Non-Targeted Metabolomic Analysis of Ethanol Extract of Propolis and Its Anti-Inflammatory Effects in LPS-Induced BV2 Microglial Cells via the TLR4 Signaling Pathway
Abstract
1. Introduction
2. Methods
2.1. Preparation of EEP
2.2. Chemical Analysis for Propolis
2.2.1. The Determination of Total Flavonoid and Phenolic Content
2.2.2. Non-Targeted Metabolomics Analysis
Detection Method of Metabolites
Data Preprocessing and Analysis
2.3. Anti-Inflammatory Assays in BV2 Cells
2.3.1. Cell Recovery and Culture
2.3.2. EEP Solution Preparation and Cell Treatment
2.3.3. Cell Viability Assessment
2.3.4. ELISA Analysis of TNF-α, IL-6 and IL-1β Expression
2.3.5. Measurement of Inflammatory Cytokine Gene Expression by RT-qPCR
2.3.6. Statistical Analysis
3. Results
3.1. Untargeted Metabolomics Analysis
3.1.1. Metabonomic Profiling of Propolis
3.1.2. Analysis of Differential Metabolites of Flavonoids and Phenols
3.1.3. Other Differential Metabolites Between HN and SD
3.2. The Anti-Inflammatory Effects of Propolis on LPS-Stimulated BV2 Cells
3.2.1. Effects of EEP and LPS on BV2 Cells Viability
3.2.2. Effects of EEP on the Levels of TNF-α, IL–6 and IL-1β
3.2.3. Effects of EEP on the Expression of Inflammatory Factors
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Zhu, L.Y.; Zhang, J.W.; Yang, H.; Li, G.Y.; Li, H.Y.; Deng, Z.Y.; Zhang, B. Propolis polyphenols: A review on the composition and anti-obesity mechanism of different types of propolis polyphenols. Front. Nutr. 2023, 10, 1066789. [Google Scholar] [CrossRef]
- Kalia, A.; Morya, S.; Neumann, A. Health from the hive: Therapeutic potential of propolis-A review. J. Food Bioact. 2022, 18, 77–84. [Google Scholar] [CrossRef]
- Sadallah, A.; Aprea, E.; Cignola, R.; Caratti, A.; Cordero, C.; Angeli, A.; Martens, S.; Di Francesco, A. Propolis Hydroalcoholic Extracts: Biochemical Characterization and Antifungal Efficacy. Horticulturae 2025, 11, 122. [Google Scholar] [CrossRef]
- Ahangari, Z.; Naseri, M.; Vatandoost, F. Propolis: Chemical composition and its applications in endodontics. Iran. Endod. J. 2018, 13, 285–292. [Google Scholar]
- Bhatti, N.; Hajam, Y.A.; Mushtaq, S.; Kaur, L.; Kumar, R.; Rai, S. A review on dynamic pharmacological potency and multifaceted biological activities of propolis. Discov. Sustain. 2024, 5, 185. [Google Scholar] [CrossRef]
- Zulhendri, F.; Chandrasekaran, K.; Kowacz, M.; Ravalia, M.; Kripal, K.; Fearnley, J.; Perera, C.O. Antiviral, antibacterial, antifungal, and antiparasitic properties of propolis: A review. Foods 2021, 10, 1360. [Google Scholar] [CrossRef]
- Kurek-Górecka, A.; Klósek, M.; Pietsz, G.; Balwierz, R.; Olczyk, P.; Czuba, Z.P. Ethanolic extract of propolis and CAPE as cardioprotective agents against LPS and IFN-α stressed cardiovascular injury. Nutrients 2024, 16, 627. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.L.; Yang, B.; Wang, D.F.; Zhu, Y.X.; Miao, X.Q.; Yang, W.C. The chemical composition of brazilian green propolis and its protective effects on mouse aortic endothelial cells against inflammatory injury. Molecules 2020, 25, 4612. [Google Scholar] [CrossRef] [PubMed]
