Next Article in Journal
Associations Between Lipid Profiles and Vitamin A and D Deficiencies Among Children and Adolescents in Zhejiang Province, China: A Cross-Sectional Study
Previous Article in Journal
Polygonatum sibiricum Polysaccharides Alleviate Simulated Weightlessness-Induced Cognitive Impairment by Gut Microbiota Modulation and Suppression of NLRP3/NF-κB Pathways
Previous Article in Special Issue
Microbiota-Based Intervention Alleviates High-Fat Diet Consequences Through Host-Microbe Environment Remodeling
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Nutrients
Volume 17
Issue 19
10.3390/nu17193158
nutrients-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Muscle Strength, Lipid Metabolism and Hepatic Steatosis Are Improved with Ursolic Acid Treatment in High-Fat Diet-Induced Obese Mice

by
Dongyang Kang
1 and
Li Cao
2,*
1
Sports Institute, Henan University of Science and Technology, Luoyang 471023, China
2
College of Food and Bioengineering, Henan University of Science and Technology, Luoyang 471023, China
*
Author to whom correspondence should be addressed.
Nutrients 2025, 17(19), 3158; https://doi.org/10.3390/nu17193158
Submission received: 11 September 2025 / Revised: 2 October 2025 / Accepted: 4 October 2025 / Published: 5 October 2025
(This article belongs to the Special Issue Hot Topics in Nutrition and Obesity)
Browse Figures
Versions Notes

Abstract

Background/Objectives: The prevalence of obesity globally has increased steadily in the past decades. Obesity, sarcopenic obesity (SO) and nonalcoholic fatty liver disease (NAFLD) commonly coexist. Ursolic acid (UA), a natural pentacyclic triterpenoid, has demonstrated potential anti-obesity properties. This study was designed to evaluate the anti-obesity efficacy of UA in a mouse model of high-fat diet (HFD)-induced obesity, with a particular focus on its impact on muscle function and NAFLD. Methods: Male C57BL/6J mice (6 weeks old) were randomly assigned to three groups (n = 20 per group): a control group (CON) fed a normal chow diet, a high-fat diet group (HFD), and a UA treatment group (UA). The HFD and UA groups received a high-fat diet for 10 weeks to induce obesity. Thereafter, mice in the UA group were administered UA orally once daily for 6 weeks. Results: In HFD-induced obese mice, UA administration significantly reduced body weight (BW), abdominal fat weight and liver weight; improved grip strength and muscle weight; and enhanced lipid profiles, including triglycerides, total cholesterol, low-density lipoprotein cholesterol and free fatty acid levels in serum. UA also improved histological changes in the liver and abdominal adipose tissues, regulated serum GH, IGF-1, T3, T4 and leptin levels and downregulated the inflammation-associated gene expression of TNF-α and IL-1β in abdominal adipose tissue. Conclusions: UA could enhance muscle strength, improve lipid metabolism and hepatic steatosis and might be considered a potential therapeutic agent for managing obesity and related metabolic diseases.

1. Introduction

Obesity is a major health problem worldwide. It is defined as abnormal or excessive fat accumulation with health risk by the World Health Organization (WHO) [1] and increases the risk of numerous diseases, including cardiovascular disease, type 2 diabetes, hyperlipidemia, fatty liver disease, cognitive impairments and various cancers [2,3,4]. The prevalence of obesity is dramatically increasing, and 20% of the world’s population will obese by 2030, according to projections [5]. Long-term over-nutrition, lack of exercise and an imbalance between energy intake and energy expenditure are factors that lead to obesity [6]. Obesity is also influenced by genetic factors [7]. Sarcopenia is defined as low muscle strength with the loss of skeletal muscle mass and function [8]. Meta-analyses have shown that sarcopenia and NAFLD have a positive association [9], and the cross-talk of cytokines produced by inflammatory reactions in skeletal muscle, liver and adipose tissue might form a triangle of harmful events that trigger the development and progression of obesity, sarcopenia and NAFLD [10]. Although sarcopenia is commonly associated with the elderly, recent research has shown that children may also develop the condition [11]. Sarcopenic obesity (SO), the coexistence of obesity and sarcopenia, is defined as obesity with low skeletal muscle mass and function [12]. Both obesity and sarcopenia synergistically exert an additional hazardous impact on metabolic disease or amplify the health risks [13,14]. In line with sarcopenia, SO is linked not only to the elderly population, but also the pediatric population and possess negative health outcomes in children and adolescents [15,16,17].
Skeletal muscle, constituting approximately 40% of total body mass, is a critical tissue responsible for a range of key physiological functions, including energy metabolism, thermogenesis and joint locomotion [18,19]. Skeletal muscle is also endocrine tissue and participates in body weight regulation by different signaling pathways [20,21,22]. Existing studies have shown a strong association between muscle strength, adipose tissue and nonalcoholic fatty liver disease [23]. The complex network relationships among them might be constructed by myokines, adipokines and hormones [24]. Skeletal muscle mass is decreased with weight loss, implying that loss of muscle mass and function should be minimized during the management of weight reduction. Grip strength is often used to measure muscular strength and muscle mass [25]. A recent study revealed a close correlation between grip strength and NAFLD risk [26]. Grip strength has been proposed as a tool for identifying metabolic syndrome and sarcopenia in the elderly [26,27]. Therefore, understanding the relationship between obesity and muscular strength is important.
To improve obesity, available treatment approaches for obesity or overweight include lifestyle corrections and the use of medications. Additionally, currently, limited scientific evidence, the lack of standardization and the paucity of clinical studies contribute to the challenges in formulating definitive WHO general recommendations for the use of natural products in this clinical field, which necessitates the design and development of natural products as potential anti-obesity agents for the therapeutic management of obesity [28,29,30].
Ursolic acid (UA), a natural pentacyclic triterpenoid, is widely present in a variety of medicinal plants, fruits and herbs [31], such as ginseng, pear apples, olives, plums, cranberries, rosemary, oregano and eucalyptus, calendula rosemarie [32,33]. So, UA is considered a component of the standard human diet. UA has gained significant attention in recent years due to its diverse biological functions and multiple pharmacological characteristics, such as anti-inflammation, anti-oxidation and anticancer effects [34,35,36]. Kunkel and colleagues highlighted that UA increases skeletal muscle mass in a mouse model of diet-induced obesity, identifying that the Akt molecular pathway is involved in muscle growth [37]. Sun and colleagues found that UA treatment significantly reduced the weight of the gastrocnemius muscle and lipid droplets in the same muscle by increasing the secretion of irisin and the expression of genes involved in adipocyte differentiation and lipogenesis [38]. Several studies have also shown that UA improved adipose tissue insulin resistance in aged rats and ameliorated HFD-induced hepatic steatosis and liver injury [39,40]. These results indicate that UA possesses anti-obesity and anti-inflammatory effects. However, UA’s mechanism of action has not been fully elucidated, and the effect of UA on muscle strength and NAFLD requires further verification during anti-obesity treatment. In addition, hormones play pivotal roles in maintaining skeletal muscle homeostasis, and further research is needed to confirm the regulatory effects of UA on hormones.
This study aimed to investigate anti-obesity effect of UA in HFD-induced obese mice with a specific dose for six weeks. In addition, this study aimed to examine the influence of UA on muscle performance and NAFLD. These data will provide evidence for the use of UA as a dietary supplement in preventing and treating obesity and its related metabolic syndrome.

