6-Shogaol, an Active Component of Ginger, Inhibits p300 Histone Acetyltransferase Activity and Attenuates the Development of Pressure-Overload-Induced Heart Failure
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Animal Experiments
2.3. Cardiomyocyte and Cardiac Fibroblast Culture
2.4. Immunofluorescence Staining and Measurement of Cardiomyocyte Surface Area
2.5. Quantitative Real-Time PCR
2.6. Measurement of L-Proline Incorporation
2.7. Sample Preparation and Western Blotting
2.8. In Vitro p300-Histone Acetyltransferase Assay
2.9. Transverse Aortic Constriction Surgery and Drug Treatment
2.10. Echocardiography
2.11. Histological Analysis
2.12. Statistics
3. Results
3.1. 6-Shogaol Significantly Suppressed PE-Induced Hypertrophic Responses in Cardiomyocytes
3.2. 6-Shogaol Significantly Suppressed TGF-β-Induced Collagen Synthesis and Fibroblast Differentiation in Cardiac Fibroblasts
3.3. 6-Shogaol Blocked PE- and TGF-β-Induced Acetylation of Histone H3K9 through the Inhibition of p300-HAT Activity
3.4. 6-Shogaol Significantly Attenuated Pressure-Overload-Induced Cardiac Hypertrophy and Systolic Dysfunction in Mice
3.5. 6-Shogaol Significantly Inhibited Pressure-Overload-Induced Hypertrophic Responses in Mouse Heart
3.6. 6-Shogaol Significantly Suppressed Pressure-Overload-Induced Cardiac Fibrosis in Mouse Heart
3.7. 6-Shogaol Significantly Suppressed a Pressure-Overload-Induced Increase in Histone Acetylation in Mouse Hearts
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ponikowski, P.; Anker, S.D.; AlHabib, K.F.; Cowie, M.R.; Force, T.L.; Hu, S.; Jaarsma, T.; Krum, H.; Rastogi, V.; Rohde, L.E.; et al. Heart failure: Preventing disease and death worldwide. ESC Heart Fail. 2014, 1, 4–25. [Google Scholar] [CrossRef] [PubMed]
- Savarese, G.; Lund, L.H. Global Public Health Burden of Heart Failure. Card. Fail. Rev. 2017, 3, 7–11. [Google Scholar] [CrossRef] [PubMed]
- Bytyçi, I.; Bajraktari, G. Mortality in heart failure patients. Anadolu Kardiyol. Derg. 2015, 15, 63–68. [Google Scholar] [CrossRef] [PubMed]
- Heidenreich, P.A.; Trogdon, J.G.; Khavjou, O.A.; Butler, J.; Dracup, K.; Ezekowitz, M.D.; Finkelstein, E.A.; Hong, Y.; Johnston, S.C.; Khera, A.; et al. Forecasting the future of cardiovascular disease in the United States: A policy statement from the American Heart Association. Circulation 2011, 123, 933–944. [Google Scholar] [CrossRef] [PubMed]
- Kaplinsky, E. DAPA-HF trial: Dapagliflozin evolves from a glucose-lowering agent to a therapy for heart failure. Drugs Context 2020, 9, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Messerli, F.H.; Rimoldi, S.F.; Bangalore, S. Mini-Focus Issue: Cardiovascular Comorbidities the Transition from Hypertension to Heart Failure Contemporary Update. J. Am. Coll. Cardiol. HF 2017, 5, 543–551. [Google Scholar]
- Hartupee, J.; Mann, D.L. Neurohormonal activation in heart failure with reduced ejection fraction. Nat. Rev. Cardiol. 2016, 14, 30–38. [Google Scholar] [CrossRef]