- Choopanizadeh, M.; Rasouli, M.; Keshavarz, M.; Kalani, M. Combinations of Iranian propolis and Leishmania proteins have the potential to influence IL-4 and IFN-γ in immunized Balb/c mice. J. Apic. Res. 2020, 59, 960–967. [Google Scholar] [CrossRef]
- Li, L.; Sun, W.; Wu, T.; Lu, R.; Shi, B. Caffeic acid phenethyl ester attenuates lipopolysaccharide-stimulated proinflammatory responses in human gingival fibroblasts via NF-κB and PI3K/Akt signaling pathway. Eur. J. Pharmacol. 2017, 794, 61–68. [Google Scholar] [CrossRef] [PubMed]
- Chang, H.S.; Wang, Y.H.; Yin, X.S.; Liu, X.Y.; Xuan, H.Z. Ethanol extract of propolis and its constituent caffeic acid phenethyl ester inhibit breast cancer cells proliferation in inflammatory microenvironment by inhibiting TLR4 signal pathway and inducing apoptosis and autophagy. BMC Complement. Altern. Med. 2017, 17, 471. [Google Scholar] [CrossRef]
- Kaushik, V.; Brünnert, D.; Hanschmann, E.M.; Sharma, P.K.; Anand, B.G.; Kar, K.; Kateriya, S.; Goyal, P. The intrinsic amyloidogenic propensity of cofilin-1 is aggravated by Cys-80 oxidation: A possible link with neurodegenerative diseases. Biochem. Biophys. Res. Commun. 2021, 569, 187–192. [Google Scholar] [CrossRef]
- Dan, X.L.; Wechter, N.; Gray, S.; Mohanty, J.G.; Croteau, D.L.; Bohr, V.A. Olfactory dysfunction in aging and neurodegenerative diseases. Ageing Res. Rev. 2021, 70, 101416. [Google Scholar] [CrossRef]
- Chen, R.; Wang, Z.Y.; Zhi, Z.W.; Tian, J.S.; Zhao, Y.; Sun, J.S. Targeting the TLR4/NF-κB pathway in β-amyloid-stimulated microglial cells: A possible mechanism that oxysophoridine exerts anti-oxidative and anti-inflammatory effects in an In Vitro model of Alzheimer’s disease. Brain Res. Bull. 2021, 175, 150–157. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Zheng, J.; Xu, Y.; Zhang, X. Paraquat-induced inflammatory response of microglia through HSP60/TLR4 signaling. Hum. Exp. Toxicol. 2018, 37, 1161–1168. [Google Scholar] [CrossRef] [PubMed]
- Ramirez, A.I.; de Hoz, R.; Salobrar-Garcia, E.; Salazar, J.J.; Rojas, B.; Ajoy, D.; López-Cuenca, I.; Rojas, P.; Triviño, A.; Ramírez, J.M. The role of microglia in retinal neurodegeneration: Alzheimer’s Disease, Parkinson, and Glaucoma. Front. Aging Neurosci. 2017, 9, 214. [Google Scholar] [CrossRef]
- Lee, K.W.; Jung, S.Y.; Choi, S.M.; Yang, E.J. Effects of ginsenoside Re on LPS-induced inflammatory mediators in BV2 microglial cells. BMC Complement. Altern. Med. 2013, 12, 196. [Google Scholar] [CrossRef] [PubMed]
- Park, B.K.; Kim, Y.H.; Kim, Y.R.; Choi, J.J.; Yang, C.; Jang, I.S.; Lee, M.Y. Antineuroinflammatory and neuroprotective effects of Gyejibokryeong-Hwan in lipopolysaccharide-stimulated BV2 microglia. Evid.-Based Complement. Altern. Med. 2019, 2019, 7585896. [Google Scholar] [CrossRef]
