Protein Purification and Solubilisation
5.3. Cancer Cell Line and Culture Conditions
5.4. Quantitative Cytotoxic Bioassay
5.5. Isolation of Plasmid DNA
5.6. Exploration of Endotoxin and Parasporin Encoding Genes
5.7. Gel Purification and DNA Sequencing of PCR Products
5.8. Translation, Alignment and Comparison of Amino Acid Sequences
5.9. In Silico Structural Homology Comparison of Cyt Proteins
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Jouzani, G.S.; Valijanian, E.; Sharafi, R. Bacillus thuringiensis: A successful insecticide with new environmental features and tidings. Appl. Microbiol. Biotechnol. 2017, 101, 2691–2711. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Didelot, X.; Barker, M.; Falush, D.; Priest, F.G. Evolution of pathogenicity in the Bacillus cereus group. Syst. Appl. Microbiol. 2009, 32, 81–90. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schinepf, E.; Crickmore, N.; van Rie, J.; Lereclus, D.; Baum, B.; Feitelson, J.; Zeigler, D.R.; Dean, D.H. Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol. Mol. Biol. Rev. 1998, 62, 775–806. [Google Scholar]
- Abdelmalek, N.; Sellami, S.; Ben Kridis, A.; Tounsi, S.; Rouis, S. Molecular characterisation of Bacillus thuringiensis strain MEB4 highly toxic to the Mediterranean flour moth Ephestia kuehniella Zeller (Lepidoptera: Pyralidae). Pest Manag. Sci. 2016, 72, 913–921. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nester, E.W.; Thomashow, L.S.; Metz, M. 100 Years of Bacillus thuringiensis: A Critical Scientific Assessment; American Society of Microbiology (ASM): Washington, DC, USA, 2002. [Google Scholar]
- Butko, P. Cytolytic toxin Cyt1A and its mechanism of membrane damage: Data and hypotheses. Appl. Environ. Microbiol. 2003, 69, 2415–2422. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shelton, A.; Olmstead, D.; Burness, E.; Hutchinson, W.; Dively, G.; Welty, C.; Sparks, A. Multi-state trials of Bt sweet corn varieties for control of the corn earworm (Lepidoptera: Noctuidae). J. Econ. Entomol. 2013, 106, 2151–2159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Banna, A.L.; Khyami-Horani, H.; Sadder, M.; Zahra, A.S. Efficacy of some local Bacillus thuringiensis isolates against soil borne fungal pathogens. Afr. J. Agric. Res. 2016, 11, 1750–1754. [Google Scholar] [CrossRef] [Scilit]
- Driss, F.; Rouis, S.; Azzouz, H. Integration of a Recombinant Chitinase into Bacillus thuringiensis. Curr. Microbiol. 2011, 62, 281–288. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kamoun, F.; Fguira, I.B.; Hassen, N.B.; Mejdoub, H.; Lereclus, D.; Jaoua, S. Purification and Characterization of a New Bacillus thuringiensis Bacteriocin Active Against Listeria monocytogenes, Bacillus cereus and Agrobacterium tumefaciens. Appl. Biochem. Biotechnol. 2011, 165, 300–314. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Periyasamy, A.; Kkani, P.; Chandrasekaran, B.; Ponnusamy, S.; Viswanathan, S.; Selvanayagam, P.; Rajaiah, S. Screening and characterization of a non-insecticidal Bacillus thuringiensis strain producing parasporal protein with selective toxicity against human colon cancer cell lines. Ann. Microbiol. 2016, 66, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Nadarajah, V.D.; Ting, D.; Chan, K.K.; Mohamed, S.M.; Kanakeswary, K.; Lee, H.L. Selective cytotoxic activity against leukemic cell lines from mosquitocidal Bacillus thuringiensis parasporal inclusions. Southeast Asian J. Trop. Med. Pubic. Health 2008, 39, 235–245. [Google Scholar]