2. Materials and Methods

2.1. Chemicals

Ursolic acid (UA, purity ≥ 90.0%) was obtained from Sigma-Aldrich (Shanghai, China) Trading Co., Ltd. The dose of UA (40 mg/kg body weight) was selected based on previous literature [41,42].

2.2. Animal Experiments

All animal experiments received approval from the Institutional Animal Care and Use Committee of Henan University of Science and Technology (Approval No: 202403017; Date: 8 March 2024) and were performed in accordance with the Guide for the Care and Use of Laboratory Animals: Eighth Edition [43].

2.3. Study Design

Male specific pathogen free C57BL/6J (6 weeks old) mice were selected from Si Pei Fu (Beijing) Biotechnology Co., Ltd. (Beijing, China). All animals were housed in cages, and they were acclimated to the environment with automatic temperature, light and humidity control for 1 week. The room temperature was maintained at 24 °C and the humidity was controlled at 55%, with a 12-h light/dark cycle.
A total of 60 mice were randomly assigned to three experimental groups (n = 20 per group): (1) control (CON), (2) high-fat diet (HFD) and (3) UA treatment (UA). The CON group received a standard chow diet (LAD3001M, Trophic Animal Feed High-Tech Co., Ltd., Nantong, China), with a nutritional composition of 67% carbohydrate, 18% protein and 5% fat, providing 7% of calories from fat. The HFD and UA groups were fed a high-fat diet (TP23400, Trophic Animal Feed High-Tech Co., Ltd, Nanning, China.) containing 23% protein, 32% carbohydrate, 31.5% fat (27.5% lard + 4.0% soybean oil), 6.8% fiber, 1.5% choline chloride, 4.0% mineral mix and 1.2% vitamin mix, with 60% of calories derived from fat. The mice were housed with five replicate cages per group (four mice per cage) and were allowed ad libitum access to food and tap water. After 10 weeks, the UA group was administered ursolic acid (40 mg/kg body weight) once daily via oral gavage, whereas the CON and HFD groups received an equivalent volume of saline for a duration of 6 weeks. Body weight and food intake were recorded weekly. The experimental timeline is summarized in Figure 1.

2.4. Grip Strength Test

Prior to the endpoint of this study, forelimb grip strength was evaluated in all mice using a specialized grip strength meter (RWD Life Science Co., Ltd., Shenzhen, China). During testing, each mouse was allowed to grasp a metal grip with both forepaws, after which the tail was gently pulled backward horizontally until the animal released its grip. The maximum force exerted immediately before release was recorded. Each mouse underwent three consecutive trials separated by one-minute intervals, and the average of these measurements was calculated to represent grip strength.

2.5. Sample Collections

At the end of the experiment (after UA treatment for 6 weeks), the mice were anaesthetized with pentobarbital sodium after 12 h of overnight fasting. Blood from the hearts was collected using vacutainer tubes, and serum samples were obtained from the collected blood samples through 10 min of centrifugation (3500× g, 4 °C). Then, the triceps, gastrocnemius, quadriceps and soleus muscles, abdominal adipose tissues and liver tissues were removed, weighed and processed for subsequent analyses. In addition, the liver index was calculated as follows:
Liver index = liver weight/body weight

2.6. Measurement of Serum Lipids

The levels of total cholesterol (TC), triglyceride (TG), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C) and free fatty acid (FFA) in serum were determined using commercial assay ELISA kits, according to the manufacturer’s instructions (Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu, China).

2.7. Observation and Analysis of Histopathology

Liver and abdominal subcutaneous adipose tissue samples were collected and fixed in 10% neutral buffered formalin. After 48 h of fixation, the tissues were dehydrated, embedded in paraffin and sectioned at a thickness of 5 µm. Following deparaffinization in xylene and rehydration, the sections were stained with hematoxylin and eosin (H&E). Liver histopathology was examined using light microscopy, with hepatic steatosis defined as the presence of lipid droplets in 5% or more of hepatocytes [44]. In brief, steatosis was assayed in three zones of the classic lobules of liver in each field: zone I (port area), zone II (intermediate area) and zone III (central vein area). When the total steatosis area in the three zones was ≥ 5%, it was recorded. For adipose tissue, images of the slides were captured, twenty cells were randomly selected from each slide and the diameter was measured. ImageJ software (1.49v) was used for the analysis of steatosis area and the diameters of adipocytes.

2.8. Measurement of Serum Hormones

Serum levels of thyroxine (TH, T3, T4), leptin, growth hormone (GH) and insulin-like growth factor-1 (IGF-1) were measured using corresponding commercial ELISA kits from Nanjing Jiancheng Bioengineering Institute.

2.9. Real-Time PCR

Total RNA was extracted from abdominal adipose tissue using TRIzol reagent (TaKaRa Bio Inc, Otsu City, Japan), following the manufacturer’s instructions. Subsequent cDNA synthesis was carried out with oligo-dT primers and PrimeScript RT enzyme (TaKaRa). Quantitative real-time PCR was performed on a Bio-Rad iQ5 detection system using SYBR Premix ExTaq II (TaKaRa) to evaluate the expression of inflammatory cytokines. All reactions were conducted in triplicate and normalized to the endogenous control, β-actin. The primer sequences utilized are listed in Table 1, and relative gene expression levels were calculated using the 2−ΔΔCt method [45].

2.10. Statistical Analysis

All data were assessed for normality using the Kolmogorov–Smirnov test and are presented as mean ± standard deviation (SD). Statistical comparisons were performed using one-way ANOVA with Tukey’s post hoc test for multiple comparisons, using SPSS 22.0 software. Differences were considered statistically significant at p < 0.05.

3. Results

3.1. The Effect of Ursolic Acid on Body Weight and Feed Intake

At the beginning of the experiment (week 0), no significant differences in body weight were observed among the different groups (p > 0.05). However, following 10 weeks of dietary intervention, mice fed a high-fat diet exhibited a significant increase in body weight compared to those maintained on a standard chow diet (Figure 2A). After treatment with UA for 6 weeks (Week 16), mice in the HFD group had higher body weight than mice in the CON group. However, the body weight of mice in the UA group was lower than that of mice in the HFD group (Figure 2B). No significant differences for feed intake were observed among the three experiment groups (Figure 2C).

3.2. The Effect of Ursolic Acid on Abdominal Fat and Liver Weight

At the end of the experiment, the abdominal subcutaneous adipose tissue weight, liver weight and live index value of the mice in the HFD group were higher liver than those in the CON group. In contrast, the mice administered 40 mg/kg/day UA had lower liver weight, abdominal fat weight and liver index values than those in the HFD group (Figure 3C–E).

3.3. The Effect of Ursolic Acid on Grip Strength and Muscle Weight

At the end of the experiment, grip strength and muscle weights were measured in this study. The grip strength of mice in the HFD group was significantly lower than that in the CON group, and UA administration led to a significant increase compared with the HFD group (p < 0.05). Lower weights of the triceps, quadriceps and gastrocnemius, but not soleus, were observed in the HFD group compared with the CON group. UA administration significantly increased the weights of these muscles compared with those in the HFD group. These results are presented in Table 2.