- Xu, X.L.; Pu, R.X.; Li, Y.J.; Wu, Z.; Li, C.X.; Miao, X.Q.; Yang, W.C. Chemical Compositions of Propolis from China and the United States and their Antimicrobial Activities Against Penicillium notatum. Molecules 2019, 24, 3576. [Google Scholar] [CrossRef]
- Yuan, M.; Yuan, X.J.; Pineda, M.; Liang, Z.Y.; He, J.; Sun, S.W.; Pan, T.L.; Li, K.P. A comparative study between Chinese propolis and Brazilian green propolis: Metabolite profile and bioactivity. Food Funct. 2020, 11, 2368–2379. [Google Scholar] [CrossRef]
- Wang, T.T.; Liu, Q.H.; Wang, M.; Zhang, L.M. Metabolomics reveals discrimination of Chinese propolis from different climatic regions. Foods 2020, 9, 491. [Google Scholar] [CrossRef]
- do Nascimento, T.G.; Arruda, R.E.D.; Almeida, E.T.D.; Oliveira, J.M.D.; Basílio, I.D., Jr.; Porto, I.C.C.D.; Sabino, A.R.; Tonholo, J.; Gray, A.; Ebel, R.E. Comprehensive multivariate correlations between climatic effect, metabolite-profile, antioxidant capacity and antibacterial activity of Brazilian red propolis metabolites during seasonal study. Sci. Rep. 2019, 9, 278–283. [Google Scholar] [CrossRef] [PubMed]
- Oruç, H.H.; Sorucu, A.; Ünal, H.H.; Aydin, L. Effects of season and altitude on biological active certain phenolic compounds levels and partial standardization of propolis. Ank. Üniversitesi Vet. Fakültesi Derg. 2017, 64, 13–20. [Google Scholar]
- Xu, W.; Lu, H.; Yuan, Y.; Deng, Z.; Zheng, L.; Li, H. The Antioxidant and Anti-Inflammatory Effects of Flavonoids from Propolis via Nrf2 and NF-κB Pathways. Foods 2022, 11, 2439. [Google Scholar] [CrossRef]
- Al-Sayed, E.; Abdel-Daim, M.M. Protective role of Cupressuflavone from Cupressus macrocarpa against carbon tetrachloride-induced hepato-and nephrotoxicity in mice. Planta Medica 2014, 80, 1665–1671. [Google Scholar] [CrossRef]
- Al-Sayed, E.; Gad, H.A.; El-Shazly, M.; Abdel-Daim, M.M.; Singab, A.N. Anti-inflammatory and analgesic activities of cupressuflavone from Cupressus macrocarpa: Impact on pro-inflammatory mediators. Drug Dev. Res. 2018, 79, 22–28. [Google Scholar] [CrossRef] [PubMed]
- Shvarzbeyn, J.; Huleihel, M. Effect of propolis and caffeic acid phenethyl ester (CAPE) on NFκB activation by HTLV-1 Tax. Antivir. Res. 2011, 90, 108–115. [Google Scholar] [CrossRef]
- Lee, S.C.; Wang, S.Y.; Li, C.C.; Liu, C.T. Anti-inflammatory effect of cinnamaldehyde and linalool from the leaf essential oil of Cinnamomum osmophloeum Kanehira in endotoxin-induced mice. J. Food Drug Anal. 2018, 26, 211–220. [Google Scholar] [CrossRef]
- Held, S.; Schieberle, P.; Somoza, V. Characterization of alpha-terpineol as an anti-inflammatory component of orange juice by in vitro studies using oral buccal cells. J. Agric. Food Chem. 2007, 55, 8040–8046. [Google Scholar] [CrossRef]
