Gamma-Aminobutyric Acid Promotes Beige Adipocyte Reconstruction by Modulating the Gut Microbiota in Obese Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Experiments and Study Design
2.2. Glucose and Insulin Tolerance Test
2.3. Cold Stimulation Test
2.4. Tissue Collection and Immunostaining
2.5. Gut Microbiota Analysis
2.6. Non-Targeted Metabolomics
2.7. Magnetic Resonance Imaging (MRI)
2.8. Fecal Microbiota Transplantation (FMT)
2.9. Quantitative PCR Analysis
2.10. Western Blot Analysis
2.11. Statistical Analysis
3. Results
3.1. GABA Treatment Promotes Energy Consumption and Improves Glucose Metabolism
3.2. GABA Promotes Energy Consumption through iWAT Beiging
3.3. GABA Reduces Fat Inflammation and Restores Intestinal Structure in HFD Mice
3.4. GABA Modulates the Composition of Gut Microbiota
3.5. Gut Microbiota Mediates the Effect of GABA on iWAT Beiging
3.6. Effect of GABA on Serum Metabolites
3.7. Potential Relationships between Serum Metabolites and the Gut Microbiota
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hu, C.; Jia, W. Diabetes in China: Epidemiology and Genetic Risk Factors and Their Clinical Utility in Personalized Medication. Diabetes 2018, 67, 3–11. [Google Scholar] [CrossRef] [Green Version]
- Zhou, M.; Wang, H.; Zeng, X.; Yin, P.; Zhu, J.; Chen, W.; Li, X.; Wang, L.; Wang, L.; Liu, Y.; et al. Mortality, morbidity, and risk factors in China and its provinces, 1990–2017: A systematic analysis for the Global Burden of Disease Study 2017. Lancet 2019, 394, 1145–1158. [Google Scholar] [CrossRef] [Green Version]
- Saunders, K.H.; Umashanker, D.; Igel, L.I.; Kumar, R.B.; Aronne, L.J. Obesity Pharmacotherapy. Med. Clin. N. Am. 2018, 102, 135–148. [Google Scholar] [CrossRef] [PubMed]
- Kaisanlahti, A.; Glumoff, T. Browning of white fat: Agents and implications for beige adipose tissue to type 2 diabetes. J. Physiol. Biochem. 2019, 75, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Grandone, A.; Di Sessa, A.; Umano, G.; Toraldo, R.; del Giudice, E.M. New treatment modalities for obesity. Best Pract. Res. Clin. Endocrinol. Metab. 2018, 32, 535–549. [Google Scholar] [CrossRef] [PubMed]
- Inagaki, T.; Sakai, J.; Kajimura, S. Transcriptional and epigenetic control of brown and beige adipose cell fate and function. Nat. Rev. Mol. Cell Biol. 2016, 17, 480–495. [Google Scholar] [CrossRef] [Green Version]
- Lahiri, V.; Hawkins, W.D.; Klionsky, D.J. Watch What You (Self-) Eat: Autophagic Mechanisms that Modulate Metabolism. Cell Metab. 2019, 29, 803–826. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Y.; Wang, D.; Ping, X.; Zhang, Y.; Zhang, T.; Wang, L.; Jin, L.; Zhao, W.; Guo, M.; Shen, F.; et al. Local hyperthermia therapy induces browning of white fat and treats obesity. Cell 2022, 185, 949–966.e19. [Google Scholar] [CrossRef] [PubMed]
- Soto, M.; Herzog, C.; Pacheco, J.A.; Fujisaka, S.; Bullock, K.; Clish, C.; Kahn, C.R. Gut microbiota modulate neurobehavior through changes in brain insulin sensitivity and metabolism. Mol. Psychiatry 2018, 23, 2287–2301. [Google Scholar] [CrossRef]
- Quan, L.-H.; Zhang, C.; Dong, M.; Jiang, J.; Xu, H.; Yan, C.; Liu, X.; Zhou, H.; Zhang, H.; Chen, L.; et al. Myristoleic acid produced by enterococci reduces obesity through brown adipose tissue activation. Gut 2019, 69, 1239–1247. [Google Scholar] [CrossRef]