- Carabello, B.A. Concentric versus eccentric remodeling. J. Card. Fail. 2002, 8, S258–S263. [Google Scholar] [CrossRef]
- Lazzeroni, D.; Rimoldi, O.; Camici, P.G. From Left Ventricular Hypertrophy to Dysfunction and Failure. Circ. J. 2016, 80, 555–564. [Google Scholar] [CrossRef]
- Derumeaux, G.; Mulder, P.; Richard, V.; Chagraoui, A.; Nafeh, C.; Bauer, F.; Henry, J.P.; Thuillez, C. Tissue Doppler imaging differen-tiates physiological from pathological pressure-overload left ventricular hypertrophy in rats. Circulation 2002, 105, 1602–1608. [Google Scholar] [CrossRef]
- Brown, R.D.; Ambler, S.K.; Mitchell, M.D.; Long, C.S. THE CARDIAC FIBROBLAST: Therapeutic Target in Myocardial Remodeling and Failure. Annu. Rev. Pharmacol. Toxicol. 2005, 45, 657–687. [Google Scholar] [CrossRef] [PubMed]
- Goyal, S.N.; Sharma, C.; Mahajan, U.B.; Patil, C.R.; Agrawal, Y.O.; Kumari, S.; Arya, D.S.; Ojha, S. Protective Effects of Cardamom in Isoproterenol-Induced Myocardial Infarction in Rats. Int. J. Mol. Sci. 2015, 16, 27457–27469. [Google Scholar] [CrossRef] [PubMed]
- Kris-Etherton, P.; Lefevre, M.; Beecher, G.; Gross, M.; Keen, C.; Etherton, T. Bioactive Compounds in Nutrition and Health-Research Methodologies for Establishing Biological Function: The Antioxidant and Anti-inflammatory Effects of Flavonoids on Atherosclerosis. Annu. Rev. Nutr. 2004, 24, 511–538. [Google Scholar] [CrossRef] [PubMed]
- Visioli, F.; Borsani, L.; Galli, C. Diet and prevention of coronary heart disease: The potential role of phytochemicals. Cardiovasc. Res. 2000, 47, 419–425. [Google Scholar] [CrossRef]
- Li, F.; Nitteranon, V.; Tang, X.; Liang, J.; Zhang, G.; Parkin, K.L.; Hu, Q. In vitro antioxidant and anti-inflammatory activities of 1-dehydro-[6]-gingerdione, 6-shogaol, 6-dehydroshogaol and hexahydrocurcumin. Food Chem. 2012, 135, 332–337. [Google Scholar] [CrossRef]
- Na, J.-Y.; Song, K.; Lee, J.-W.; Kim, S.; Kwon, J. Pretreatment of 6-shogaol attenuates oxidative stress and inflammation in middle cerebral artery occlusion-induced mice. Eur. J. Pharmacol. 2016, 788, 241–247. [Google Scholar] [CrossRef]
- Nedungadi, D.; Binoy, A.; Pandurangan, N.; Pal, S.; Nair, B.; Mishra, N. 6-Shogaol induces caspase-independent paraptosis in cancer cells via proteasomal inhibition. Exp. Cell Res. 2018, 364, 243–251. [Google Scholar] [CrossRef]
- Sari, N.; Katanasaka, Y.; Sugiyama, Y.; Sunagawa, Y.; Miyazaki, Y.; Funamoto, M.; Shimizu, S.; Shimizu, K.; Murakami, A.; Mori, K.; et al. Zerumbone prevents pressure overload-induced left ventricular systolic dysfunction by inhibiting cardiac hypertrophy and fibrosis. Phytomedicine 2021, 92, 153744. [Google Scholar] [CrossRef]
- Sunagawa, Y.; Shimizu, K.; Katayama, A.; Funamoto, M.; Shimizu, K.; Nurmila, S.; Shimizu, S.; Miyazaki, Y.; Katanasaka, Y.; Hasegawa, K.; et al. Metformin suppresses phenylephrine-induced hypertrophic responses by inhibiting p300-HAT activity in cardiomyocytes. J. Pharmacol. Sci. 2021, 147, 169–175. [Google Scholar] [CrossRef]