- Schepetkin, I.A.; Özek, G.; Özek, T.; Kirpotina, L.N.; Kokorina, P.I.; Khlebnikov, A.I.; Quinn, M.T. Neutrophil Immunomodulatory Activity of Nerolidol, a Major Component of Essential Oils from Populus balsamifera Buds and Propolis. Plants 2022, 11, 3399. [Google Scholar] [CrossRef]
- Funakoshi-Tago, M.; Okamoto, K.; Izumi, R.; Tago, K.; Yanagisawa, K.; Narukawa, Y.; Kiuchi, F.; Kasahara, T.; Tamura, H. Anti-inflammatory activity of flavonoids in Nepalese propolis is attributed to inhibition of the IL-33 signaling pathway. Int. Immunopharmacol. 2015, 25, 189–198. [Google Scholar] [CrossRef] [PubMed]
- Markiewicz-Zukowska, R.; Car, H.; Naliwajko, S.K.; Sawicka, D.; Szynaka, B.; Chyczewski, L.; Isidorov, V.; Borawska, M.H. Ethanolic extract of propolis, chrysin, CAPE inhibit human astroglia cells. Adv. Med. Sci. 2012, 57, 208–216. [Google Scholar] [CrossRef] [PubMed]
- Ohkura, N.; Takata, Y.; Ando, K.; Kanai, S.; Watanabe, E.; Nohira, T.; Atsumi, G. Propolis and its constituentchrysin inhibit plasminogen activator inhibitor 1 production induced by tumour necrosis factor and lipopolysaccharide. J. Apic. Res. 2015, 51, 179–184. [Google Scholar] [CrossRef]
- Sousa, C.; Biber, K.; Michelucci, A. Cellular and molecular characterization of microglia: A unique immune cell population. Front. Immunol. 2017, 8, 198. [Google Scholar] [CrossRef]
- Pannell, M.; Szulzewsky, F.; Matyash, V.; Wolf, S.A.; Kettenmann, H. The subpopulation of microglia sensitive to neurotransmitters/neurohormones is modulated by stimulation with LPS, interferon-γ, and IL-4. Glia 2014, 62, 667–679. [Google Scholar] [CrossRef]
- Wojtera, M.; Sikorska, B.; Sobow, T.; Liberski, P.P. Microglial cells in neurodegenerative disorders. Folia Neuropathol. 2006, 43, 311–321. [Google Scholar]
- Kyrkanides, S.; O’Banion, M.K.; Whiteley, P.E.; Daeschner, J.A.C.; Olschowka, J.A. Enhanced glial activation and expression of specific cns inflammation-related molecules in aged versus young rats following cortical stab injury. J. Neuroimmunol. 2001, 119, 269–277. [Google Scholar] [CrossRef]
- Kim, D.C.; Park, J.S.; Yoon, C.S.; Kim, Y.C.; Oh, H. Nardostachin from Nardostachys jatamansi exerts anti-neuroinflammatory effects through TLR4/MyD88-related suppression of the NF-κB and JNK MAPK signaling pathways in lipopolysaccharide-induced BV2 and primary microglial cells. Mol. Med. Rep. 2020, 23, 1. [Google Scholar] [CrossRef]
- Wang, Y.; Cai, Z.; Zhan, G.; Li, X.; Li, S.; Wang, X.; Li, S.; Luo, A. Caffeic Acid Phenethyl Ester Suppresses Oxidative Stress and Regulates M1/M2 Microglia Polarization via Sirt6/Nrf2 Pathway to Mitigate Cognitive Impairment in Aged Mice following Anesthesia and Surgery. Antioxidants 2023, 12, 714. [Google Scholar] [CrossRef]
- Ehrentraut, H.; Weber, C.; Ehrentraut, S.; Schwederski, M.; Boehm, O.; Knuefermann, P.; Meyer, R.; Baumgarten, G. The toll-like receptor 4-antagonist eritoran reduces murine cardiac hypertrophy. Eur. J. Heart Fail. 2011, 13, 602–610. [Google Scholar] [CrossRef]