- Moreno-Navarrete, J.M.; Serino, M.; Blasco-Baque, V.; Azalbert, V.; Barton, R.H.; Cardellini, M.; Latorre, J.; Ortega, F.J.; Sabater-Masdeu, M.; Burcelin, R.; et al. Gut Microbiota Interacts with Markers of Adipose Tissue Browning, Insulin Action and Plasma Acetate in Morbid Obesity. Mol. Nutr. Food Res. 2018, 62, 1700721. [Google Scholar] [CrossRef]
- Wang, Y.; Tong, Q.; Shou, J.-W.; Zhao, Z.-X.; Li, X.-Y.; Zhang, X.-F.; Ma, S.-R.; Zhen-Xiong, Z.; Lin, Y.; Wen, B.-Y.; et al. Gut Microbiota-Mediated Personalized Treatment of Hyperlipidemia Using Berberine. Theranostics 2017, 7, 2443–2451. [Google Scholar] [CrossRef]
- Suárez-Zamorano, N.; Fabbiano, S.; Chevalier, C.; Stojanovic, O.; Colin, D.J.; Stevanović, A.; Veyrat-Durebex, C.; Tarallo, V.; Rigo, D.; Germain, S.; et al. Microbiota depletion promotes browning of white adipose tissue and reduces obesity. Nat. Med. 2015, 21, 1497–1501. [Google Scholar] [CrossRef] [PubMed]
- Li, G.; Xie, C.; Lu, S.; Nichols, R.G.; Tian, Y.; Li, L.; Patel, D.; Ma, Y.; Brocker, C.N.; Yan, T.; et al. Intermittent Fasting Promotes White Adipose Browning and Decreases Obesity by Shaping the Gut Microbiota. Cell Metab. 2017, 26, 672–685.e4. [Google Scholar] [CrossRef] [Green Version]
- Chevalier, C.; Stojanović, O.; Colin, D.J.; Suarez-Zamorano, N.; Tarallo, V.; Veyrat-Durebex, C.; Rigo, D.; Fabbiano, S.; Stevanović, A.; Hagemann, S.; et al. Gut Microbiota Orchestrates Energy Homeostasis during Cold. Cell 2015, 163, 1360–1374. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ziętak, M.; Kovatcheva-Datchary, P.; Markiewicz, L.H.; Ståhlman, M.; Kozak, L.P.; Bäckhed, F. Altered Microbiota Contributes to Reduced Diet-Induced Obesity upon Cold Exposure. Cell Metab. 2016, 23, 1216–1223. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, X.; Gao, F.; Chen, Q.; Xuan, X.; Wang, Y.; Deng, H.; Yang, F.; Yuan, L. ACE2 modulates glucose homeostasis through GABA signaling during metabolic stress. J. Endocrinol. 2020, 246, 223–236. [Google Scholar] [CrossRef]
- Wang, Q.; Ren, L.; Wan, Y.; Prud’Homme, G.J. GABAergic regulation of pancreatic islet cells: Physiology and antidiabetic effects. J. Cell. Physiol. 2019, 234, 14432–14444. [Google Scholar] [CrossRef]
- Chen, X.; Li, Y.; Xiao, J.; Zhang, H.; Yang, C.; Wei, Z.; Chen, W.; Du, X.; Liu, J. Modulating Neuro-Immune-Induced Macrophage Polarization With Topiramate Attenuates Experimental Abdominal Aortic Aneurysm. Front. Pharmacol. 2020, 11, 565461. [Google Scholar] [CrossRef]
- Si, X.; Shang, W.; Zhou, Z.; Shui, G.; Lam, S.M.; Blanchard, C.; Strappe, P. Gamma-aminobutyric Acid Enriched Rice Bran Diet Attenuates Insulin Resistance and Balances Energy Expenditure via Modification of Gut Microbiota and Short-Chain Fatty Acids. J. Agric. Food Chem. 2018, 66, 881–890. [Google Scholar] [CrossRef]
- Yang, M.; Ma, X.; Xuan, X.; Deng, H.; Chen, Q.; Yuan, L. Liraglutide Attenuates Non-Alcoholic Fatty Liver Disease in Mice by Regulating the Local Renin-Angiotensin System. Front. Pharmacol. 2020, 11, 432. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, X.; Xiao, W.; Li, H.; Pang, P.; Xue, F.; Wan, L.; Pei, L.; Yan, H. Metformin restores hippocampal neurogenesis and learning and memory via regulating gut microbiota in the obese mouse model. Brain. Behav. Immun. 2021, 95, 68–83. [Google Scholar] [CrossRef] [PubMed]