- Shimizu, K.; Sunagawa, Y.; Funamoto, M.; Wakabayashi, H.; Genpei, M.; Miyazaki, Y.; Katanasaka, Y.; Sari, N.; Shimizu, S.; Katayama, A.; et al. The Synthetic Curcumin Analogue GO-Y030 Effectively Suppresses the Development of Pressure Overload-induced Heart Failure in Mice. Sci. Rep. 2020, 10, 7172. [Google Scholar] [CrossRef]
- McCollum, L.T.; Gallagher, P.E.; Tallant, E.A. Angiotensin-(1–7) abrogates mitogen-stimulated proliferation of cardiac fibroblasts. Peptides 2012, 34, 380–388. [Google Scholar] [CrossRef] [PubMed]
- Sunagawa, Y.; Morimoto, T.; Takaya, T.; Kaichi, S.; Wada, H.; Kawamura, T.; Fujita, M.; Shimatsu, A.; Kita, T.; Hasegawa, K. Cyclin-dependent kinase-9 is a component of the p300/GATA4 complex required for phenylephrine-induced hypertrophy in cardiomyocytes. J. Biol. Chem. 2010, 285, 9556–9568. [Google Scholar] [CrossRef] [PubMed]
- Sari, N.; Katanasaka, Y.; Honda, H.; Miyazaki, Y.; Sunagawa, Y.; Funamoto, M.; Shimizu, K.; Shimizu, S.; Wada, H.; Hasegawa, K.; et al. Cacao Bean Polyphenols Inhibit Cardiac Hypertrophy and Systolic Dysfunction in Pressure Overload-induced Heart Failure Model Mice. Planta Med. 2020, 86, 1304–1312. [Google Scholar] [CrossRef] [PubMed]
- Sakaguchi, T.; Takefuji, M.; Wettschureck, N.; Hamaguchi, T.; Amano, M.; Kato, K.; Tsuda, T.; Eguchi, S.; Ishihama, S.; Mori, Y.; et al. Protein Kinase N Promotes Stress-Induced Cardiac Dysfunction Through Phosphorylation of Myocardin-Related Transcription Factor A and Disruption of Its Interaction with Actin. Circulation 2019, 140, 1737–1752. [Google Scholar] [CrossRef] [PubMed]
- Funamoto, M.; Sunagawa, Y.; Katanasaka, Y.; Shimizu, K.; Miyazaki, Y.; Sari, N.; Shimizu, S.; Mori, K.; Wada, H.; Hasegawa, K.; et al. Histone Acetylation Domains Are Differentially Induced during Development of Heart Failure in Dahl Salt-Sensitive Rats. Int. J. Mol. Sci. 2021, 22, 1771. [Google Scholar] [CrossRef]
- Morimoto, T.; Sunagawa, Y.; Kawamura, T.; Takaya, T.; Wada, H.; Nagasawa, A.; Komeda, M.; Fujita, M.; Shimatsu, A.; Kita, T.; et al. The dietary compound curcumin inhibits p300 histone acetyltransferase activity and prevents heart failure in rats. J. Clin. Investig. 2008, 118, 868–878. [Google Scholar] [CrossRef]
- Sunagawa, Y.; Morimoto, T.; Wada, H.; Takaya, T.; Katanasaka, Y.; Kawamura, T.; Yanagi, S.; Marui, A.; Sakata, R.; Shimatsu, A.; et al. A Natural p300-Specific Histone Acetyltransferase Inhibitor, Curcumin, in Addition to Angiotensin-Converting Enzyme Inhibitor, Exerts Beneficial Effects on Left Ventricular Systolic Function After Myocardial Infarction in Rats. Circ. J. 2011, 75, 2151–2159. [Google Scholar] [CrossRef]
- Conrad, C.H.; Brooks, W.W.; Hayes, J.A.; Sen, S.; Robinson, K.G.; Bing, O.H.L. Myocardial Fibrosis and Stiffness with Hypertrophy and Heart Failure in the Spontaneously Hypertensive Rat. Circulation 1995, 91, 161–170. [Google Scholar] [CrossRef]