3.4. The Effect of Ursolic Acid on Serum Lipids

We analyzed serum TG, TC, HDL-C, LDL-C and FFA levels. As shown in Table 3, these parameters in the HFD group showed significant increases compared with those in the CON group (p < 0.05). Treatment with UA significantly decreased TG, TC, LDL-C and FFA levels (p < 0.05), but not HDL-C.

3.5. The Effect of Ursolic Acid on Histological Changes in Liver and Abdominal Adipose Tissues

Histopathological assessment of liver tissues indicated that mice in the HFD group developed severe hepatic steatosis, exhibiting significantly larger steatotic areas (p < 0.01), along with substantial lipid droplet accumulation and hepatocellular swelling relative to the CON group (Figure 4A). In contrast, UA treatment effectively ameliorated these pathological changes, resulting in a noticeable reduction in both the number and size of intra-cellular lipid vacuoles. The steatotic area was markedly decreased from 53% in the HFD group to 22% in the UA-treated group (Figure 4B).
Morphometric analysis of abdominal adipose tissue further revealed adipocyte hypertrophy in the HFD group compared with the CON group. UA intervention significantly attenuated this increase in adipocyte size, as demonstrated by a clear reduction in the cross-sectional area of adipocytes in the UA group relative to the HFD group (Figure 4C,D).

3.6. The Effect of Ursolic Acid on Serum Hormones

To investigate the potential involvement of endocrine factors in obesity development, serum levels of leptin, T3, T4, GH and IGF-1 were measured. As shown in Figure 5, the HFD group exhibited notably reduced concentrations of GH, IGF-1 and T3 compared with the CON group (p < 0.05). In contrast, leptin levels were significantly elevated in HFD-fed mice relative to the control group (p < 0.05). After UA treatment, GH, IGF-1 and T3 levels were increased, and leptin levels were decreased (p < 0.05). Additionally, no significant difference was observed for T4 levels between the CON group and he HFD group, but the UA group showed a notable increase.

3.7. The Effect of Ursolic Acid on the Expression of Inflammation-Associated Genes in Abdominal Adipose Tissue

We analyzed the expression of inflammation-associated genes TNF-α and IL-1β. The expression of TNF-α and IL-1β was significantly higher in the HFD group than in the CON group. UA administration significantly reduced their mRNA expression compared with the HFD group. The results are presented in Figure 6.

4. Discussion

Obesity represents a significant public health concern affecting elderly populations, children, and adolescents globally. Although body weight reduction is beneficial for managing obesity and mitigating associated metabolic disorders, it is frequently accompanied by a decline in skeletal muscle mass [46]. Skeletal muscle mass is closely related to function and metabolic capacity of the muscle [47], and skeletal muscle atrophy and dysfunction can further impair whole-body metabolism [48]. The desired outcomes for the management of people living with obesity are the maintenance or increase of muscle mass and function when body weight (fat mass) is reduced. Hand grip strength is a well-established indicator of muscle strength and is often used to assess muscle condition [49,50]. In the present study, the assessment of grip strength revealed a significant reduction in the HFD group. Notably, UA supplementation effectively restored grip strength and concurrently increased muscle mass in HFD-induced obese mice. Results regarding muscle strength and muscle mass are in line with human clinical studies, in which muscle strength was positively correlated with muscle mass [51,52,53].
Obesity is defined as a condition of excessive adipose tissue accumulation, characterized by adipose tissue expansion through adipocyte hypertrophy (increase in cell size) and/or hyperplasia (increase in cell number) [54,55]. The current study found that mice fed a HFD gained more body weight, abdominal fat mass and higher liver index values than those who received a control diet, and UA supplementation reduced body weight, abdominal fat mass and liver index values in HFD-fed mice. We also found that the adipocyte size in abdominal adipose tissue was decreased by UA, indicating that adipose tissue loss may have led to weight loss and that UA may regulate lipid metabolism in peripheral adipose tissues. The lipid abnormalities usually observed in obese patients are high levels of serum TG, TC, FFA and LDL-C [56,57]. Serum lipids were tested in the current study and our results demonstrated that UA effectively decreased TG, TC, LDL-C and FFA in serum in HFD-fed mice after 6 weeks of administration. This suggests that UA might be useful for treating and preventing hyperlipidemia.
Given the role of leptin and TH in the regulation of energy expenditure and lipid homeostasis, circulating leptin and TH levels were determined. Leptin is produced in adipose tissue and can regulate energy balance by inhibiting hunger and increasing energy expenditure in the body [58,59]. However, leptin levels seem to be increased in obese patients [60]. We also found that serum leptin levels are higher in HDF-fed mice. It is possible that high leptin levels lead to leptin resistance and blunt its positive effects [61,62]. TH was secreted by the thyroid gland. T3 is the most metabolically active form of TH, and T4 is considered a prohormone and constitutes a large reserve of T3. The regulation of energy expenditure is a critical role of TH [63]. Shao et al. reported that high-fat diets could induce hypothyroidism in mice by increasing thyrotropin and decreasing T3 and T4 levels, likely related to increased leptin signaling [64]. Consistent Shao et al.’s research, we found that T3 levels were lower in HDF-fed mice. UA treatment increased T3 and T4 levels. These data indicated that UA played a key role in energy homeostasis by regulating circulating hormone levels.
Both GH and IGF-1 are anabolic hormones related to skeletal muscle function and mass. Early and recent studies have shown that GH strongly affected skeletal muscle mass and performance [65,66]. GH can stimulate skeletal muscle protein synthesis and skeletal muscle growth in human and animals [67,68]. IGF-1 primarily regulates muscle mass through both the activation of protein synthesis and the inhibition of protein breakdown [69], and IGF-1 mediates the primary anabolic action of GH in skeletal muscle [70]. The reduction of GH/IGF-1 is markedly associated with a decrease in muscle growth and function in people with obesity [71]. In the present study, UA administration significantly elevated serum GH and IGF-1 levels compared with the HFD group, suggesting a plausible role of UA in enhancing muscle mass and function. Further investigation is warranted to elucidate the underlying mechanisms involved.
Obesity is a chronic metabolic disease accompanying low-grade inflammatory responses [72]. Excessive fat leads to the expansion of adipose tissue. Under these conditions, macrophage infiltration is triggered and levels of inflammatory cytokines (e.g., TNF-α and IL-1β) produced by activated macrophages are increased [73]. It has been demonstrated that TNF-α and IL-1β are two important pro-inflammatory biomarkers involved in the development of obesity [74,75,76]. Previous research has shown that TNF-α possesses higher expression levels in adipose tissue in obese and diabetic rodents [77], and increased TNF-α production in human adipose tissue is positively correlated with obesity [78]. IL-1β participates in the inflammatory process of obesity and obesity-related diseases [79] and contributes to the development of insulin resistance [80]. Our findings were consistent with previous research. Here, the HFD group showed a higher expression of TNF-α and IL-1β mRNA, whereas UA treatment down-regulated their mRNA levels. This demonstrates that UA possesses anti-inflammatory effects.
Nonalcoholic fatty liver disease (NAFLD) is closely associated with obesity [81]. When adipose tissue storage capacity becomes limited, ectopic fat deposition occurs in organs such as the liver, which may contribute to the onset and progression of NAFLD [82]. Duan et al. showed that HFD induced rapid weight gain and obesity and expanded areas of liver steatosis in mice [83]. Similarly to their study, the current study indicated that the mice fed a HFD had higher body weight and liver weight and bigger areas of liver steatosis. To test the ability of UA to limit liver steatosis, we evaluated the histological appearance of this organ in mice. The results showed that UA reduced liver weight and improved the histological appearance of the liver, indicating that UA reduced liver steatosis.
This study has potential limitations. Muscle strength was assessed at only a single terminal point; data from both baseline and the end of the experiment should be included. Although a dose of 40 mg/kg body weight is effective under the conditions of this study, this cannot be directly translated to dietary intake in humans; more clinical studies are needed in the future. In addition, doses of UA should be tested in order to establish dose–response effects. Energy expenditure could not be tested due to limitations of the experimental conditions, which limits further understanding of the management of obesity with UA treatment. The mass and functions of brown adipose tissues were not evaluated in this study, so further examination of brown adipose tissue might provide a stronger scientific basis for the application of UA. In addition, the mechanism of action of UA on different target organs also needs to be clarified.