- Leon-Coria, A.; Kumar, M.; Moreau, F.; Chadee, K. Defining cooperative roles for colonic microbiota and Muc2 mucin in mediating innate host defense against Entamoeba histolytica. PLoS Pathog. 2018, 14, e1007466. [Google Scholar] [CrossRef]
- Tang, X.; Wang, W.; Hong, G.; Duan, C.; Zhu, S.; Tian, Y.; Han, C.; Qian, W.; Lin, R.; Hou, X. Gut microbiota-mediated lysophosphatidylcholine generation promotes colitis in intestinal epithelium-specific Fut2 deficiency. J. Biomed. Sci. 2021, 28, 20. [Google Scholar] [CrossRef]
- Halatchev, I.G.; O’Donnell, D.; Hibberd, M.C.; Gordon, J.I. Applying indirect open-circuit calorimetry to study energy expenditure in gnotobiotic mice harboring different human gut microbial communities. Microbiome 2019, 7, 158. [Google Scholar] [CrossRef] [Green Version]
- Suchacki, K.J.; Tavares, A.A.S.; Mattiucci, D.; Scheller, E.L.; Papanastasiou, G.; Gray, C.; Sinton, M.C.; Ramage, L.E.; McDougald, W.A.; Lovdel, A.; et al. Bone marrow adipose tissue is a unique adipose subtype with distinct roles in glucose homeostasis. Nat. Commun. 2020, 11, 3097. [Google Scholar] [CrossRef] [PubMed]
- Flores-Costa, R.; Alcaraz-Quiles, J.; Titos, E.; López-Vicario, C.; Casulleras, M.; Duran-Güell, M.; Rius, B.; Diaz, A.; Hall, K.; Shea, C.; et al. The soluble guanylate cyclase stimulator IW-1973 prevents inflammation and fibrosis in experimental non-alcoholic steatohepatitis. Br. J. Pharmacol. 2017, 175, 953–967. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cox, N.; Crozet, L.; Holtman, I.R.; Loyher, P.-L.; Lazarov, T.; White, J.B.; Mass, E.; Stanley, E.R.; Elemento, O.; Glass, C.K.; et al. Diet-regulated production of PDGFcc by macrophages controls energy storage. Science 2021, 373, eabe9383. [Google Scholar] [CrossRef] [PubMed]
- Jahn, D.; Dorbath, D.; Kircher, S.; Nier, A.; Bergheim, I.; Lenaerts, K.; Hermanns, H.M.; Geier, A. Beneficial Effects of Vitamin D Treatment in an Obese Mouse Model of Non-Alcoholic Steatohepatitis. Nutrients 2019, 11, 77. [Google Scholar] [CrossRef] [Green Version]
- Aßhauer, K.P.; Wemheuer, B.; Daniel, R.; Meinicke, P. Tax4Fun: Predicting functional profiles from metagenomic 16S rRNA data: Fig. 1. Bioinformatics 2015, 31, 2882–2884. [Google Scholar] [CrossRef] [Green Version]
- Bäumler, A.J.; Sperandio, V. Interactions between the microbiota and pathogenic bacteria in the gut. Nature 2016, 535, 85–93. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Serbulea, V.; Upchurch, C.M.; Schappe, M.S.; Voigt, P.; DeWeese, D.E.; Desai, B.N.; Meher, A.K.; Leitinger, N. Macrophage phenotype and bioenergetics are controlled by oxidized phospholipids identified in lean and obese adipose tissue. Proc. Natl. Acad. Sci. USA 2018, 115, E6254–E6263. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Riehle, C.; Bauersachs, J. Of mice and men: Models and mechanisms of diabetic cardiomyopathy. Basic Res. Cardiol. 2018, 114, 2. [Google Scholar] [CrossRef] [Green Version]
- Heydarpour, F.; Sajadimajd, S.; Mirzarazi, E.; Haratipour, P.; Joshi, T.; Farzaei, M.H.; Khan, H.; Echeverría, J. Involvement of TGF-β and Autophagy Pathways in Pathogenesis of Diabetes: A Comprehensive Review on Biological and Pharmacological Insights. Front. Pharmacol. 2020, 11, 498758. [Google Scholar] [CrossRef]
- Barragan, A.; Weidner, J.M.; Jin, Z.; Korpi, E.R.; Birnir, B. GABAergic signalling in the immune system. Acta Physiol. 2015, 213, 819–827. [Google Scholar] [CrossRef]