- Wu, H.C.; Jiang, K.F.; Yin, N.N.; Ma, X.F.; Zhao, G.; Qiu, C.W.; Deng, G.Z. Thymol mitigates lipopolysaccharide-induced endometritis by regulating the TLR4- and ROS-mediated NF-κB signaling pathways. Oncotarget 2017, 8, 20042–20055. [Google Scholar] [CrossRef] [PubMed]
- Blanco, A.M.; Vallés, S.L.; Pascual, M.; Guerri, C. Involvement of TLR4/type I IL-1 receptor signaling in the induction of inflammatory mediators and cell death induced by ethanol in cultured astrocytes. J. Immunol. 2005, 175, 6893–6899. [Google Scholar] [CrossRef] [PubMed]
- Oršolić, N. Allergic Inflammation: Effect of Propolis and Its Flavonoids. Molecules 2022, 27, 6694. [Google Scholar] [CrossRef]
- Sun, G.; Li, R.; Yang, B.; Fritsche, K.; Beversdorf, D.; Lubahn, D.; Xue, G.; James, L.; Greenlief, C. Quercetin Potentiates Docosahexaenoic Acid to Suppress Lipopolysaccharide-induced Oxidative/Inflammatory Responses, Alter Lipid Peroxidation Products, and Enhance the Adaptive Stress Pathways in BV-2 Microglial Cells. Int. J. Mol. Sci. 2019, 20, 932. [Google Scholar] [CrossRef]
- Gao, C.; Jiang, J.; Tan, Y.; Chen, S. Microglia in neurodegenerative diseases: Mechanism and potential therapeutic targets. Signal Transduct. Target. Ther. 2023, 8, 359. [Google Scholar] [CrossRef] [PubMed]






| Primers | Sequences (5′→3′) |
|---|---|
| IL-1β-Forward | GCATGGATCAGAAACTCAGCAA |
| IL-1β-Reverse | TTGAGAGGTGGTGTAAGCCAT |
| IL-6-Forward | GACTGATGCTGGTGACAACC |
| IL-6-Reverse | CAGGTCTGTTGGGAGTGGT |
| TNF-α-Forward | AAGCCTGTAGCCCACGTCGTA |
| TNF-α-Reverse | GGCACCACTAGTTGGTTGTCTTTG |
| iNOS-Forward | ACACCGTGACCGTTGACTAC |
| iNOS-Reverse | CTTCTGCCGGACTTTGGAGT |
| TLR4-Forward | TCTGGGGAGGCACATCTTCT |
| TLR4-Reverse | AGGTCCAAGTTGCCGTTTCT |
| COX-2-Forward | AGGTCATTGGTGGAGAGGTG |
| COX-2-Reverse | CCTGCTTGAGTATGTCGCAC |
| β-ACT-Forward | GGACTGTTACTGAGCTGCGTT |
| β-ACT-Reverse | CGCCTTCACCGTTCCAGTT |
| ID | Metabolites | m/z | Retention Time (min) | Formula | log2(FC) | FC |
|---|---|---|---|---|---|---|
| 1 | Isorhamnetin | 315.051 | 6.8705 | C16H12O7 | 0.0950 | 1.0681 |
| 2 | Isorhamnetin 3-(6″-acetylgalactoside) | 559.084 | 4.7782 | C24H24O13 | 7.1654 | 143.558 |
| 3 | Dihydroisorhamnetin | 317.067 | 5.1625 | C16H14O7 | 0.5268 | 1.4407 |
| 4 | Kaempferol | 285.041 | 6.6709 | C15H10O6 | 0.1172 | 1.0846 |
| 5 | 8-C-Methylvellokaempferol 3,5-dimethyl ether | 412.175 | 7.6226 | C23H22O6 | −1.8914 | 0.2695 |
| 6 | Kaempferol 3-arabinofuranoside 7-rhamnofuranoside | 565.154 | 5.3921 | C26H28O14 | −0.3176 | 0.8023 |
| 7 | 6″,6″-Dimethylpyraono [2″,3″:7,8] kaempferol 4′-methyl ether 3-rhamnoside | 495.164 | 6.7044 | C27H28O10 | −0.0741 | 0.9499 |
| 8 | Kaempferol 3-apiosyl-(1->4)-rhamnoside-7-rhamnoside | 755.205 | 4.557 | C32H38O18 | 3.7788 | 13.726 |
| 9 | 6-Hydroxyluteolin 7-rhamnoside | 429.083 | 5.3897 | C21H20O11 | 2.6331 | 6.2038 |