- Miyamoto, S.; Kawamura, T.; Morimoto, T.; Ono, K.; Wada, H.; Kawase, Y.; Matsumori, A.; Nishio, R.; Kita, T.; Hasegawa, K. Histone Acetyltransferase Activity of p300 Is Required for the Promotion of Left Ventricular Remodeling After Myocardial Infarction in Adult Mice In Vivo. Circulation 2006, 113, 679–690. [Google Scholar] [CrossRef]
- Yanazume, T.; Hasegawa, K.; Morimoto, T.; Kawamura, T.; Wada, H.; Matsumori, A.; Kawase, Y.; Hirai, M.; Kita, T. Cardiac p300 Is Involved in Myocyte Growth with Decompensated Heart Failure. Mol. Cell. Biol. 2003, 23, 3593–3606. [Google Scholar] [CrossRef]
- Ma, S.; Guo, Z.; Liu, F.; Hasan, S.G.; Yang, D.; Tang, N.; An, P.; Wang, M.; Wu, H.; Yang, Z.; et al. 6-Gingerol protects against cardiac remodeling by inhibiting the p38 mitogen-activated protein kinase pathway. Acta Pharm. Sin. 2021, 42, 1575–1586. [Google Scholar] [CrossRef] [PubMed]
- Wei, J.Q.; Shehadeh, L.A.; Mitrani, J.M.; Pessanha, M.; Slepak, T.I.; Webster, K.A.; Bishopric, N.H. Quantitative Control of Adaptive Cardiac Hypertrophy by Acetyltransferase p300. Circulation 2008, 118, 934–946. [Google Scholar] [CrossRef] [PubMed]
- Derynck, R.; Zhang, Y.E. Smad-dependent and Smad-independent pathways in TGF-b family signalling. Nature 2003, 425, 577–584. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Miano, J.M.; Cserjesi, P.; Olson, E.N. SM22α, a Marker of Adult Smooth Muscle, Is Expressed in Multiple Myogenic Lineages During Embryogenesis. Circ. Res. 1996, 78, 188–195. [Google Scholar] [CrossRef]
- Qiu, P.; Ritchie, R.P.; Gong, X.Q.; Hamamori, Y.; Li, L. Dynamic changes in chromatin acetylation and the expression of histone acetyltransferases and histone deacetylases regulate the SM22α transcription in response to Smad3-mediated TGFβ1 signaling. Biochem. Biophys. Res. Commun. 2006, 348, 351–358. [Google Scholar] [CrossRef] [PubMed]
- Travers, J.G.; Kamal, F.A.; Robbins, J.; Yutzey, K.E.; Blaxall, B.C. Cardiac fibrosis: The fibroblast awakens. Circ. Res. 2016, 118, 1021–1040. [Google Scholar] [CrossRef] [PubMed]
- Qiu, P.; Li, L. Histone acetylation and recruitment of serum responsive factor and CREB-binding protein onto SM22 promoter during SM22 gene expression. Circ. Res. 2002, 90, 858–865. [Google Scholar] [CrossRef]
- Pan, M.H.; Hsieh, M.C.; Hsu, P.C.; Ho, S.Y.; Lai, C.S.; Wu, H.; Sang, S.; Ho, C.T. 6-Shogaol suppressed lipopol-ysaccharide-induced up-expression of iNOS and COX-2 in murine macrophages. Mol. Nutr. Food Res. 2008, 52, 1467–1477. [Google Scholar] [CrossRef]
- Ma, R.-H.; Ni, Z.-J.; Thakur, K.; Cespedes-Acuña, C.L.; Zhang, J.-G.; Wei, Z.-J. Transcriptome and proteomics conjoint analysis reveal metastasis inhibitory effect of 6-shogaol as ferroptosis activator through the PI3K/AKT pathway in human endometrial carcinoma in vitro and in vivo. Food Chem. Toxicol. 2022, 170, 113499. [Google Scholar] [CrossRef]
- Bapat, P.; Ghadi, R.; Chaudhari, D.; Katiyar, S.S.; Jain, S. Tocophersolan stabilized lipid nanocapsules with high drug loading to improve the permeability and oral bioavailability of curcumin. Int. J. Pharm. 2019, 560, 219–227. [Google Scholar] [CrossRef]