- Everington, E.A.; Gibbard, A.G.; Swinny, J.D.; Seifi, M. Molecular Characterization of GABA-A Receptor Subunit Diversity within Major Peripheral Organs and Their Plasticity in Response to Early Life Psychosocial Stress. Front. Mol. Neurosci. 2018, 11, 18. [Google Scholar] [CrossRef]
- Man, A.W.; Xia, N.; Daiber, A.; Li, H. The roles of gut microbiota and circadian rhythm in the cardiovascular protective effects of polyphenols. Br. J. Pharmacol. 2019, 177, 1278–1293. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, T.; Li, Q.; Cheng, L.; Buch, H.; Zhang, F. Akkermansia muciniphila is a promising probiotic. Microb. Biotechnol. 2019, 12, 1109–1125. [Google Scholar] [CrossRef] [Green Version]
- Gerritsen, J.; Hornung, B.; Renckens, B.; van Hijum, S.A.; dos Santos, V.A.M.; Rijkers, G.T.; Schaap, P.J.; de Vos, W.M.; Smidt, H. Genomic and functional analysis of Romboutsia ilealis CRIBT reveals adaptation to the small intestine. Peerj 2017, 5, e3698. [Google Scholar] [CrossRef] [Green Version]
- Cypess, A.M.; Weiner, L.S.; Roberts-Toler, C.; Elía, E.F.; Kessler, S.H.; Kahn, P.A.; English, J.; Chatman, K.; Trauger, S.A.; Doria, A.; et al. Activation of Human Brown Adipose Tissue by a β3-Adrenergic Receptor Agonist. Cell Metab. 2015, 21, 33–38. [Google Scholar] [CrossRef]
- Zhao, L.; Zhang, F.; Ding, X.; Wu, G.; Lam, Y.Y.; Wang, X.; Fu, H.; Xue, X.; Lu, C.; Ma, J.; et al. Gut bacteria selectively promoted by dietary fibers alleviate type 2 diabetes. Science 2018, 359, 1151–1156. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Karl, J.P.; Hatch-McChesney, A.; Arcidiacono, S.M.; Pearce, S.C.; Pantoja-Feliciano, I.G.; Doherty, L.A.; Soares, J.W. Effects of Psychological, Environmental and Physical Stressors on the Gut Microbiota. Front. Microbiol. 2018, 9, 2013. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
Ucp1 | GATGGTGAACCCGACAACTTCCGAAGTG | TTCACCTTGGATCTGAAGGCGGACTTTGG |
Prdm16 | TCTACATTCCTGAAGACATTCCAATCCCACCA | TGTATCCGTCAGCATCTCCCATCCAAAGTC |
Cidea | CGAGTTTCAAACCATGACCGAAGTAGCC | CTTACTACCCGGTGTCCATTTCTGTCCC |
Pgc1α | GACAGGTGCCTTCAGTTCACTCTCAG | AGCAGCACACTCTATGT-CACTCCATACAG |
Mct1 | AGGTCCTATCAGCAGTATCT | AGTTCCTGCACCGTGTTACA |
Dio2 | TACAAACAGGTTAAACTGGGTGAAGATGCTC | GAGCCTCATCAATGTATACCAACAGGAAGTC |
F4/80 | GGATGTACAGATGGGGGATG | CATAAGCTGGGCAAGTGGTA |
TNFα | TCCCTCTCATCAGTTCTATGGCCCA | CAGCAAGCATCTATGCACTTAGACCCC |
IL1β | CGGCACACCCACCCTG | AAACCGTTTTTCCATCTTCTTCT |
IL10 | GCTCTTACTGACTGGCATGAG | CGCAGCTCTAGGAGCATGTG |
β-actin | GGCACCACACCTTCTACAATG | GTGGTGGTGAAGCTGTAGCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ma, X.; Yan, H.; Hong, S.; Yu, S.; Gong, Y.; Wu, D.; Li, Y.; Xiao, H. Gamma-Aminobutyric Acid Promotes Beige Adipocyte Reconstruction by Modulating the Gut Microbiota in Obese Mice. Nutrients 2023, 15, 456. https://doi.org/10.3390/nu15020456
Ma X, Yan H, Hong S, Yu S, Gong Y, Wu D, Li Y, Xiao H. Gamma-Aminobutyric Acid Promotes Beige Adipocyte Reconstruction by Modulating the Gut Microbiota in Obese Mice. Nutrients. 2023; 15(2):456. https://doi.org/10.3390/nu15020456
Chicago/Turabian StyleMa, Xiaoyi, Huanhuan Yan, Shubin Hong, Shuang Yu, Yingying Gong, Dide Wu, Yanbing Li, and Haipeng Xiao. 2023. "Gamma-Aminobutyric Acid Promotes Beige Adipocyte Reconstruction by Modulating the Gut Microbiota in Obese Mice" Nutrients 15, no. 2: 456. https://doi.org/10.3390/nu15020456