5. Conclusions

In this study, we showed that UA enhanced grip strength and improved body weight and hepatic steatosis by altering muscle mass, fat mass, hormone and inflammatory cytokines in HFD-induced obese mice, demonstrating its efficacy against obesity and improving muscle function and the metabolic environment.
These findings confirmed that UA administration enhanced muscle strength and improved lipid metabolism and hepatic steatosis induced by HFD. These data also show that UA acts on multiple target organs and could be considered a potential therapeutic agent for managing obesity, sarcopenia and other metabolic diseases, or might serve as a functional ingredient in the development of health-promoting foods. Based on these findings, future studies are required to understand the underlying mechanisms.

Author Contributions

Study design: D.K. Data collection: D.K. and L.C. Data analysis: D.K. and L.C. Initial draft preparation: D.K. and L.C. Final version approval: all authors. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the Henan Provincial Soft Science Research Program (242400411238), the Henan Provincial Teacher Education Curriculum Reform Research Project (2025-JSJYYB-102) and the Experimental Technology Development Fund of Henan University of Science and Technology (SY2425001).

Institutional Review Board Statement

The animal experiments received approval from the Institutional Animal Care and Use Committee of Henan University of Science and Technology (Approval No: 202403017; Date: 8 March 2024) and were performed in accordance with the Guide for the Care and Use of Laboratory Animals: Eighth Edition.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflicts of interest.

Correction Statement

This article has been republished with a minor change. The change does not affect the scientific content of the article and further details are available within the backmatter of the website version of this article.

Abbreviations

The following abbreviations are used in this manuscript:
SOSarcopenic obesity
NAFLDNonalcoholic fatty liver disease
UAUrsolic acid
HFDHigh-fat diet
TCTotal cholesterol
TGTriglyceride
HDL-CHigh-density lipoprotein cholesterol
LDL-CLow-density lipoprotein cholesterol
THThyroxine
GHGrowth hormone
IGF-1Insulin-like growth factor-1
IL-1βInterleukin-1β
TNF-αTumor necrosis factor-α
FFAFree fatty acid

