Impact of a High-Fat or High-Fiber Diet on Intestinal Microbiota and Metabolic Markers in a Pig Model
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethical Approval
2.2. Animals and Housing
2.3. Study Design
2.4. Chemical and Physical Analysis
2.5. Blood Analysis
2.6. DNA Extraction
2.7. Quantitative Real-Time PCR
2.8. Analysis of Microbial Metabolites
2.9. Statistical Analysis
3. Results
3.1. General Observations
3.2. Effect of Diet Composition on Carcass Parameters
3.3. Effect of Diet Composition on Cecal and Colonic Microbiota
3.4. Effect of Diet Composition on Microbial Metabolites in Cecum and Colon
3.5. Effect of Diet on Biochemical Parameters in Blood Serum
4. Discussion
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
Abbreviations
AP | alkaline phosphatase |
AX | arabinoxylan |
Bp | base pairs |
BW | body weight |
CRP | C-reactive protein |
DM | dry matter |
F | forward |
FM | fresh matter |
Gamma GT | glutamyl transpeptidase |
GE | gross energy |
GOT | glutamic oxaloacetic transaminase |
GPT | glutamic pyruvic transaminase |
HF | high-fat/low-fiber |
LDL | low-density lipoprotein |
LF | low-fat/high-fiber |
LPS | lipopolysaccharide |
NDF | neutral detergent fiber |
R | reverse |
SCFA | short-chain fatty acids |
SEM | standard error of the mean |
References
- Conlon, M.A.; Bird, A.R. The impact of diet and lifestyle on gut microbiota and human health. Nutrients 2015, 7, 17–44. [Google Scholar] [CrossRef] [PubMed]
- Clemente, J.V.; Ursell, L.K.; Parfrey, L.W.; Knight, R. The impact of the gut microbiota on human health: An integrative view. Cell 2012, 148, 1258–1270. [Google Scholar] [CrossRef] [PubMed]
- Wu, G.D.; Chen, J.; Hoffmann, C.; Bittinger, K.; Chen, Y.Y.; Keilbaugh, S.A.; Bewtra, M.; Knights, D.; Walters, W.A.; Knight, R.; et al. Linking long-term dietary patterns with gut microbial enterotypes. Science 2011, 334, 105–108. [Google Scholar] [CrossRef] [PubMed]
- Heinritz, S.N.; Mosenthin, R.; Weiss, E. Use of pigs as a potential model for research into dietary modulation of the human gut microbiota. Nutr. Res. Rev. 2013, 26, 191–209. [Google Scholar] [CrossRef] [PubMed]
- Miquel, S.; Martin, R.; Rossi, O.; Bermudez-Humaran, L.; Chatel, J.; Sokol, H.; Thomas, M.; Wells, J.M.; Langella, P. Faecalibacterium prausnitzii and human intestinal health. Curr. Opin. Microbiol. 2013, 16, 255–261. [Google Scholar] [CrossRef] [PubMed]
- Bublitz, D.C.; Wright, P.C.; Bodager, J.R.; Rasambainarivo, F.T.; Bliska, J.B.; Gillespie, T.R. Epidemiology of pathogenic enterobacteria in humans, livestock, and peridomestic rodents in rural Madagascar. PLoS ONE 2014, 9, e101456. [Google Scholar] [CrossRef] [PubMed]
- De Filippo, C.; Cavalieria, D.; Di Paola, M.; Ramazzotti, M.; Poullet, J.B.; Massart, S.; Collini, S.; Pieraccini, G.; Lionetti, P. Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proc. Natl. Acad. Sci. USA 2010, 107, 14691–14696. [Google Scholar] [CrossRef] [PubMed]
- Creely, S.J.; McTernan, P.G.; Kusminski, C.M.; Fisher, N.M.; Da Silva, N.F.; Khanolkar, M.; Evans, M.; Harte, A.L.; Kumar, S. Lipopolysaccharide activates an innate immune system response in human adipose tissue in obesity and type 2 diabetes. Am. J. Physiol. Endocrinol. Metab. 2007, 292, E740–E747. [Google Scholar] [CrossRef] [PubMed]
- Frirdich, E.; Whitfield, C. Review: Lipopolysaccharide inner core oligosaccharide structure and outer membrane stability in human pathogens belonging to the Enterobacteriaceae. J. Innate Immun. 2005, 11, 133–144. [Google Scholar] [CrossRef]