- Wang, Q.; Yang, Q.; Cao, X.; Wei, Q.; Firempong, C.K.; Guo, M.; Shi, F.; Xu, X.; Deng, W.; Yu, J. Enhanced oral bioavailability and anti-gout activity of [6]-shogaol-loaded solid lipid nanoparticles. Int. J. Pharm. 2018, 550, 24–34. [Google Scholar] [CrossRef]
- Veber, D.F.; Johnson, S.R.; Cheng, H.Y.; Smith, B.R.; Ward, K.W.; Kopple, K.D. Molecular properties that influence the oral bioavailability of drug candidates. J. Med. Chem. 2002, 45, 2615–2623. [Google Scholar] [CrossRef]
- Yang, C.; Zhang, M.; Lama, S.; Wang, L.; Merlin, D. Natural-lipid nanoparticle-based therapeutic approach to deliver 6-shogaol and its metabolites M2 and M13 to the colon to treat ulcerative colitis. J. Control. Release 2020, 323, 293–310. [Google Scholar] [CrossRef] [PubMed]
- Zick, S.M.; Djuric, Z.; Ruffin, M.T.; Litzinger, A.J.; Normolle, D.P.; Alrawi, S.; Feng, M.R.; Brenner, D.E. Pharmacokinetics of 6-gingerol, 8-gingerol, 10-gingerol, and 6-shogaol and conjugate metabolites in healthyhuman subjects. Cancer Epidemiol. Biomark. Prev. 2008, 17, 1930–1936. [Google Scholar] [CrossRef] [PubMed]
- Mukkavilli, R.; Yang, C.; Tanwar, R.S.; Saxena, R.; Gundala, S.R.; Zhang, Y.; Ghareeb, A.; Floyd, S.D.; Vangala, S.; Kuo, W.-W.; et al. Pharmacokinetic-pharmacodynamic correlations in the development of ginger extract as an anticancer agent. Sci. Rep. 2018, 8, 3056. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Wang, Q.; Sun, C.; Zhu, Y.; Yang, Q.; Wei, Q.; Chen, J.; Deng, W.; Adu-Frimpong, M.; Yu, J.; et al. Enhanced Oral Bioavailability, Anti-Tumor Activity and Hepatoprotective Effect of 6-Shogaol Loaded in a Type of Novel Micelles of Polyethylene Glycol and Linoleic Acid Conjugate. Pharmaceutics 2019, 11, 107. [Google Scholar] [CrossRef] [PubMed]
- Bao, R.; Wang, Q.-L.; Li, R.; Adu-Frimpong, M.; Toreniyazov, E.; Ji, H.; Xu, X.-M.; Yu, J.-N. Improved oral bioavailability and target delivery of 6-shogaol via vitamin E TPGS-modified liposomes: Preparation, in-vitro and in-vivo characterizations. J. Drug Deliv. Sci. Technol. 2020, 59, 101842. [Google Scholar] [CrossRef]
- Gerdts, E.; Regitz-Zagrosek, V. Sex differences in cardiometabolic disorders. Nat. Med. 2019, 25, 1657–1666. [Google Scholar] [CrossRef]
- Donaldson, C.; Eder, S.; Baker, C.; Aronovitz, M.J.; Weiss, A.D.; Hall-Porter, M.; Wang, F.; Ackerman, A.; Karas, R.H.; Molkentin, J.D.; et al. Estrogen attenuates left ventricular and cardiomyocyte hypertrophy by an estrogen receptor-dependent pathway that increases calcineurin degradation. Circ. Res. 2009, 104, 265–275. [Google Scholar] [CrossRef]
- Bottillo, I.; Giordano, C.; Cerbelli, B.; D’Angelantonio, D.; Lipari, M.; Polidori, T.; Majore, S.; Bertini, E.; D’Amico, A.; Giannarelli, D.; et al. A novel LAMP2 mutation associated with severe cardiac hypertrophy and microvascular remodeling in a female with Danon disease: A case report and literature review. Cardiovasc. Pathol. 2016, 25, 423–431. [Google Scholar] [CrossRef]
- Regitz-Zagrosek, V.; Oertelt-Prigione, S.; Seeland, U.; Hetzer, R. Sex and Gender Differences in Myocardial Hypertrophy and Heart Failure. Circ. J. 2010, 74, 1265–1273. [Google Scholar] [CrossRef] [PubMed]
- Regitz-Zagrosek, V. Sex and gender differences in health. Science & Society Series on Sex and Science. EMBO Rep. 2012, 13, 596–603. [Google Scholar] [PubMed]
- Zucker, I.; Beery, A.K. Males still dominate animal studies. Nature 2010, 465, 690. [Google Scholar] [CrossRef] [PubMed]
Target Gene | Forward | Reverse |
---|---|---|
ANF | ATCACCAAGGGCTTCTTCCT | CCTCATCTTCTACCGGCATC |
BNP | TTCCGGATCCAGGAGAGACTT | CCTAAAACAACCTCAGCCCGT |
Rat-α-SMA | TTCCGGATCCAGGAGAGACTT | TTTGGCCCATTCCAACCATC |
Rat-Periostin | AGGAGCCGTGTTTGAGACCAT | CGGTGAAAGTGGTTTGCTGTTT |
Rat-Col1a1 | TGGTCTTGGAGGAAACTT | CCATCGTTACCACGAGCA |
Mouse-α-SMA | GTCCCAGACATCAGGGAGTAA | TCGGATACTTCAGCGTCAGGA |
Mouse-Periostin | ACCTGCAATGACGAAGATCC | TCACTTCTGTCACCGTTTCG |
Mouse-Col1a1 | AAGAAGACATCCCTGAAGTCA | TTGTGGCAGATACAGATCAAG |
Mouse-Col3a1 | CCCAACCCAGAGATCCCATT | GAAGCACAGGAGGTGTAGA |
Mouse-Fibronectin | CCGGTGGCTGTCAGTCAGA | CCGTTCCCACTGCTGATTTATC |
Mouse-TGF-β | GCTGCGCTTGCAGAGATTAAA | TTGCTGTACTGTGTGTCCAG |
18S rRNA | CTTAGAGGGACAAGGGCG | GGACATCTAAGGGCATCACA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kawase, Y.; Sunagawa, Y.; Shimizu, K.; Funamoto, M.; Hamabe-Horiike, T.; Katanasaka, Y.; Shimizu, S.; Hawke, P.; Mori, K.; Komiyama, M.; et al. 6-Shogaol, an Active Component of Ginger, Inhibits p300 Histone Acetyltransferase Activity and Attenuates the Development of Pressure-Overload-Induced Heart Failure. Nutrients 2023, 15, 2232. https://doi.org/10.3390/nu15092232
Kawase Y, Sunagawa Y, Shimizu K, Funamoto M, Hamabe-Horiike T, Katanasaka Y, Shimizu S, Hawke P, Mori K, Komiyama M, et al. 6-Shogaol, an Active Component of Ginger, Inhibits p300 Histone Acetyltransferase Activity and Attenuates the Development of Pressure-Overload-Induced Heart Failure. Nutrients. 2023; 15(9):2232. https://doi.org/10.3390/nu15092232
Chicago/Turabian StyleKawase, Yuto, Yoichi Sunagawa, Kana Shimizu, Masafumi Funamoto, Toshihide Hamabe-Horiike, Yasufumi Katanasaka, Satoshi Shimizu, Philip Hawke, Kiyoshi Mori, Maki Komiyama, and et al. 2023. "6-Shogaol, an Active Component of Ginger, Inhibits p300 Histone Acetyltransferase Activity and Attenuates the Development of Pressure-Overload-Induced Heart Failure" Nutrients 15, no. 9: 2232. https://doi.org/10.3390/nu15092232
APA StyleKawase, Y., Sunagawa, Y., Shimizu, K., Funamoto, M., Hamabe-Horiike, T., Katanasaka, Y., Shimizu, S., Hawke, P., Mori, K., Komiyama, M., Hasegawa, K., & Morimoto, T. (2023). 6-Shogaol, an Active Component of Ginger, Inhibits p300 Histone Acetyltransferase Activity and Attenuates the Development of Pressure-Overload-Induced Heart Failure. Nutrients, 15(9), 2232. https://doi.org/10.3390/nu15092232