References

  1. The World Health Organization (WHO). Obesity and Overweight; WHO Media Center: Geneva, Switzerland, 2012. [Google Scholar]
  2. Mopuri, R.; Ganjayi, M.; Banavathy, K.S.; Parim, B.N.; Meriga, B. Evaluation of anti-obesity activities of ethanolic extract of Terminalia paniculata bark on high fat diet-induced obese rats. BMC Complement. Altern. Med. 2015, 15, 76. [Google Scholar] [CrossRef]
  3. Naomi, R.; Teoh, S.H.; Embong, H.; Balan, S.S.; Othman, F.; Bahari, H.; Yazid, M.D. The role of oxidative stress and inflammation in obesity and its impact on cognitive impairments-a narrative review. Antioxidants 2023, 12, 1071. [Google Scholar] [CrossRef]
  4. Yang, H.W.; Fernando, K.H.N.; Oh, J.Y.; Li, X.; Jeon, Y.J.; Ryu, B. Anti-obesity and anti-diabetic effects of ishige okamurae. Mar. Drugs 2019, 17, 202. [Google Scholar] [CrossRef]
  5. Hruby, A.; Hu, F.B. The epidemiology of obesity: A big picture. Pharmacoeconomics 2015, 33, 673–689. [Google Scholar] [CrossRef] [PubMed]
  6. Lee, E.S.; Choi, S.J.; Kim, H.D.; Kang, M.H.; Ji, Y.J.; Kim, G.S.; Jang, G.Y. Anti-obesity activity in 3T3-L1 cells of Cornus officinalis fruits harvested at different times. Processes 2022, 10, 2008. [Google Scholar] [CrossRef]
  7. Goodarzi, M.O. Genetics of obesity: What genetic association studies have taught us about the biology of obesity and its complications. Lancet Diabetes Endocrinol. 2018, 6, 223–236. [Google Scholar] [CrossRef]
  8. Cruz-Jentoft, A.J.; Bahat, G.; Bauer, J.; Boirie, Y.; Bruyère, O.; Cederholm, T.; Cooper, C.; Landi, F.; Rolland, Y.; Sayer, A.A.; et al. Writing group for the european working group on sarcopenia in older people 2 (EWGSOP2), and the extended group for EWGSOP2. sarcopenia: Revised european consensus on definition and diagnosis. Age Ageing 2019, 48, 16–31. [Google Scholar] [CrossRef]
  9. Wijarnpreecha, K.; Panjawatanan, P.; Thongprayoon, C.; Jaruvongvanich, V.; Ungprasert, P. Sarcopenia and risk of nonalcoholic fatty liver disease: A metaanalysis. Saudi J. Gastroenterol. 2018, 24, 12–17. [Google Scholar] [CrossRef]
  10. Polyzos, S.A.; Vachliotis, I.D.; Mantzoros, C.S. Sarcopenia, sarcopenic obesity and nonalcoholic fatty liver disease. Metabolism 2023, 147, 155676. [Google Scholar] [CrossRef]
  11. Steffl, M.; Chrudimsky, J.; Tufano, J.J. Using relative handgrip strength to identify children at risk of sarcopenic obesity. PLoS ONE 2017, 12, e0177006. [Google Scholar] [CrossRef]
  12. Barazzoni, R.; Bischoff, S.C.; Boirie, Y.; Busetto, L.; Cederholm, T.; Dicker, D.; Toplak, H.; Van Gossum, A.; Yumuk, V.; Vettor, R. Sarcopenic obesity: Time to meet the challenge. Clin. Nutr. 2018, 37, 1787–1793. [Google Scholar] [CrossRef] [PubMed]
  13. Alizadeh Pahlavani, H. Exercise therapy for people with sarcopenic obesity: Myokines and adipokines as effective actors. Front. Endocrinol. 2022, 13, 811751. [Google Scholar] [CrossRef] [PubMed]
  14. Koliaki, C.; Liatis, S.; Dalamaga, M.; Kokkinos, A. Sarcopenic obesity: Epidemiologic evidence, pathophysiology, and therapeutic perspectives. Curr. Obes. Rep. 2019, 8, 458–471. [Google Scholar] [CrossRef] [PubMed]
  15. Kim, K.; Hong, S.; Kim, E.Y. Reference values of skeletal muscle mass for korean children and adolescents using data from the korean national health and nutrition examination survey 2009–2011. PLoS ONE 2016, 11, e0153383. [Google Scholar] [CrossRef]
  16. Yodoshi, T.; Orkin, S.; Arce Clachar, A.C.; Bramlage, K.; Sun, Q.; Fei, L.; Beck, A.F.; Xanthakos, S.A.; Trout, A.T.; Mouzaki, M. Muscle mass is linked to liver disease severity in pediatric nonalcoholic fatty liver disease. J. Pediatr. 2020, 223, 93–99. [Google Scholar] [CrossRef]
  17. Burrows, R.; Correa-Burrows, P.; Reyes, M.; Blanco, E.; Albala, C.; Gahagan, S. High cardiometabolic risk in healthy Chilean adolescents: Associations with anthropometric, biological and lifestyle factors. Public Health Nutr. 2016, 19, 486–493. [Google Scholar] [CrossRef]
  18. Hope, D.C.D.; Tan, T.M. Skeletal muscle loss and sarcopenia in obesity pharmacotherapy. Nat. Rev. Endocrinol. 2024, 20, 695–696. [Google Scholar] [CrossRef]
  19. Frontera, W.R.; Ochala, J. Skeletal muscle: A brief review of structure and function. Calcif. Tissue Int. 2015, 96, 183–195. [Google Scholar] [CrossRef]
  20. Schiaffino, S.; Dyar, K.A.; Ciciliot, S.; Blaauw, B.; Sandri, M. Mechanisms regulating skeletal muscle growth and atrophy. FEBS J. 2013, 280, 4294–4314. [Google Scholar] [CrossRef]
  21. Lee, S.H.; Park, S.Y.; Choi, C.S. Insulin resistance: From mechanisms to therapeutic strategies. Diabetes. Metab. J. 2022, 46, 15–37. [Google Scholar] [CrossRef]
  22. Huang, X.; Liu, G.; Guo, J.; Su, Z. The PI3K/AKT pathway in obesity and type 2 diabetes. Int. J. Biol. Sci. 2018, 14, 1483–1496. [Google Scholar] [CrossRef] [PubMed]
  23. Park, J.H.; Park, H.Y. Association between muscular strength, abdominal obesity, and incident nonalcoholic fatty liver disease in a Korean population. Sci. Rep. 2025, 15, 17602. [Google Scholar] [CrossRef] [PubMed]
  24. Park, M.J.; Choi, K.M. Interplay of skeletal muscle and adipose tissue: Sarcopenic obesity. Metabolism 2023, 144, 155577. [Google Scholar] [CrossRef]
  25. Vaidya, S.M.; Nariya, D.M. Handgrip strength as a predictor of muscular strength and endurance: A cross-sectional study. J. Clin. Diagn. Res. 2021, 15, YC01–YC04. [Google Scholar] [CrossRef]
  26. Rho, H.S.; Choi, W.S. Low muscle strength as risk factor for non-alcoholic fatty liver disease in different metabolic conditions. Korean J. Fam. Med. 2024, 45, 89–95. [Google Scholar] [CrossRef]
  27. McLean, R.; Shardell, M.; Alley, D.; Cawthon, P.; Fragala, M.; Harris, T.; Kenny, A.M.; Pe-ters, K.W.; Luigi, F.; Guralnik, J.M. Criteria for clinically relevant weakness and low lean mass and their longitudinal association with incident mobility impairment and mortality: The foundation for the National Institutes of Health (FNIH) sarcopenia project. J. Gerontol. 2014, 69, 576–583. [Google Scholar] [CrossRef]
  28. Shaik Mohamed Sayed, U.F.; Moshawih, S.; Goh, H.P.; Kifli, N.; Gupta, G.; Singh, S.K.; Chellappan, D.K.; Dua, K.; Hermansyah, A.; Ser, H.L.; et al. Natural products as novel anti-obesity agents: Insights into mechanisms of action and potential for therapeutic management. Front. Pharmacol. 2023, 14, 1182937. [Google Scholar] [CrossRef]
  29. Martins, T.; Ferreira, T.; Nascimento-Gonçalves, E.; Castro-Ribeiro, C.; Lemos, S.; Rosa, E.; Antunes, L.M.; Oliveira, P.A. Obesity rodent models applied to research with food products and natural compounds. Obesities 2022, 2, 171–204. [Google Scholar] [CrossRef]