- Myles, I.A.; Fontecilla, N.M.; Janelsins, B.M.; Vithayathil, P.J.; Segre, J.A.; Datta, S.K. Parental Dietary fat intake alters offspring. J. Immunol. 2013, 191, 3200–3209. [Google Scholar] [CrossRef] [PubMed]
- Cani, P.D.; Neyrinck, A.M.; Fava, F.; Knauf, C.; Burcelin, R.G.; Tuohy, K.M.; Gibson, G.R.; Delzenne, N.M. Selective increases of bifidobacteria in gut microflora improve high-fat-diet-induced diabetes in mice through a mechanism associated with endotoxaemia. Diabetologia 2007, 50, 2374–2383. [Google Scholar] [CrossRef] [PubMed]
- Moreira, A.P.; Texeira, T.F.; Ferreira, A.B.; Do Carmo Gouveia Peluzio, M.; De Cássia Gonçalves Alfenas, R. Influence of a high-fat diet on gut microbiota, intestinal permeability and metabolic endotoxaemia. Br. J. Nutr. 2012, 108, 801–809. [Google Scholar] [CrossRef] [PubMed]
- Bäckhed, F.; Manchester, J.K.; Semenkovich, C.F.; Gordon, J.I. Mechanisms underlying the resistance to diet-induced obesity in germ-free mice. Proc. Natl. Acad. Sci. USA 2007, 104, 979–984. [Google Scholar] [CrossRef] [PubMed]
- American Association of Cereal Chemists (AACC). The Definition of Dietary Fiber. AACC Rep. 2001, 46, 112–126. [Google Scholar]
- Fung, K.Y.; Cosgrove, L.; Lockett, T.; Head, R.; Topping, D.L. A review of the potential mechanisms for the lowering of colorectal oncogenesis by butyrate. Br. J. Nutr. 2012, 108, 820–831. [Google Scholar] [CrossRef] [PubMed]
- Graham, H.; Åman, P. The pig as a model in dietary fibre digestion studies. Scand. J. Gastroenterol. 1987, 22, 55–61. [Google Scholar] [CrossRef]
- Nguyen, T.L.A.; Vieira-Silva, S.; Liston, A.; Raes, J. How informative is the mouse for human gut microbiota research? Dis. Model Mech. 2015, 8, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Pedersen, R.; Ingerslev, H.C.; Sturek, M.; Alloosh, M.; Cirera, S.; Christoffersen, B.Ø.; Moesgaard, S.G.; Larsen, N.; Boye, M. Characterisation of gut microbiota in Ossabaw and Göttingen minipigs as models of obesity and metabolic syndrome. PLOS ONE 2013, 8, e56612. [Google Scholar] [CrossRef] [PubMed]
- Yan, H.; Potu, R.; Lu, H.; Vezzoni de Almeida, V.; Stewart, T.; Ragland, D.; Armstrong, A.; Adeola, O.; Nakatsu, C.H.; Ajuwon, K.M. Dietary fat content and fiber type modulate hind gut microbial community and metabolic markers in the pig. PLoS ONE 2013, 8, e59581. [Google Scholar] [CrossRef] [PubMed]
- Guo, X.; Xia, X.; Tang, R.; Zhou, J.; Zhao, H.; Wang, K. Development of a real-time PCR method for Firmicutes and Bacteroidetes in faeces and its application to quantify intestinal population of obese and lean pigs. Lett. Appl. Microbiol. 2008, 47, 367–373. [Google Scholar] [CrossRef] [PubMed]
- NRC. Nutrient Requirements of Swine, 11th ed.; National Academies Press: Washington, DC, USA, 2012. [Google Scholar]
- Noblet, J.; Fortune, H.; Shi, X.S.; Dubois, S. Prediction of net energy value of feeds for growing pigs. J. Anim. Sci. 1994, 72, 344–354. [Google Scholar] [PubMed]
- Pettigrew, J.E.; Moser, R.L. Fat in Swine Nutrition. In Swine Nutrition; Miller, E.R., Ullrey, D.E., Lewis, A.J., Eds.; Butterworth-Heineman: Stoneham, MA, USA, 1991; pp. 133–145. [Google Scholar]
- Naumann, C.; Basler, R. Die chemische Untersuchung von Futtermitteln. In VDLUFA-Methodenbuch Band III; VDLUFA-Verlag: Darmstadt, Germany, 1997. [Google Scholar]
- Weiss, E.; Aumiller, T.; Spindler, H.; Rosenfelder, P.; Eklund, M.; Witzig, M.; Jørgensen, H.; Bach Knudsen, K.E.; Mosenthin, R. Wheat and barley differently affect porcine intestinal microbiota. J. Sci. Food Agric. 2015. [Google Scholar] [CrossRef]
- Yu, Z.; Morrison, M. Improved extraction of PCR-quality community DNA from digesta and fecal samples. Biotechniques 2004, 36, 808–812. [Google Scholar] [PubMed]
- Lee, C.; Kim, J.; Shin, S.G.; Hwang, S. Absolute and relative QPCR quantification of plasmid copy number in Escherichia coli. J. Biotechnol. 2006, 123, 273–280. [Google Scholar] [CrossRef] [PubMed]
- Maeda, H.; Fujimoto, C.; Haruki, Y.; Maeda, T.; Kokeguchi, S.; Petelin, M.; Arai, H.; Tanimoto, I.; Nishimura, F.; Takashiba, S. Quantitative real-time PCR using TaqMan and SYBR Green for Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, tetQ gene and total bacteria. FEMS Immunol. Med. Mic. 2003, 39, 81–86. [Google Scholar] [CrossRef]
- Veiga, P.; Gallini, C.A.; Beal, C.; Michaud, M.; Delaney, M.L.; DuBois, A.; Khlebnikov, A.; van Hylckama Vlieg, J.E.T.; Punit, S.; Glickman, J.N.; et al. Bifidobacterium animalis subsp. lactis fermented milk product reduces inflammation by altering a niche for colitogenic microbes. Proc. Natl. Acad. Sci. USA 2010, 107, 18132–18137. [Google Scholar] [CrossRef] [PubMed]
- Rinttilä, T.; Kassinen, A.; Malinen, E.; Krogius, L.; Palva, A. Development of an extensive set of 16S rRNA-targeted primers for quantification of pathogenic and indigenous bacteria in fecal samples by real-time PCR. J. Appl. Microbiol. 2004, 97, 1166–1177. [Google Scholar] [CrossRef] [PubMed]
- Malinen, E.; Kassinen, A.; Rinttilä, T.; Palva, A. Comparison of real-time PCR with SYBR Green I or 5′-nuclease assays and dot-blot hybridization with rRNA-targeted oligonucleotide probes in quantification of selected faecal bacteria. Microbiology 2003, 149, 269–277. [Google Scholar] [CrossRef] [PubMed]
- Leser, T.D.; Amenuvor, J.Z.; Jensen, T.K.; Lindecrona, R.H.; Boye, M.; Moller, K. Culture-independent analysis of gut bacteria, the pig gastrointestinal tract microbiota revisited. Appl. Environ. Microbiol. 2002, 68, 673–690. [Google Scholar] [CrossRef] [PubMed]
- Sghir, A.; Gramet, G.; Suau, A.; Rochet, V.; Pochart, P.; Dore, J. Quantification of bacterial groups within human fecal flora by oligonucleotide probe hybridization. Appl. Environ. Microbiol. 2000, 66, 2263–2266. [Google Scholar] [CrossRef] [PubMed]
- Matsuki, T.; Watanabe, K.; Fujimoto, J.; Takada, T.; Tanaka, R. Use of 16S rRNA gene targeted group-specific primers for real-time PCR analysis of predominant bacteria in human feces. Appl. Environ. Microbiol. 2004, 70, 7220–7228. [Google Scholar] [CrossRef] [PubMed]
- Song, Y.; Liu, C.; Finegold, S.M. Real-time PCR quantitation of clostridia in feces of autistic children. Appl. Environ. Microbiol. 2004, 70, 6459–6465. [Google Scholar] [CrossRef] [PubMed]
- Stevenson, D.M.; Weimer, P.J. Dominance of Prevotella and low abundance of classical ruminal bacterial species in the bovine rumen revealed by relative quantification real-time PCR. Appl. Microbiol. Biotechnol. 2007, 75, 165–174. [Google Scholar] [CrossRef] [PubMed]
- Xiang, Z.T.; Qi, H.W.; Han, G.Q.; Liu, J.; Huang, Z.; Yu, B. Real-time TaqMan polymerase chain reaction to quantify the effects of different sources of dietary starch on Bifidobacterium in the intestinal tract of piglets. Afr. J. Biotechnol. 2011, 10, 5059–5067. [Google Scholar]
- Balamurugan, R.; Janardhan, H.P.; George, S.; Raghava, M.V.; Muliyil, J.; Ramakrishna, B.S. Molecular studies of fecal anaerobic commensal bacteria in acute diarrhea in children. J. Pediatr. Gastroenterol. Nutr. 2008, 46, 514–519. [Google Scholar] [CrossRef] [PubMed]
- Fuller, Z.; Louis, P.; Mihajlovski, A.; Rungapamestry, V.; Ratcliffe, B.; Duncan, A.J. Influence of cabbage processing methods and prebiotic manipulation of colonic microflora on glucosinolate breakdown in man. Br. J. Nutr. 2007, 98, 364–372. [Google Scholar] [CrossRef] [PubMed]
- Castillo, M.; Martín-Orúe, S.M.; Manzanilla, E.G.; Badiola, I.; Martín, M.; Gasa, J. Quantification of total bacteria, enterobacteria and lactobacilli populations in pig digesta by real-time PCR. Vet. Microbiol. 2006, 114, 165–170. [Google Scholar] [CrossRef] [PubMed]
- Zijlstra, J.B.; Beukema, J.; Wolthers, B.G.; Byrne, B.M.; Groen, A.; Dankert, J. Pretreatment methods prior to gas chromatographic analysis of volatile fatty acids from faecal samples. Clin. Chim. Acta 1977, 78, 243–225. [Google Scholar] [CrossRef]
- Kenward, M.G.; Roger, J.H. Small sample inference for fixed effects from restricted maximum likelihood. Biometrics 1997, 53, 983–997. [Google Scholar] [CrossRef] [PubMed]
- Winer, B.J.; Brown, D.R.; Michels, K.M. Statistical Principles in Experimental Design, 3rd ed.; McGraw-Hill: New York, NY, USA, 1991. [Google Scholar]
- Piepho, H.P. An algorithm for a letter-based representation of all-pairwise comparisons. J. Comput. Graph. Stat. 2004, 13, 456–466. [Google Scholar] [CrossRef]
- Pekas, J.C.; Yen, J.T.; Pond, W.G. Gastrointestinal, carcass and performance traits of obese versus lean genotype swine: Effect of dietary fiber. Nutr. Rep. Int. 1983, 27, 259–270. [Google Scholar]
- Pond, W.G.; Jung, H.G.; Varel, V.H. Effect of dietary fiber on young adult genetically lean, obese and contemporary pigs: Body weight, carcass measurements, organ weights and digesta content. J. Anim. Sci. 1988, 66, 699–706. [Google Scholar] [PubMed]
- Kripke, S.A.; Fox, A.D.; Berman, J.M.; Settle, R.G.; Rombeau, J.L. Stimulation of intestinal mucosal growth with intracolonic infusion of short chain fatty acids. J. Parenter. Enteral Nutr. 1989, 13, 109–116. [Google Scholar] [CrossRef]
- Scheppach, W.; Bartram, P.; Richter, A.; Richter, F.; Liepold, H.; Dusel, G.; Hofstetter, G.; Rüthlein, J.; Kasper, H. Effect of short-chain fatty acids on the human colonic mucosa in vitro. J. Parenter. Enteral Nutr. 1992, 16, 43–48. [Google Scholar] [CrossRef]
- Anugwa, F.O.; Varel, F.H.; Dickson, J.S.; Pong, W.G.; Krook, L.P. Effects of dietary fibre and protein concentration on growth, feed efficiency, visceral organ weights and large intestinal microbial populations of swine. J. Nutr. 1989, 119, 879–886. [Google Scholar] [PubMed]
- Nerbas, E. Aktualisierung von Blutparametern beim Schwein. Ph.D. Thesis, Tierärztliche Hochschule Hannover, Hannover, Germany, 2008. [Google Scholar]
- Bantle, J.P.; Wylie-Rosett, J.; Albright, A.L.; Apovian, C.M.; Clark, N.G.; Franz, M.J.; Hoogwerf, B.J.; Lichtenstein, A.H.; Mayer-Davis, E.; et al. Nutrition recommendations and interventions for diabetes: A position statement of the American Diabetes Association. Diabetes Care 2008, 31, S61–S78. [Google Scholar] [PubMed]
- Lau, D.C.; Douketis, J.D.; Morrison, K.M.; Hramiak, I.M.; Sharma, A.M.; Ur, E. Canadian clinical practice guidelines on the management and prevention of obesity in adults and children. CMAJ. 2007, 176, S1–S13. [Google Scholar] [CrossRef] [PubMed]
- Wycherley, T.P.; Noakes, M.; Clifton, P.M.; Cleanthous, X.; Keogh, J.B.; Brinkworth, G.D. A high-protein diet with resistance exercise training improves weight loss and body composition in overweight and obese patients with type 2 diabetes. Diabetes Care 2010, 33, 969–976. [Google Scholar] [CrossRef] [PubMed]