| 10 | Pinocembrin 7-rhamnosylglucoside | 587.173 | 5.9783 | C27H32O13 | −0.2939 | 0.8157 |
| 11 | Pinocembrin | 301.072 | 6.8534 | C15H12O4 | 0.2451 | 1.1852 |
| 20 | 5,8-Dihydroxy-7-methoxyflavanone | 269.08 | 10.301 | C16H14O5 | 0.0678 | 1.0481 |
| 21 | (2S)-4′,5-Dihydroxy-8-hydroxymethyl-6″,6″-dimethylpyrano 2″,3″:7,6] flavanone | 391.117 | 8.6383 | C21H20O6 | 0.2282 | 1.1714 |
| 22 | 5,7-Dihydroxy-4′-methoxy-8-C-(2-hydroxy-3-methyl-3-butenyl) flavanone | 369.135 | 9.7757 | C21H22O6 | 0.1829 | 1.1351 |
| 23 | 5,7,8-Trihydroxy-4′-methoxyflavanone | 301.072 | 7.1025 | C16H14O6 | −0.7465 | 0.5960 |
| 24 | 5-Hydroxy-7,8-dimethoxyflavanone | 283.096 | 8.6535 | C17H16O5 | 0.2229 | 1.1671 |
| 25 | Glyflavanone A | 389.138 | 9.9047 | C22H22O5 | 0.0632 | 1.0448 |
| 26 | Sophoraisoflavanone C | 477.263 | 11.280 | C30H36O5 | −0.1504 | 0.9010 |
| 27 | Lumaflavanone C | 489.227 | 11.556 | C30H34O7 | 0.1278 | 1.0926 |
| 28 | 7-Hydroxy-6,8-di-C-methylflavanone 7-O-arabinoside | 423.143 | 6.8422 | C22H24O7 | 0.1229 | 1.0889 |
| 29 | Glicoisoflavanone | 407.147 | 10.194 | C22H24O6 | −0.1069 | 0.9285 |
| 30 | Epilumaflavanone A | 533.218 | 9.7602 | C30H32O6 | −1.1109 | 0.4630 |
| 31 | Citflavanone | 356.149 | 4.7435 | C20H18O5 | −1.088 | 0.4704 |
| 32 | Prenyl cis-caffeate | 247.098 | 8.3515 | C14H16O4 | 0.1074 | 1.0773 |
| 33 | Caffeic acid ethyl ester | 209.081 | 5.6655 | C11H12O4 | −0.2729 | 0.8276 |
| 34 | Caffeic acid | 163.039 | 4.2200 | C9H8O4 | −1.2746 | 0.4133 |
| 35 | Ferulic acid | 177.054 | 4.9568 | C10H10O4 | −0.3795 | 0.7687 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, X.; Li, C.; Zhu, Y.; Zhao, S.; Wu, F.; He, Q.; Wei, L.; Duan, X.; Li, J. Non-Targeted Metabolomic Analysis of Ethanol Extract of Propolis and Its Anti-Inflammatory Effects in LPS-Induced BV2 Microglial Cells via the TLR4 Signaling Pathway. Nutrients 2025, 17, 2831. https://doi.org/10.3390/nu17172831
Xu X, Li C, Zhu Y, Zhao S, Wu F, He Q, Wei L, Duan X, Li J. Non-Targeted Metabolomic Analysis of Ethanol Extract of Propolis and Its Anti-Inflammatory Effects in LPS-Induced BV2 Microglial Cells via the TLR4 Signaling Pathway. Nutrients. 2025; 17(17):2831. https://doi.org/10.3390/nu17172831
Chicago/Turabian StyleXu, Xiaolan, Chunxia Li, Yuxuan Zhu, Shuangshuang Zhao, Fangjing Wu, Qian He, Lizhen Wei, Xinle Duan, and Jianghong Li. 2025. "Non-Targeted Metabolomic Analysis of Ethanol Extract of Propolis and Its Anti-Inflammatory Effects in LPS-Induced BV2 Microglial Cells via the TLR4 Signaling Pathway" Nutrients 17, no. 17: 2831. https://doi.org/10.3390/nu17172831
APA StyleXu, X., Li, C., Zhu, Y., Zhao, S., Wu, F., He, Q., Wei, L., Duan, X., & Li, J. (2025). Non-Targeted Metabolomic Analysis of Ethanol Extract of Propolis and Its Anti-Inflammatory Effects in LPS-Induced BV2 Microglial Cells via the TLR4 Signaling Pathway. Nutrients, 17(17), 2831. https://doi.org/10.3390/nu17172831