  30. Chan, Y.; Ng, S.W.; Tan, J.Z.X.; Gupta, G.; Chellappan, D.K. Natural products in the management of obesity: Fundamental mechanisms and pharmacotherapy. S. Afr. J. Bot. 2021, 143, 176–197. [Google Scholar] [CrossRef]
  31. Sharma, R.; Yadav, V.; Jha, S.; Dighe, S.; Jain, S. Unveiling the potential of ursolic acid modified hyaluronate nanoparticles for combination drug therapy in triple negative breast cancer. Carbohydr. Polym. 2024, 338, 122196. [Google Scholar] [CrossRef]
  32. Parthiban, A.; Sachithanandam, V.; Lalitha, P.; Adhikari, P.; Prakash, S.; Ramasubburayan, R.; Dhillon, D.; Muthukumaran, J.; Vinithkumar, N.V.; Sridhar, R.; et al. Decoding the multi-functional potential of ursolic acid: Antioxidant, antiproliferative, molecular dynamics, and biodegradability evaluations of a mangrove-derived terpenoid. J. Comput.-Aided Mol. Des. 2025, 39, 22. [Google Scholar] [CrossRef] [PubMed]
  33. Miatmoko, A.; Jauhari, A.A.; Faradisa, A.A.; Cahyani, D.M.; Hariawan, B.S.; Susanto, J.; Pa-rumasivam, T.; Hendradi, E.; Sari, R. Oral curative therapeutic study of N-nitrosodiethylamine-induced mouse liver damage of chitosan-coated ursolic acid nio-somes. Sci. Rep. 2025, 15, 19225. [Google Scholar] [CrossRef] [PubMed]
  34. Zafar, S.; Khan, K.; Hafeez, A.; Irfan, M.; Armaghan, M.; Rahman, A.U.; Gürer, E.S.; Sharifi-Rad, J.; Butnariu, M.; Bagiu, I.C. Ursolic acid: A natural modulator of signaling networks in different cancers. Cancer Cell Int. 2022, 22, 399. [Google Scholar] [CrossRef] [PubMed]
  35. Liu, G.; Qin, P.; Cheng, X.; Wu, L.; Wang, R.; Gao, W. Ursolic acid: Biological functions and application in animal husbandry. Front. Vet. Sci. 2023, 10, 1251248. [Google Scholar] [CrossRef]
  36. Yang, B.; Zhu, Q.; Wang, X.; Mao, J.; Zhou, S. Using network pharmacology and molecular docking verification to explore the mechanism of ursolic acid in the treatment of osteoporosis. Medicine 2022, 101, e32222. [Google Scholar] [CrossRef]
  37. Kunkel, S.D.; Elmore, C.J.; Bongers, K.S.; Ebert, S.M.; Fox, D.K.; Dyle, M.C.; Bullard, S.A.; Adams, C.M. Ursolic acid increases skeletal muscle and brown fat and decreases diet-induced obesity, glucose intolerance and fatty liver disease. PLoS ONE 2012, 7, e39332. [Google Scholar] [CrossRef]
  38. Sun, A.; Hu, X.; Chen, H.; Ma, Y.; Yan, X.; Peng, D.; Ping, J.; Yan, Y. Ursolic acid induces white adipose tissue beiging in high-fat-diet obese male mice. Food Funct. 2021, 12, 6490–6501. [Google Scholar] [CrossRef]
  39. Wang, T.Z.; Zuo, G.W.; Yao, L.; Yuan, C.L.; Li, H.F.; Lai, Y.; Chen, Z.W.; Zhang, J.; Jin, Y.Q.; Yamahara, J.; et al. Ursolic acid ameliorates adipose tissue insulin resistance in aged rats via activating the Akt-glucose transporter 4 signaling pathway and inhibiting inflammation. Exp. Ther. Med. 2021, 22, 10901. [Google Scholar] [CrossRef]
  40. Li, S.; Liao, X.; Meng, F.; Wang, Y.; Sun, Z.; Guo, F.; Li, X.; Meng, M.; Li, Y.; Sun, C. Therapeutic role of ursolic Acid on ameliorating hepatic steatosis and improving metabolic disorders in high-fat diet-induced non-alcoholic fatty liver disease rats. PLoS ONE 2014, 9, e86724. [Google Scholar] [CrossRef]
  41. Colla, A.R.; Rosa, J.M.; Cunha, M.P.; Rodrigues, A.L. Anxiolytic-like effects of ursolic acid in mice. Eur. J. Pharmacol. 2015, 758, 171–176. [Google Scholar] [CrossRef]
  42. Kannampuzha, S.; Gopalakrishnan, A.V. Protective role of ursolic acid against cispla-tin-induced oxidative stress and ferroptosis in the liver of Swiss albino mice. Med. Oncol. 2025, 42, 327. [Google Scholar] [CrossRef] [PubMed]
  43. National Research Council (US) Committee for the Update of the Guide for the Care and Use of Laboratory Animals. Guide for the Care and Use of Laboratory Animals, 8th ed.; National Academies Press: Washington, DC, USA, 2011. [Google Scholar]
  44. Sakamoto, M.; Tsujikawa, H.; Effendi, K.; Ojima, H.; Harada, K.; Zen, Y.; Kondo, F.; Nakano, M.; Kage, M.; Sumida, Y.; et al. Pathological findings of nonalcoholic steatohepatitis and nonalcoholic fatty liver disease. Pathol. Int. 2017, 67, 1–7. [Google Scholar] [CrossRef] [PubMed]
  45. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  46. Harper, M.E.; Dent, R.R.M.; McPherson, R. High-quality weight loss in obesity: Importance of skeletal muscle. Diabetes 2025, 74, dbi250003. [Google Scholar] [CrossRef]
  47. Lahiri, S.; Kim, H.; Garcia-Perez, I.; Reza, M.M.; Martin, K.A.; Kundu, P.; Cox, L.M.; Selkrig, J.; Posma, J.M.; Zhang, H.; et al. The gut microbiota influences skeletal muscle mass and function in mice. Sci. Transl. Med. 2019, 1, eaan5662. [Google Scholar] [CrossRef]
  48. Castillo, Í.M.P.; Argilés, J.M.; Rueda, R.; Ramírez, M.; Pedrosa, J.M.L. Skeletal muscle atrophy and dysfunction in obesity and type-2 diabetes mellitus: Myocellular mechanisms involved. Rev. Endocr. Metab. Dis. 2025. [Google Scholar] [CrossRef]
  49. Yi, D.W.; Khang, A.R.; Lee, H.W.; Son, S.M.; Kang, Y.H. Relative handgrip strength as a marker of metabolic syndrome: The Korea National Health and Nutrition Examination Survey (KNHANES) VI (2014-2015). Diabetes Metab. Syndr. Obes. 2018, 11, 227–240. [Google Scholar] [CrossRef]
  50. Zhu, J.; Wang, J.; Fan, C.; Wu, D.; Feng, Q. Handgrip strength and low muscle strength rate in chinese adults-China, 2020. China CDC Wkly. 2024, 6, 821–824. [Google Scholar] [CrossRef]
  51. Porto, J.M.; Nakaishi, A.P.M.; Cangussu-Oliveira, L.M.; Freire Júnior, R.C.; Spilla, S.B.; Abreu, D.C.C. Relationship between grip strength and global muscle strength in community-dwelling older people. Arch. Gerontol. Geriatr. 2019, 82, 273–278. [Google Scholar] [CrossRef]
  52. Bohannon, R.W. Muscle strength: Clinical and prognostic value of hand-grip dynamometry. Curr. Opin. Clin. Nutr. Metab. Care 2015, 18, 465–470. [Google Scholar] [CrossRef]
  53. Momma, H.; Kato, K.; Sawada, S.S.; Gando, Y.; Kawakami, R.; Miyachi, M.; Nagatomi, R.; Tashiro, M.; Matsubayashi, Y.; Kodama, S.; et al. Physical fitness and dyslipidemia among japanese: A cohort study from the niigata wellness study. J. Epidemiol. 2021, 31, 287–296. [Google Scholar] [CrossRef]
  54. Jo, J.; Gavrilova, O.; Pack, S.; Jou, W.; Mullen, S.; Sumner, A.E.; Cushman, S.W.; Periwal, V. Hypertrophy and/or hyperplasia: Dynamics of adipose tissue growth. PLoS Comput. Biol. 2009, 5, e1000324. [Google Scholar] [CrossRef]