- Halton, T.L.; Hu, F.B. The effects of high protein diets on thermogenesis, satiety and weight loss: A critical review. J. Am. Coll. Nutr. 2004, 23, 373–385. [Google Scholar] [CrossRef] [PubMed]
- Krieger, J.W.; Sitren, H.S.; Daniels, M.J.; Langkamp-Henken, B. Effects of variation in protein and carbohydrate intake on body mass and composition during energy restriction: A meta-regression. Am. J. Clin. Nutr. 2006, 83, 260–274. [Google Scholar] [PubMed]
- Schindhelm, R.K.; Diamant, M.; Dekker, J.M.; Tushuizen, M.E.; Teerlink, T.; Heine, R.J. Alanine aminotransferase as a marker of non-alcoholic fatty liver disease in relation to type 2 diabetes mellitus and cardiovascular disease. Diabetes Metab. Res. Rev. 2006, 22, 437–443. [Google Scholar] [CrossRef] [PubMed]
- Peters, J.C.; Harper, A.E. Adaptation of rats to diets containing different levels of protein: Effects on food intake, plasma and brain amino acid concentrations and brain neurotransmitter metabolism. J. Nutr. 1985, 115, 382–398. [Google Scholar] [PubMed]
- Ismail, N.A.; Ragab, S.H.; Elbaky, A.A.; Shoeib, A.R.S.; Alhosary, Y.; Fekry, D. Frequency of Firmicutes and Bacteroidetes in gut microbiota in obese and normal weight Egyptian children and adults. Arch. Med. Sci. 2011, 7, 501–507. [Google Scholar] [CrossRef] [PubMed]
- Anderson, J.W.; Baird, P.; Davis, R.H.; Ferreri, S.; Knudtson, M.; Koraym, A.; Waters, V.; Williams, C.L. Health benefits of dietary fiber. Nutr. Rev. 2009, 67, 188–205. [Google Scholar] [CrossRef] [PubMed]
- Stevenson, L.; Phillips, F.; O’Sullivan, K.; Walton, J. Wheat bran: Its composition and benefits to health, a European perspective. Int. J. Food Sci. Nutr. 2012, 63, 1001–1013. [Google Scholar] [CrossRef] [PubMed]
- Varel, V.H.; Pond, W.G.; Pekas, J.C.; Yen, J.T. Influence of high-fibre diet on bacterial populations in gastrointestinal tracts of obese- and lean-genotype pigs. Appl. Environ. Microbiol. 1983, 44, 107–112. [Google Scholar]
- Smith, A.G.; Reilly, P.; Sweeney, T.; Pierce, K.M.; Gahan, D.A.; Callan, J.J.; O’Doherty, J.V. The effect of cereal type and exogenous enzyme supplementation on intestinal microbiota and nutrient digestibility in finisher pigs. Livest. Sci. 2010, 133, 148–150. [Google Scholar] [CrossRef]
- Tjalsma, H.; Boleij, A.; Marchesi, J.R.; Dutilh, B.E. A bacterial driver-passenger model for colorectal cancer: Beyond the usual suspects. Nat. Rev. Microbiol. 2012, 10, 575–582. [Google Scholar] [CrossRef] [PubMed]
- Kingston, D.G.I.; Van Tassell, R.L.; Wilkins, T.D. The fecapentaenes, potent mutagens from human feces. Chem. Res. Toxicol. 1990, 3, 391–400. [Google Scholar] [CrossRef] [PubMed]
- Moore, W.E.; Moore, L.H. Intestinal floras of populations that have high risk of colon cancer. Appl. Environ. Microbiol. 1995, 61, 3202–3207. [Google Scholar] [PubMed]
- Williams, B.A.; Zhang, D.; Lisle, A.T.; Mikkelsen, D.; McSweeney, C.S.; Kang, S.; Bryden, W.L.; Gidley, M.J. Soluble arabinoxylan enhances large intestinal microbial health biomarkers in pigs fed a red meat-containing diet. Nutrition 2015. [Google Scholar] [CrossRef] [PubMed]
- Feng, Z.M.; Li, T.J.; Wu, L.; Xiao, D.F.; Blachier, F.; Yin, Y.L. Monosodium L-Glutamate and dietary fat differently modify the composition of the intestinal microbiota in growing pigs. Obes. Facts 2015, 8, 87–100. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Archbold, T.; Kimber, M.S.; Li, J.; Lam, J.S.; Fan, M.Z. The porcine gut microbial metagenomic library for mining novel cellulases established from growing pigs fed cellulose-supplemented high-fat diets. J. Anim. Sci. 2012, 90, 400–402. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; DiBaise, J.K.; Zuccolo, A.; Kudrna, D.; Braidotti, M.; Yu, Y.; Parameswaran, P.; Crowell, M.D.; Wing, R.; Rittmann, B.E.; et al. Human gut microbiota in obesity and after gastric bypass. Proc. Natl. Acad. Sci. USA 2009, 106, 2365–2370. [Google Scholar] [CrossRef] [PubMed]
- Schwiertz, A.; Taras, D.; Schäfer, K.; Beijer, S.; Bos, N.A.; Donus, C.; Hardt, P.D. Microbiota and SCFA in lean and overweight healthy subjects. Obesity 2010, 18, 190–195. [Google Scholar] [CrossRef] [PubMed]
- Pedersen, R.; Andersen, A.D.; Mølbak, L.; Stagsted, J.; Boye, M. Changes in the gut microbiota of cloned and non-cloned control pigs during development of obesity: Gut microbiota during development of obesity in cloned pigs. BMC Microbiol. 2013, 13, 30. [Google Scholar] [CrossRef] [PubMed]
- Sokol, H.; Lay, C.; Seksik, P.; Tannock, G.W. Analysis of bacterial bowel communities of IBD patients: What has it revealed? Inflamm. Bowel Dis. 2008, 14, 858–867. [Google Scholar] [CrossRef] [PubMed]
- Miquel, S.; Martin, R.; Bridonneau, C.; Robert, V.; Sokol, H.; Bermudez-Humaran, L.G.; Thomas, M.; Langella, P. Ecology and metabolism of the beneficial intestinal commensal bacterium. Gut Microb. 2014, 5, 146–151. [Google Scholar] [CrossRef] [PubMed]
- Bouhnik, Y.; Raskine, L.; Simoneau, G.; Vicaut, E.; Neut, C.; Flourié, B.; Brouns, F.; Bornet, F.R. The capacity of nondigestible carbohydrates to stimulate fecal bifidobacteria in healthy humans: A double-blind, randomized, placebo-controlled, parallel-group, dose-response relation study. Am. J. Clin. Nutr. 2004, 80, 1658–1664. [Google Scholar] [PubMed]
- Duncan, S.H.; Louis, P.; Flint, H.J. Lactate-utilizing bacteria, isolated from human feces, that produce butyrate as a major fermentation product. Appl. Environ. Microbiol. 2004, 70, 5810–5817. [Google Scholar] [CrossRef] [PubMed]
- Kalliomäki, M.; Collado, M.C.; Salminen, S.; Isolauri, E. Early differences in fecal microbiota composition in children may predict overweight. Am. J. Clin. Nutr. 2008, 87, 534–538. [Google Scholar] [PubMed]
- Palmquist, D.L. The role of dietary fats in efficiency of ruminants. J. Nutr. 1994, 124, 1377S–1382S. [Google Scholar] [PubMed]
- Kanneganti, T.D.; Dixit, V.D. Immunological complications of obesity. Nat. Immunol. 2012, 13, 707–712. [Google Scholar] [CrossRef] [PubMed]
- Weisburger, J.H.; Reddy, B.S.; Rose, D.P.; Cohen, L.A.; Kendall, M.E.; Wynder, E.L. Protective mechanisms of dietary fibers in nutritional carcinogenesis. Basic Life Sci. 1993, 61, 45–63. [Google Scholar] [PubMed]
Ingredient, g/kg | HF | LF |
---|---|---|
Wheat | 184.9 | 477.3 |
Wheat flour a | 200.0 | |
Wheat bran b | 50.0 | 350.0 |
Casein c | 152.0 | 120.5 |
Sunflower margarine d | 70.0 | |
Sweet cream butter e | 150.0 | |
Soy oil | 30.0 | 15.0 |
Fructose f | 50.0 | |
Dextrose g | 50.0 | |
Cellulose h | 30.0 | 10.0 |
Vitamin and mineral premix i | 17.0 | 13.4 |
Potassium chloride | 1.4 | |
Monocalcium phosphate | 5.4 | |
Sodium chloride | 0.2 | |
Calcium carbonate | 4.3 | 8.5 |
Titanium dioxide | 5.0 | 5.0 |
Analyzed nutrient content | ||
Dry matter (DM), g/kg | 890.3 | 895.7 |
Crude protein, g/kg·DM | 210.2 | 244.3 |
Crude fat, g/kg·DM | 248.6 | 41.3 |
Neutral detergent fiber, g/kg·DM | 66.3 | 216.8 |
Gross energy, MJ/kg·DM | 23.3 | 19.2 |
Targeted Bacterial Group (Amplicon Size) | Item | Sequence (5′ → 3′) | Annealing Temperature (°C) | Primer Concentration (nM) | qPCR Efficiency (%) | Coefficient of Determination R2 | Reference |
---|---|---|---|---|---|---|---|
Total bacteria (147 bp) | F | GTGSTGCAYGGYYGTCGTCA | 52 | 600 | 82.6 | 0.981 | Maeda et al. [28] a |
R | ACGTCRTCCMCNCCTTCCTC | ||||||
Roseburia spp. (353 bp) | F | AGGCGGTACGGCAAGTCT | 59 | 400 | 97.7 | 0.994 | Veiga et al. [29] |
R | AGTTTYATTCTTGCGAACG | Rinttilä et al. [30] | |||||
Bacteroides-Prevotella-Porphyromonas (140 bp) | F | GGTGTCGGCTTAAGTGCCAT | 59 | 600 | 97.2 | 0.992 | Rinttilä et al. [30] |
R | CGGAYGTAAGGGCCGTGC | ||||||
Lactobacillus spp. (391 bp) | F | AGAGGTAGTAACTGGCCTTTA | 59 | 200 | 89.0 | 0.986 | Malinen et al. [31] |
R | GCGGAAACCTCCCAACA | ||||||
Enterobacteriaceae (385 bp) | F | ATGGCTGTCGTCAGCTCGT | 59 | 600 | 87.3 | 0.999 | Leser et al. [32] b |
R | CCTACTTCTTTTGCAACCCACTC | Sghir et al. [33] b | |||||
Clostridium leptum subgroup (239 bp) | F | GCACAAGCAGTGGAGT | 63.3 | 600 | 91.6 | 0.997 | Matsuki et al. [34] |
R | CTTCCTCCGTTTTGTCAA | ||||||
Clostridium cluster XIVab (150 bp) | F | GAWGAAGTATYTCGGTATGT | 57 | 600 | 102.7 | 0.996 | Song et al. [35] |
R | CTACGCWCCCTTTACAC | ||||||
Genus Prevotella (121 bp) | F | GGTTCTGAGAGGAAGGTCCCC | 59 | 600 | 101.8 | 0.996 | Stevenson & Weimer [36] |
R | TCCTGCACGCTACTTGGCTG | ||||||
Bifidobacterium spp. (126 bp) | F | CGCGTCCGGTGTGAAAG | 59 | 400 | 107.0 | 0.994 | Xiang et al. [37] |
R | CTTCCCGATATCTACACATTCCA | ||||||
Enterococcus spp. (144 bp) | F | CCCTTATTGTTAGTTGCCATCATT | 59 | 400 | 84.0 | 0.966 | Rinttilä et al. [30] |
R | ACTCGTTGTACTTCCCATTGT | ||||||
Faecalibacterium prausnitzii (203 bp) | F | GGAGGATTGACC CCTTCAGT | 59 | 600 | 85.0 | 0.985 | Balamurugan et al. [38] |
R | CTGGTCCCGAAGAAACACAT |
HF | LF | SEM | p-Values | |
---|---|---|---|---|
Weights | ||||
Body (kg) | 72.5 | 77.1 | 2.34 | 0.211 |
Carcass (kg) | 57.6 | 57.2 | 1.96 | 0.890 |
Organ weights | ||||
Empty stomach (g) | 565 | 690 | 41.6 | 0.078 |
Empty colon (g) | 1245 | 1850 | 177.9 | 0.053 |
Empty cecum (g) | 85 | 135 | 20.4 | 0.134 |
Full stomach (g) | 660 | 1385 | 98.97 | 0.002 |
Full colon (g) | 1870 | 3225 | 177.19 | 0.002 |
Liver (g) | 1195 | 1480 | 43.4 | 0.004 |
Backfat thickness (mm) | 16.4 | 10.3 | 2.34 | 0.072 |
Cecum | Colon | ||||||||
---|---|---|---|---|---|---|---|---|---|
HF | LF | SEM | p-Value | HF | LF | SEM | p-Value | ||
Total bacteria | 10.2 | 9.9 | 0.07 | 0.011 | 10.3 | 10.1 | 0.07 | 0.063 | |
Firmicutes | Roseburia spp. | 8.0 | 7.8 | 0.31 | 0.675 | 8.5 | 7.9 | 0.26 | 0.175 |
Lactobacillus spp. | 7.8 | 8.1 | 0.11 | 0.152 | 7.8 | 8.0 | 0.13 | 0.229 | |
Clostridium leptum | 7.4 | 8.3 | 0.23 | 0.034 | 7.8 | 8.3 | 0.17 | 0.056 | |
Clostridium cluster XIVab | 8.8 | 9.1 | 0.14 | 0.135 | 9.2 | 9.4 | 0.13 | 0.365 | |
Enterococcus spp. | 6.5 | 6.5 | 0.17 | 0.912 | 6.5 | 6.6 | 0.14 | 0.900 | |
Faecalibacterium prausnitzii | 6.2 | 6.8 | 0.46 | 0.373 | 6.3 | 7.1 | 0.47 | 0.300 | |
Bacteroidetes | Bacteroides group | 9.3 | 8.8 | 0.09 | 0.013 | 9.3 | 8.9 | 0.09 | 0.042 |
Prevotella spp. | 10.0 | 9.6 | 0.11 | 0.050 | 10.0 | 9.6 | 0.10 | 0.041 | |
Actinobacteria | Bifidobacterium spp. | 5.6 | 7.5 | 0.40 | 0.015 | 5.6 | 7.9 | 0.41 | 0.008 |
Proteobacteria | Enterobacteriaceae | 8.4 | 6.3 | 0.19 | <0.001 | 8.5 | 6.4 | 0.21 | <0.001 |
Cecum | Colon | |||||||
---|---|---|---|---|---|---|---|---|
HF | LF | SEM | p-Values | HF | LF | SEM | p-Values | |
SCFA, mmol/kg of DM | ||||||||
Acetate | 538.9 | 764.3 | 62.98 | 0.045 | 218.7 | 422.2 | 40.85 | 0.013 |
Propionate | 494.6 | 330.0 | 50.14 | 0.059 | 217.9 | 170.9 | 20.50 | 0.156 |
Iso-Butyrate | 6.7 | 6.5 | 0.90 | 0.857 | 8.1 | 10.8 | 1.73 | 0.315 |
Butyrate | 80.4 | 201.7 | 22.12 | 0.008 | 59.9 | 117.8 | 8.71 | 0.003 |
Iso-Valeric Acid | 8.5 | 6.9 | 1.26 | 0.407 | 10.7 | 13.8 | 2.69 | 0.449 |
Valeric Acid | 26.8 | 15.4 | 4.11 | 0.098 | 26.8 | 15.5 | 7.12 | 0.303 |
Total | 1156.0 | 1324.8 | 120.97 | 0.362 | 542.1 | 751.0 | 48.43 | 0.023 |
Ammonia, mmol/kg of DM | 21.4 | 13.4 | 3.77 | 0.184 | 15.2 | 17.2 | 2.93 | 0.645 |
Parameter | Sampling Date | p-Values | |||||
---|---|---|---|---|---|---|---|
1 | 2 | 3 | Pooled SEM | Diet | Week * Diet (HF or LF) | ||
Gamma-Gt (U/I) | HF | 33.75 w | 38.75 x | 34.25 w | 2.91 | 0.731 | 0.010 |
LF | 34.75 | 34.25 | 33.50 | 0.705 | |||
GOT (U/I) | HF | 21.25 | 20.75 a | 21.50 a | 1.94 | <0.001 | 0.962 |
LF | 25.75 | 28.67 b | 29.75 b | 0.349 | |||
GPT (U/I) | HF | 22.75 a | 21.00 a | 24.75 a | 3.67 | <0.001 | 0.176 |
LF | 56.50 b,w | 60.00 b,w | 69.00 b,x | 0.002 | |||
AP (U/I) | HF | 243.75 | 220.50 | 221.00 | 15.24 | 0.117 | 0.103 |
LF | 195.25 | 199.10 | 182.75 | 0.387 | |||
Glucose i.s. (mg/dL) | HF | 105.50 a,x | 95.00 a,w | 99.25 a,w,x | 2.79 | <0.001 | 0.049 |
LF | 90.75 b,x | 82.75 b,w,x | 77.75 b,w | 0.014 | |||
Urea (mg/dL) | HF | 20.25 a | 22.50 a | 21.75 a | 2.59 | 0.001 | 0.501 |
LF | 33.50 b,w | 42.25 b,x | 42.75 b,x | 0.002 | |||
Creatinine (mg/dL) | HF | 1.12 | 1.18 | 1.20 | 0.059 | 0.363 | 0.185 |
LF | 1.01 w | 1.09 w | 1.17 x | 0.021 | |||
Na+ (mmol/L) | HF | 138.50 a,w | 138.75 w | 142.50 x | 0.88 | 0.002 | 0.008 |
LF | 142.25 b | 141.00 | 144.25 | 0.054 | |||
K+ (mmol/L) | HF | 4.25 | 4.70 | 4.73 | 0.18 | 1.000 | 0.142 |
LF | 4.48 | 4.85 | 4.35 | 0.145 | |||
Cholesterol (mg/dL) | HF | 76.00 | 83.00 | 89.25 | 4.69 | 0.710 | 0.071 |
LF | 81.50 | 87.50 | 85.75 | 0.336 | |||
Triglycerides (mg/dL) | HF | 28.50 | 21.50 | 26.25 | 2.86 | 0.781 | 0.056 |
LF | 23.25 | 27.75 | 22.50 | 0.129 | |||
HDL (mg/dL) | HF | 38.25 w | 40.50 w | 44.25 x | 1.62 | 0.098 | 0.013 |
LF | 35.00 w | 36.75 w,x | 39.75 x | 0.046 | |||
LDL (mg/dL) | HF | 42.00 w | 48.00 w,x | 54.25 x | 3.11 | 0.617 | 0.008 |
LF | 47.00 | 51.25 | 52.00 | 0.219 | |||
LDL/HDL ratio | HF | 1.10 a,w | 1.22 a,w,x | 1.23 x | 0.05 | 0.035 | 0.005 |
LF | 1.33 b | 1.40 b | 1.33 | 0.061 | |||
CRP (mg/L) | HF | 1.03 | 1.13 | 1.13 | 0.15 | 0.623 | 0.878 |
LF | 1.45 x | 1.00 w | 1.00 w | 0.042 |
© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Heinritz, S.N.; Weiss, E.; Eklund, M.; Aumiller, T.; Heyer, C.M.E.; Messner, S.; Rings, A.; Louis, S.; Bischoff, S.C.; Mosenthin, R. Impact of a High-Fat or High-Fiber Diet on Intestinal Microbiota and Metabolic Markers in a Pig Model. Nutrients 2016, 8, 317. https://doi.org/10.3390/nu8050317
Heinritz SN, Weiss E, Eklund M, Aumiller T, Heyer CME, Messner S, Rings A, Louis S, Bischoff SC, Mosenthin R. Impact of a High-Fat or High-Fiber Diet on Intestinal Microbiota and Metabolic Markers in a Pig Model. Nutrients. 2016; 8(5):317. https://doi.org/10.3390/nu8050317
Chicago/Turabian StyleHeinritz, Sonja N., Eva Weiss, Meike Eklund, Tobias Aumiller, Charlotte M.E. Heyer, Sabine Messner, Andreas Rings, Sandrine Louis, Stephan C. Bischoff, and Rainer Mosenthin. 2016. "Impact of a High-Fat or High-Fiber Diet on Intestinal Microbiota and Metabolic Markers in a Pig Model" Nutrients 8, no. 5: 317. https://doi.org/10.3390/nu8050317
APA StyleHeinritz, S. N., Weiss, E., Eklund, M., Aumiller, T., Heyer, C. M. E., Messner, S., Rings, A., Louis, S., Bischoff, S. C., & Mosenthin, R. (2016). Impact of a High-Fat or High-Fiber Diet on Intestinal Microbiota and Metabolic Markers in a Pig Model. Nutrients, 8(5), 317. https://doi.org/10.3390/nu8050317