- Aldeewan, A.; Zhang, Y.; Su, L. Bacillus thuringiensis parasporins functions on cancer cells. Int. J. Pure Appl. Biosci. 2014, 2, 67–74. [Google Scholar]
- Katayama, H.; Yokota, H.; Akao, T.; Nakamura, O.; Ohba, M.; Mekada, E.; Mizuki, E. Parasporin-1, a Novel Cytotoxic Protein to Human Cells from Non-Insecticidal Parasporal Inclusions of Bacillus thuringiensis. J. Biochem. 2005, 137, 17–25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamashita, S.; Katayama, H.; Saitoh, H.; Akao, T.; Park, Y.S.; Mizuki, E.; Ohba, M.; Ito, A. Typical three-domain Cry proteins of Bacillus thuringiensis strain A1462 exhibit cytocidal activity on limited human cancer cells. J. Biochem. 2005, 138, 663–672. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ammons, D.R.; Short, J.D.; Bailey, J.; Hinojosa, G.; Tavarez, L.; Salazar, M.; Rampersad, J.N. Anti-cancer parasporin toxins are associated with different environments: discovery of two novel parasporin 5-like genes. Curr. Microbiol. 2016, 72, 184–189. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ohba, M.; Mizuki, E.; Uemori, A. Parasporin, a new anticancer protein group from Bacillus thuringiensis. Anticancer Res. 2009, 29, 427–433. [Google Scholar] [PubMed]
- Okumura, S.; Saitoh, H.; Ishikawa, T.; Inouye, K.; Mizuki, E. Mode of action of parasporin-4, a cytocidal protein from Bacillus thuringiensis. Biochim. Biophys. Acta 2011, 1808, 1476–1482. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rodriguez-Almazan, C.; Ruiz de Escudero, I.; Emiliano Cantón, P.; Muñoz-Garay, C.; Pérez, C.; Gill, S.S.; Bravo, A. The amino- and carboxyl-terminal fragments of the Bacillus thuringensis Cyt1Aa toxin have differential roles on toxin oligomerization and pore formation. Biochemistry 2011, 50, 388–396. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chang, C.; Yu, Y.M.; Dai, S.M.; Law, S.K.; Gill, S.S. High-level cryIVD and cytA gene expression in Bacillus thuringiensis does not require the 20-kilodalton protein, and the co-expressed gene products are synergistic in their toxicity to mosquitoes. Appl. Environ. Microbiol. 1993, 59, 815–821. [Google Scholar] [PubMed]
- Cantón, P.E.; Reyes, E.Z.; de Escudero, I.R.; Bravo, A.; Soberón, M. Binding of Bacillus thuringiensis subsp. israelensis Cry4Ba to Cyt1Aa has an important role in synergism. Peptides 2011, 32, 595–600. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Porter, A.G.; Davidson, E.W.; Liu, J.W. Mosquitocidal toxins of bacilli and their genetic manipulation for effective biological control of mosquitoes. Microbiol. Rev. 1993, 57, 838–861. [Google Scholar] [PubMed]
- Nair, K.; Al-Thani, R.; Al-Thani, D.; Al-Yafei, F.; Ahmed, T.; Jaoua, S. Diversity of unexplored Bacillus thuringiensis strains from Qatari soil microbiome: Crystal morphology, δ-endotoxins and cry gene content. Front. Microbiol. 2018. submitted. [Google Scholar]
- Lenina, N.K.; Naveenkumar, A.; Sozhavendan, A.E. Characterization of parasporin gene harboring Indian isolates of Bacillus thuringiensis. 3 Biotech 2014, 4, 545. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mizuki, E.; Ohba, M.; Akao, T.; Yamashita, S.; Saitoh, H.; Park, Y.S. Unique activity associated with non-insecticidal Bacillus thuringiensis parasporal inclusions: in vitro cell killing action on human cancer cells. J. Appl. Microbiol. 1999, 86, 477–486. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Knowles, B.H.; White, P.J.; Nicholls, C.N.; Ellar, D.J. A broad-spectrum cytolytic toxin from Bacillus thuringiensis var. kyushuensis. Proc. Biol. Soc. 1992, 248, 1–7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thomas, W.E.; Ellar, D.J. Bacillus thuringiensis var. israelensis crystal endotoxin: Effects on insect and mammalian cells in vitro and in vivo. J. Cell Sci. 1983, 60, 181–197. [Google Scholar] [PubMed]
- Pérez, C.; Fernandez, L.E.; Sun, J.; Folch, J.L.; Gill, S.S.; Soberón, M.; Bravo, A. Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor. Proc. Natl. Acad. Sci. USA 2005, 102, 18303–18308. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Travers, R.S.; Martin, P.A.W.; Reichelderfer, C.F. Selective process for efficient isolation of soil Bacillus spp. Appl. Environ. Microbiol. 1987, 53, 1263–1266. [Google Scholar] [PubMed]
- Yasutake, K.; Bihn, N.D.; Kagoshima, K.; Uemori, A.; Ohgushi, A.; Maeda, M.; Mizuki, E.; Yu, Y.M. Occurrence of parasporin-producing Bacillus thuringiensis crystal proteins in Vietnam. Biomed. Life Sci. 2006, 92, 53–57. [Google Scholar]
- Heiss, P.; Bernatz, S.; Bruchelt, G.; Senekowitsch-Schmidtke, R. Cytotoxic effect of immunoconjugate composed of glucose-oxidase coupled to an anti-ganglioside (GD2) antibody on spheroids. Anticancer Res. 1997, 17, 3177–3178. [Google Scholar] [PubMed]
- Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 1989. [Google Scholar]
- Carozzi, N.B.; Kramer, V.C.; Warren, G.W.; Evola, S.; Koziel, M.G. Prediction of insecticidal activity of Bacillus thuringiensis strains by polymerase chain reaction product profiles. Appl. Environ. Microbiol. 1991, 57, 3057–3061. [Google Scholar] [PubMed]
- Zghal, R.Z.; Trigui, H.; Ben Ali, M.; Jaoua, S. Evidence of the importance of the Met 115 for Bacillus thuringiensis subsp. israelensis Cyt1Aa Protein cytolytic Activity in Escherichia coli. Mol. Biotechnol. 2008, 38, 121–127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guerchicoff, A.; Ugalde, R.A.; Rubinstein, C.P. Identification and characterization of a previously undescribed cyt gene in Bacillus thuringiensis subsp. israelensis. Appl. Environ. Microbiol. 1997, 63, 2716–2721. [Google Scholar] [PubMed]
- Bravo, A.; Sarabia, S.; Lopez, H.; Ontiveros, C.; Abarca, A.; Ortiz, M.; Ortiz, L.; Villalobos, F.J.; Pena, G.; Nunez-Valdez, M.E.; et al. Characterization of cry genes in a Mexican Bacillus thuringiensis strain collection. Appl. Environ. Microbiol. 1998, 64, 4965–4972. [Google Scholar] [PubMed]
- Porcar, M.; Iriarte, J.; Dumanoir, V.C.; Ferrandis, M.D.; Lecadet, M.M.; Ferrer, J.; Caballero, P. Identifcation and characterization of the new Bacillus thuringiensis serovars pirenaica (serotype H57) and iberica (serotype H59). J. Appl. Microbiol. 1999, 87, 640–648. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arnold, K.; Bordoli, L.; Kopp, J.; Schwede, T. The SWISS-MODEL workspace: A web-based environment for protein structure homology modelling. Bioinformatics 2006, 22, 195–201. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cohen, S.; Albeck, S.; Ben-Dov, E.; Cahan, R.; Firer, M.; Zaritsky, A.; Dym, O. Cyt1Aa toxin: Crystal structure reveals implications for its membrane-perforating function. J. Mol. Biol. 2011, 413, 804–814. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Amino Acid Positions | Bt subsp. israelensis H14 | Qatari Bt subsp. israelensis QBT229 |
|---|---|---|
| 225 | Lysine (+) (Charged) | Asparagine (+) (Polar) |
| 226 | Phenylalanine (Hydrophobic) | Leucine (Hydrophobic) |
| 227 | Alanine (Hydrophobic) | Histidine (+) (Polar) |
| 228 | Glutamine (Polar) | Asparagine (+) (Polar) |
| 229 | Proline (Hydrophobic) | Histidine (+) (Polar) |
| Sr. No | Genes | Primer Pairs | Sequences | Amplicon Size | References |
|---|---|---|---|---|---|
| 1 | cry4A, cry4B | Dip1A | 5′ CAAGCCGCAAATCTTGTGGA 3′ | 800 bp | [33] |
| Dip1B | 5′ ATGGCTTGTTTCGCTACATC 3′ | ||||
| 2 | cry4B | Dip2A | 5′ GGTGCTTCCTATTCTTTGG 3′ | 1293 bp | [33] |
| Dip2B | 5′ TGACCAGGTCCCTTGATTAC 3′ | ||||
| 3 | cyt1A | Cyt1A1 | 5′ GTTGTAAGCTTATGGAAAAT 3′ | 701 bp | [34] |
| Cyt1A2 | 5′ TTAGAAGCTTCCATTAATA 3′ | ||||
| 4 | cyt2 | Cyt2-1 | 5′ AATACATTTCAAGGAGCTA 3′ | 471 bp | [35] |
| Cyt2-2 | 5′ TTTCATTTTAACTTCATATC 3′ | ||||
| 5 | cry11 | Cry11-1 | 5′ TTAGAAGATACGCCAGATCAAGC 3′ | 304 bp | [36] |
| Cry11-2 | 5′ CATTTGTACTTGAAGTTGTAATCCC 3′ | ||||
| 6 | cry10 | Cry10-1 | 5′ ATATGAAATATTCAATGCTC 3′ | 614 bp | [37] |
| Cry10-2 | 5′ ATAAATTCAAGTGCCAAGTA 3′ | ||||
| 7 | cyt1C | Cyt1C1 | 5′ CAAAATCTACGGGAGCAAGG 3′ | 1320 bp | [23] |
| Cyt1C2 | 5′ GGAAGGATCCCTTTGACTTTT 3′ | ||||
| 8 | p19 | P19-1 | 5′ GCAGGAGGAACATCACCATT 3′ | 291 bp | [23] |
| P19-2 | 5′ GGATTTGCTGAGCAGGTCAT 3′ | ||||
| 9 | p20 | P20-1 | 5′ TGACGAGGAAACAGAGTATACGA 3′ | 704 bp | [23] |
| P20-2 | 5′ TGAAAGGTTAAACGTTCCGATT 3′ | ||||
| 10 | parasporin1 | PS1-94F1 | 5′ AGCACCTAATGATGATAGAGGAA 3′ | 511 bp | [16] |
| PS1-94R4 | 5′ CCCAGATTCAAATAATAACCAAGA 3′ | ||||
| 11 | parasporin2 | PS2-F | 5′ GATGGTATTGCATTAAATAATGAAAC 3′ | 306 bp | [16] |
| PS2-R | 5′ TTCTCCACCAATTTCAAAGACT 3′ | ||||
| 12 | parasporin3 | PS3-F | 5′ ATACAAGATGTGAGGAAATGATGA 3′ | 526 bp | [16] |
| PS3-R | 5′ GTATGGCTCAGCTCAATTTGA 3′ | ||||
| 13 | parasporin4 | PS4-F | 5′ ACTAGTCAGCCTATAATCAGAACGA 3′ | 377 bp | [16] |
| PS4-R | 5′ ACTATTCCAGTACCAGTGTAACC 3′ | ||||
| 14 | parasporin5 | PS5-F | 5′ TCAACGCCACAATTAACAAATA 3′ | 397 bp | [16] |
| PS5-R | 5′ TCCCTTGTATAGTTGCCTTTGT 3′ | ||||
| 15 | parasporin6 | PS6-F | 5′ TGTTTACTATGTGAAAGGTGGAGA 3′ | 446 bp | [16] |
| PS6-R | 5′ CAATAGTGGTTCCTATTGGACC 3′ |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nair, K.; Iskandarani, A.; Al-Thani, R.; Mohammad, R.; Jaoua, S. The Replacement of five Consecutive Amino Acids in the Cyt1A Protein of Bacillus thuringiensis Enhances its Cytotoxic Activity against Lung Epithelial Cancer Cells. Toxins 2018, 10, 125. https://doi.org/10.3390/toxins10030125
Nair K, Iskandarani A, Al-Thani R, Mohammad R, Jaoua S. The Replacement of five Consecutive Amino Acids in the Cyt1A Protein of Bacillus thuringiensis Enhances its Cytotoxic Activity against Lung Epithelial Cancer Cells. Toxins. 2018; 10(3):125. https://doi.org/10.3390/toxins10030125
Chicago/Turabian StyleNair, Kavita, Ahmad Iskandarani, Roda Al-Thani, Ramzi Mohammad, and Samir Jaoua. 2018. "The Replacement of five Consecutive Amino Acids in the Cyt1A Protein of Bacillus thuringiensis Enhances its Cytotoxic Activity against Lung Epithelial Cancer Cells" Toxins 10, no. 3: 125. https://doi.org/10.3390/toxins10030125
APA StyleNair, K., Iskandarani, A., Al-Thani, R., Mohammad, R., & Jaoua, S. (2018). The Replacement of five Consecutive Amino Acids in the Cyt1A Protein of Bacillus thuringiensis Enhances its Cytotoxic Activity against Lung Epithelial Cancer Cells. Toxins, 10(3), 125. https://doi.org/10.3390/toxins10030125