  55. Romieu, I.; Dossus, L.; Barquera, S.; Blottière, H.M.; Franks, P.W.; Gunter, M.; Hwalla, N.; Hursting, S.D.; Leitzmann, M.; Margetts, B.; et al. Energy balance and obesity: What are the main drivers? Cancer Causes Control 2017, 28, 247–258. [Google Scholar] [CrossRef] [PubMed]
  56. Bays, H.E.; Toth, P.P.; Kris-Etherton, P.M.; Abate, N.; Aronne, L.J.; Brown, W.V.; Gonzalez-Campoy, J.M.; Jones, S.R.; Kumar, R.; La Forge, R.; et al. Obesity, adiposity, and dyslipidemia: A consensus statement from the national lipid association. J. Clin. Lipidol. 2013, 7, 304–383. [Google Scholar] [CrossRef] [PubMed]
  57. Nussbaumerova, B.; Rosolova, H. Obesity and dyslipidemia. Curr. Atheroscler. Rep. 2023, 25, 947–955. [Google Scholar] [CrossRef] [PubMed]
  58. Pijet, M.; Pijet, B.; Litwiniuk, A.; Pajak, B.; Gajkowska, B.; Orzechowski, A. Leptin impairs myogenesis in C2C12 cells through JAK/STAT and MEK signaling pathways. Cytokine 2013, 61, 445–454. [Google Scholar] [CrossRef]
  59. Skubic, C.; Drakulić, Ž.; Rozman, D. Personalized therapy when tackling nonalcoholic fatty liver disease: A focus on sex, genes, and drugs. Expert Opin. Drug Metab. Toxicol. 2018, 14, 831–841. [Google Scholar] [CrossRef]
  60. Adolph, T.E.; Grander, C.; Grabherr, F.; Tilg, H. Adipokines and non-alcoholic fatty liver disease: Multiple interactions. Int. J. Mol. Sci. 2017, 18, 1649. [Google Scholar] [CrossRef]
  61. Fuentes, T.; Ara, I.; Guadalupe-Grau, A.; Larsen, S.; Stallknecht, B.; Olmedillas, H.; Santana, A.; Helge, J.W.; Calbet, J.A.; Guerra, B. Leptin receptor 170 kDa (OB-R170) protein expression is reduced in obese human skeletal muscle: A potential mechanism of leptin resistance. Exp. Physiol. 2010, 95, 160–171. [Google Scholar] [CrossRef]
  62. Kohara, K.; Ochi, M.; Tabara, Y.; Nagai, T.; Igase, M.; Miki, T. Leptin in sarcopenic visceral obesity: Possible link between adipocytes and myocytes. PLoS ONE 2011, 6, e24633. [Google Scholar] [CrossRef]
  63. Yavuz, S.; Salgado Nunez Del Prado, S.; Celi, F.S. Thyroid hormone action and energy expenditure. J. Endocr. Soc. 2019, 3, 1345–1356. [Google Scholar] [CrossRef] [PubMed]
  64. Shao, S.S.; Zhao, Y.F.; Song, Y.F.; Xu, C.; Yang, J.M.; Xuan, S.M.; Yan, H.L.; Yu, C.X.; Zhao, M.; Xu, J.; et al. Dietary high-fat lard intake induces thyroid dysfunction and abnormal morphology in rats. Acta Pharmacol. Sin. 2014, 35, 1411–1420. [Google Scholar] [CrossRef] [PubMed]
  65. Wolf, E.; Wanke, R.; Schenck, E.; Hermanns, W.; Brem, G. Effects of growth hormone overproduction on grip strength of transgenic mice. Eur. J. Endocrinol. 1995, 133, 735–740. [Google Scholar] [CrossRef] [PubMed]
  66. Malpani, A.; Welch, L.; Plummer, D.; Churilla, J.; Benson, M.; Hossain, J.; Permuy, J.; Carakushansky, M.; Mauras, N. Impact of growth hormone on skeletal muscle strength, power, endurance, and agility in prepubertal boys with short stature. J. Clin. Endocrinol. Metab. 2025, 2, dgaf203. [Google Scholar] [CrossRef]
  67. Jiang, H.; Ge, X. Meat science and muscle biology symposium—Mechanism of growth hormone stimulation of skeletal muscle growth in cattle. J. Anim. Sci. 2014, 92, 21–29. [Google Scholar] [CrossRef]
  68. Rudman, D.; Feller, A.G.; Nagraj, H.S.; Gergans, G.A.; Lalitha, P.Y.; Goldberg, A.F.; Schlenker, R.A.; Cohn, L.; Rudman, I.W.; Mattson, D.E. Effects of human growth hormone in men over 60 years old. N. Engl. J. Med. 1990, 323, 1–6. [Google Scholar] [CrossRef]
  69. Mathes, S.; Fahrner, A.; Luca, E.; Krützfeldt, J. Growth hormone/IGF-I-dependent signaling restores decreased expression of the myokine SPARC in aged skeletal muscle. J. Mol. Med. 2022, 100, 1647–1658. [Google Scholar] [CrossRef]
  70. Green, H.; Morikawa, M.; Nixon, T. A dual effector theory of growth-hormone action. Differentiation 1985, 29, 195–198. [Google Scholar] [CrossRef]
  71. Cappola, A.R.; Bandeen-Roche, K.; Wand, G.S.; Volpato, S.; Fried, L.P. Association of IGF-I levels with muscle strength and mobility in older women. J. Clin. Endocrinol. Metab. 2001, 86, 4139–4146. [Google Scholar] [CrossRef]
  72. Theilade, S.; Christensen, M.B.; Vilsbøll, T.; Knop, F.K. An overview of obesity mechanisms in humans: Endocrine regulation of food intake, eating behaviour and common determinants of body weight. Diabetes Obes. Metab. 2021, 23, 17–35. [Google Scholar] [CrossRef]
  73. Lumeng, C.N.; Saltiel, A.R. Inflammatory links between obesity and metabolic disease. J. Clin. Invest. 2011, 121, 2111–2117. [Google Scholar] [CrossRef] [PubMed]
  74. Romacho, T.; Glosse, P.; Richter, I.; Elsen, M.; Schoemaker, M.H.; van Tol, E.A.; Eckel, J. Nutritional ingredients modulate adipokine secretion and inflammation in human primary adipocytes. Nutrients 2015, 7, 865–886. [Google Scholar] [CrossRef] [PubMed]
  75. Saha, S.; Panigrahi, D.P.; Patil, S.; Bhutia, S.K. Autophagy in health and disease: A comprehensive review. Biomed. Pharmacother. 2018, 104, 485–495. [Google Scholar] [CrossRef] [PubMed]
  76. Pedersen, B.K. Skeletal muscle as an endocrine organ: The role of myokines in muscle-fat cross-talk. Inflamm. Res. 2010, 59, S275–S276. [Google Scholar]
  77. Hotamisligil, G.S.; Shargill, N.S.; Spiegelman, B.M. Adipose expression of tumor necrosis factor-alpha: Direct role in obesity-linked insulin resistance. Science 1993, 259, 87–91. [Google Scholar] [CrossRef]
  78. Kern, P.A.; Ranganathan, S.; Li, C.; Wood, L.; Ranganathan, G. Adipose tissue tumor ne-crosis factor and interleukin-6 expression in human obesity and insulin resistance. Am. J. Physiol. Endocrinol. Metab. 2001, 280, E745–E751. [Google Scholar] [CrossRef]
  79. Luo, J.; Chen, M.; Ji, H.; Su, W.; Song, W.; Zhang, D.; Su, W.; Liu, S. Hypolipidemic and anti-obesity effect of anserine on mice orally administered with high-fat diet via regulating SREBP-1, NLRP3, and UCP-1. Mol. Nutr. Food. Res. 2024, 68, e2300471. [Google Scholar] [CrossRef]
  80. Sahebkar, A. Potential efficacy of ginger as a natural supplement for nonalcoholic fatty liver disease. World. J. Gastroenterol. 2011, 17, 271–272. [Google Scholar] [CrossRef]
  81. Pereira, R.M.; Rodrigues, K.C.D.C.; Anaruma, C.P.; Sant’Ana, M.R.; de Campos, T.D.P.; Gaspar, R.S.; Canciglieri, R.D.S.; de Melo, D.G.; Mekary, R.A.; da Silva, A.S.R.; et al. Short-term strength training reduces gluconeogenesis and NAFLD in obese mice. J. Endocrinol. 2019, 241, 59–70. [Google Scholar] [CrossRef]
  82. Polyzos, S.A.; Perakakis, N.; Mantzoros, C.S. Fatty liver in lipodystrophy: A review with a focus on therapeutic perspectives of adiponectin and/or leptin replacement. Metabolism 2019, 96, 66–82. [Google Scholar] [CrossRef]
  83. Duan, X.; Meng, Q.; Wang, C.; Liu, Z.; Sun, H.; Huo, X.; Sun, P.; Ma, X.; Peng, J.; Liu, K. Effects of calycosin against high-fat diet-induced nonalcoholic fatty liver disease in mice. J. Gastroenterol. Hepatol. 2018, 33, 533–542. [Google Scholar] [CrossRef]
Nutrients 17 03158 g001
Figure 1. The time schedule of the procedures in this study.
Figure 1. The time schedule of the procedures in this study.
Nutrients 17 03158 g001
Nutrients 17 03158 g002
Figure 2. Changes in body weight and feed intake. (A): Representative images of C57BL/6J mice fed a standard chow diet and a high-fat diet for 10 weeks. (B): Body weight changes during the 6 weeks of UA administration. (C): Food intake during the 6 weeks of UA administration. Data are expressed as mean ± SD. Values with different capital letters are significant at the 0.01 level. Values with different lowercase letters are significant at the 0.05 level.
Figure 2. Changes in body weight and feed intake. (A): Representative images of C57BL/6J mice fed a standard chow diet and a high-fat diet for 10 weeks. (B): Body weight changes during the 6 weeks of UA administration. (C): Food intake during the 6 weeks of UA administration. Data are expressed as mean ± SD. Values with different capital letters are significant at the 0.01 level. Values with different lowercase letters are significant at the 0.05 level.
Nutrients 17 03158 g002
Nutrients 17 03158 g003
Figure 3. Changes in abdominal fat and liver weight. (A): Representative gross images of liver. (B): Representative gross images of abdominal subcutaneous adipose tissue. (C): Liver weight. (D): Abdominal fat weight. (E): Liver index. Data are expressed as mean ± SD. Different letters represent significant differences at the 0.05 level.
Figure 3. Changes in abdominal fat and liver weight. (A): Representative gross images of liver. (B): Representative gross images of abdominal subcutaneous adipose tissue. (C): Liver weight. (D): Abdominal fat weight. (E): Liver index. Data are expressed as mean ± SD. Different letters represent significant differences at the 0.05 level.
Nutrients 17 03158 g003
Nutrients 17 03158 g004
Figure 4. Histopathological changes in liver and abdominal adipose tissues. (A): Representative liver histology by H&E staining. (B): Steatosis area of the liver. (C): Representative adipose tissues.(D): Average diameter of adipocytes. Values with different capital letters are significant at the 0.01 level. Values with different lowercase letters are significant at the 0.05 level.
Figure 4. Histopathological changes in liver and abdominal adipose tissues. (A): Representative liver histology by H&E staining. (B): Steatosis area of the liver. (C): Representative adipose tissues.(D): Average diameter of adipocytes. Values with different capital letters are significant at the 0.01 level. Values with different lowercase letters are significant at the 0.05 level.
Nutrients 17 03158 g004
Nutrients 17 03158 g005
Figure 5. The effect of ursolic acid on serum hormone levels. (A) Serum GH levels. (B): Serum IGF-1 levels. (C): Serum leptin levels. (D): Serum T3 levels. (E): Serum T4 levels. Different letters represent significant differences at the 0.05 level.
Figure 5. The effect of ursolic acid on serum hormone levels. (A) Serum GH levels. (B): Serum IGF-1 levels. (C): Serum leptin levels. (D): Serum T3 levels. (E): Serum T4 levels. Different letters represent significant differences at the 0.05 level.
Nutrients 17 03158 g005
Nutrients 17 03158 g006
Figure 6. Changes in the expression of inflammation-associated genes. (A): TNF-α mRNA. (B): IL-1β mRNA. Values with different capital letters are significant at the 0.01 level. Values with different lowercase letters are significant at the 0.05 level.
Figure 6. Changes in the expression of inflammation-associated genes. (A): TNF-α mRNA. (B): IL-1β mRNA. Values with different capital letters are significant at the 0.01 level. Values with different lowercase letters are significant at the 0.05 level.
Nutrients 17 03158 g006
Table 1. Primer sequences for quantitative real-time PCR.
Table 1. Primer sequences for quantitative real-time PCR.
GeneForward Primer (5′−3′)Reverse Primer (5′−3′)
IL-1βTGCCACCTTTTGACAGTGATGTTCTTGTGACCCTGAGCGAC
TNF-αTCTTTCGGAGAAGGTTGCCCAGAAGTCCTGCCACTTCACG
β-actinAGAGGGAAATCGTGCGTGACCAATAGTGATGACCTGGCCGT
IL-1β: Interleukin-1β. TNF-α: Tumor necrosis factor-α.
Table 2. The effect of ursolic acid on grip strength and various muscle weights.
Table 2. The effect of ursolic acid on grip strength and various muscle weights.
Groups
CONHFDUA
Grip strength (g force (gf))118.34 ± 13.24 a99.68 ± 14.71 b112.86 ± 11.52 a
Triceps (mg)234.77 ± 25.14 a198.64 ± 17.75 b242.54 ± 15.68 a
Quadriceps (mg)415.31 ± 39.03 a369.61 ± 38.73 b364.00 ± 27.38 b
Gastrocnemius (mg)288.61 ± 21.89 a271.64 ± 17.43 b290.29 ± 21.82 a
Soleus (mg)14.26 ± 1.0616.58 ± 0.9515.14 ± 1.32
Data are expressed as mean ± SD. Different letters represent significant differences at the 0.05 level.
Table 3. The effect of ursolic acid on plasma lipids.
Table 3. The effect of ursolic acid on plasma lipids.
Groups
CONHFDUA
TG (mmol/L)0.64 ± 0.04 a1.18 ± 0.07 b0.86 ± 0.05 a
TC (mmol/L)2.53 ± 0.28 a4.69 ± 0.23 b3.07 ± 0.31 a
HDL-C (mmol/L)2.34 ± 0.14 a3.64 ± 0.17 b3.24 ± 0.25 b
LDL-C (mmol/L)0.21 ± 0.03 a0.42 ± 0.05 b0.26 ± 0.08 a
FFA (mmol/L)0.37 ± 0.04 a0.78 ± 0.11 b0.44 ± 0.06 a
Data are expressed as mean ± SD. Different letters represent significant differences at the 0.05 level.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kang, D.; Cao, L. Muscle Strength, Lipid Metabolism and Hepatic Steatosis Are Improved with Ursolic Acid Treatment in High-Fat Diet-Induced Obese Mice. Nutrients 2025, 17, 3158. https://doi.org/10.3390/nu17193158

AMA Style

Kang D, Cao L. Muscle Strength, Lipid Metabolism and Hepatic Steatosis Are Improved with Ursolic Acid Treatment in High-Fat Diet-Induced Obese Mice. Nutrients. 2025; 17(19):3158. https://doi.org/10.3390/nu17193158

Chicago/Turabian Style

Kang, Dongyang, and Li Cao. 2025. "Muscle Strength, Lipid Metabolism and Hepatic Steatosis Are Improved with Ursolic Acid Treatment in High-Fat Diet-Induced Obese Mice" Nutrients 17, no. 19: 3158. https://doi.org/10.3390/nu17193158

APA Style

Kang, D., & Cao, L. (2025). Muscle Strength, Lipid Metabolism and Hepatic Steatosis Are Improved with Ursolic Acid Treatment in High-Fat Diet-Induced Obese Mice. Nutrients, 17(19), 3158. https://doi.org/10.3390/nu17193158

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop