A Study on the Amelioration of Circadian Rhythm Disorders in Fat Mice Using High-Protein Diets
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Experimental Design and Grouping
2.2. Tissue Collection of Experimental Animals
2.3. Plasma and Tissue Biochemical Analysis
2.4. Antioxidant Levels in Plasma and Tissues
2.5. RNA Extraction and Real-Time PCR Analysis
2.6. Statistical Analyses
3. Results
3.1. Effects of a High-Protein Diet on The Growth Performance of Mice
3.2. Effects of a High-Protein Diet on Liver and Plasma Markers and Circadian Rhythms
3.3. Effects of a High-Protein Diet on the Circadian Rhythm of Liver Lipid Metabolism Genes
3.4. Effects of a High-Protein Diet on the Circadian Rhythm of Redox Status in Mice
3.5. Effects of a High-Protein Diet on the Circadian Rhythms of Hepatic H2S Levels and Transsulfuration Pathway-Related Gene Expressions
3.6. Effects of a High-Protein Diet on the Circadian Rhythm Changes in Liver CLOCK Genes and Lipid Metabolism Genes
4. Discussion
- CLOCK and BMAL1, which bind to form a CLOCK–BMAL1 heterodimer and regulate peroxisome proliferator-activated receptor α (PPARα); this complex trans-activates PPARα, which controls the expression of the lipolytic target genes HSL and ACOX [40,41] that are involved in regulating lipid metabolism homeostasis. PPARα positively regulates its transcription by binding to the PPARα response element on the BMAL1 gene promoter [42]; in contrast, PER2 and CRY proteins can interact directly with CLOCK and BMAL1 to inhibit CLOCK–BMAL1 heterodimer activity and suppress PER2 and CRY transcription, thus completing the self-negative feedback regulatory loop [43,44];
- The BMAL1 promoter is associated with retinoic acid-related orphan receptor α (RORα) and the orphan nuclear hormone receptor α (reverse viral erythroblastosis oncogene product (REV-ERBα). These bind to the ROR response element, activating and blocking BMAL1 transcription. The nuclear receptor REV-ERBα inhibits the expression of insulin-induced gene 2 (INSIG2), which deregulates the shearing and activation of the lipid metabolism transcription factor SREBP-1C to maintain lipid droplet morphology [45,46]; additionally, SREBP-1C promotes the expression of ACC and FAS [47], key enzymes for the de novo synthesis of fatty acids. Furthermore, the activation of PPARα by fatty acids contributes to its involvement in the circadian rhythm of fatty acid oxidative metabolism.
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Roberto, C.A.; Swinburn, B.; Hawkes, C.; Huang, T.T.-K.; Costa, A.S.; Ashe, M.; Zwicker, L.; Cawley, J.H.; Brownell, K.D. Patchy progress on obesity prevention: Emerging examples, entrenched barriers, and new thinking. Lancet 2015, 385, 2400–2409. [Google Scholar] [CrossRef] [PubMed]
- Bhupathiraju, S.N.; Hu, F.B. Epidemiology of Obesity and Diabetes and Their Cardiovascular Complications. Circ. Res. 2016, 118, 1723–1735. [Google Scholar] [CrossRef] [PubMed]
- Wilson, R.A.; Deasy, W.; Hayes, A.; Cooke, M.B. High fat diet and associated changes in the expression of micro-RNAS in tissue: Lessons learned from animal studies. Mol. Nutr. Food Res. 2017, 61, 1600943. [Google Scholar] [CrossRef] [PubMed]
- Zeng, Q.; Li, N.; Pan, X.F.; Chen, L.; Pan, A. Clinical management and treatment of obesity in China. Lancet Diabetes Endocrinol. 2021, 9, 393–405. [Google Scholar] [CrossRef] [PubMed]
- Piaggi, P.; Vinales, K.L.; Basolo, A.; Santini, F.; Krakoff, J. Energy expenditure in the etiology of human obesity: Spendthrift and thrifty metabolic phenotypes and energy-sensing mechanisms. J. Endocrinol. Investig. 2018, 41, 83–89. [Google Scholar] [CrossRef]
- Sato, T.; Greco, C.M. Expanding the link between circadian rhythms and redox metabolism of epigenetic control. Free Radic. Biol. Med. 2021, 170, 50–58. [Google Scholar] [CrossRef]
- Zhou, D.; Wang, Y.; Chen, L.; Jia, L.; Yuan, J.; Sun, M.; Zhang, W.; Wang, P.; Zuo, J.; Xu, Z.; et al. Evolving roles of circadian rhythms in liver homeostasis and pathology. Oncotarget 2016, 7, 8625–8639. [Google Scholar] [CrossRef]
- Panda, S.; Hogenesch, J.B.; Kay, S.A. Circadian rhythms from flies to human. Nature 2002, 417, 329–335. [Google Scholar] [CrossRef]
- Reppert, S.M.; Weaver, D.R. Coordination of circadian timing in mammals. Nature 2002, 418, 935–941. [Google Scholar] [CrossRef]
- Chen, R.L.; Ruan, M.C.; Chen, S.; Tian, Y.; Wang, H.L.; Li, N.; Zhang, J.L.; Yu, X.L.; Liu, Z.G. Circadian dysregulation disrupts gut microbe-related bile acid metabolism. Food Nutr. Res. 2022, 66, 1–13. [Google Scholar] [CrossRef]
- Yamajuku, D.; Okubo, S.; Haruma, T.; Inagaki, T.; Okuda, Y.; Kojima, T.; Noutomi, K.; Hashimoto, S.; Oda, H. Regular Feeding Plays an Important Role in Cholesterol Homeostasis Through the Liver Circadian Clock. Circ. Res. 2009, 105, 545–548. [Google Scholar] [CrossRef]
- Sato, F.; Kohsaka, A.; Bhawal, U.K.; Muragaki, Y. Potential Roles of Dec and Bmal1 Genes in Interconnecting Circadian Clock and Energy Metabolism. Int. J. Mol. Sci. 2018, 19, 781–795. [Google Scholar] [CrossRef]
- Budkowska, M.; Cecerska-Heryc, E.; Marcinowska, Z.; Siennicka, A.; Dolegowska, B. The Influence of Circadian Rhythm on the Activity of Oxidative Stress Enzymes. Int. J. Mol. Sci. 2022, 23, 14275. [Google Scholar] [CrossRef]
- Ch, R.; Rey, G.; Ray, S.; Jha, P.K.; Driscoll, P.C.; Dos Santos, M.S.; Malik, D.M.; Lach, R.; Weljie, A.M.; MacRae, J.I.; et al. Rhythmic glucose metabolism regulates the redox circadian clockwork in human red blood cells. Nat. Commun. 2021, 12, 377. [Google Scholar] [CrossRef]
- Reinke, H.; Asher, G. Crosstalk between metabolism and circadian clocks. Nat. Rev. Mol. Cell Biol. 2019, 20, 227–241. [Google Scholar] [CrossRef]
- Gooley, J.J. Circadian regulation of lipid metabolism. Proc. Nutr. Soc. 2016, 75, 440–450. [Google Scholar] [CrossRef]
- Zhong, W.L.; Wang, H.; Yang, Y.; Zhang, Y.L.; Lai, H.J.; Cheng, Y.L.; Yu, H.M.; Feng, N.; Huang, R.; Liu, S.; et al. High-protein diet prevents fat mass increase after dieting by counteracting Lactobacillus-enhanced lipid absorption. Nat. Metab. 2022, 4, 1713–1731. [Google Scholar] [CrossRef]
- Dashti, H.M.; Mathew, T.C.; Hussein, T.; Asfar, S.K.; Behbahani, A.; Khoursheed, M.A.; Al-Sayer, H.M.; Bo-Abbas, Y.Y.; Al-Zaid, N.S. Long-term effects of a ketogenic diet in obese patients. Exp. Clin. Cardiol. 2004, 9, 200–205. [Google Scholar]
- Ren, H.Y.; Liu, T.C.; Lu, Y.P.; Zhang, K.; Xu, Y.; Zhou, P.; Tang, X. A comparison study of the influence of milk protein versus whey protein in high-protein diets on adiposity in rats. Food Funct. 2021, 12, 1008–1019. [Google Scholar] [CrossRef]
- Zhang, B.; Chu, L.; Liu, H.; Xie, C.; Qiao, S.; Zeng, X. Leucine Supplementation in a Chronically Protein-Restricted Diet Enhances Muscle Weight and Postprandial Protein Synthesis of Skeletal Muscle by Promoting the mTOR Pathway in Adult Rats. Engineering 2017, 3, 760–765. [Google Scholar] [CrossRef]
- Chaumontet, C.; Even, P.C.; Schwarz, J.; Simonin-Foucault, A.; Piedcoq, J.; Fromentin, G.; Azzout-Marniche, D.; Tome, D. High dietary protein decreases fat deposition induced by high-fat and high-sucrose diet in rats. Br. J. Nutr. 2015, 114, 1132–1142. [Google Scholar] [CrossRef] [PubMed]
- Moon, J.; Koh, G. Clinical Evidence and Mechanisms of High-Protein Diet-Induced Weight Loss. J. Obes. Metab. Syndr. 2020, 29, 166–173. [Google Scholar] [CrossRef] [PubMed]
- Higashida, K.; Terada, S.; Li, X.; Inoue, S.; Iida, N.; Kitai, S.; Nakai, N. Low-carbohydrate high-protein diet diminishes the insulin response to glucose load via suppression of SGLT-1 in mice. Biosci. Biotechnol. Biochem. 2019, 83, 365–371. [Google Scholar] [CrossRef] [PubMed]
- Lobley, G.E.; Holtrop, G.; Horgan, G.W.; Bremner, D.M.; Fyfe, C.; Johnstone, A.M. Responses in gut hormones and hunger to diets with either high protein or a mixture of protein plus free amino acids supplied under weight-loss conditions. Br. J. Nutr. 2015, 113, 1254–1270. [Google Scholar] [CrossRef] [PubMed]
- Schwarz, J.; Tome, D.; Baars, A.; Hooiveld, G.J.E.J.; Muller, M. Dietary Protein Affects Gene Expression and Prevents Lipid Accumulation in the Liver in Mice. PLoS ONE 2012, 7, e47303. [Google Scholar] [CrossRef]
- Uebanso, T.; Taketani, Y.; Fukaya, M.; Sato, K.; Takei, Y.; Sato, T.; Sawada, N.; Amo, K.; Harada, N.; Arai, H.; et al. Hypocaloric high-protein diet improves fatty liver and hypertriglyceridemia in sucrose-fed obese rats via two pathways. Am. J. Physiol.-Endoc. 2009, 297, E76–E84. [Google Scholar] [CrossRef]
- Petrus, P.; Cervantes, M.; Samad, M.; Sato, T.; Chao, A.; Sato, S.; Koronowski, K.B.; Park, G.; Alam, Y.; Mejhert, N.; et al. Tryptophan metabolism is a physiological integrator regulating circadian rhythms. Mol. Metab. 2022, 64, 101556. [Google Scholar] [CrossRef]
- Corsello, T.; Komaravelli, N.; Casola, A. Role of Hydrogen Sulfide in NRF2- and Sirtuin-Dependent Maintenance of Cellular Redox Balance. Antioxidants 2018, 7, 129–139. [Google Scholar] [CrossRef]
- Wojcik, J.L.; Devassy, J.G.; Wu, Y.; Zahradka, P.; Taylor, C.G.; Aukema, H.M. Protein source in a high-protein diet modulates reductions in insulin resistance and hepatic steatosis in fa/fa Zucker rats. Obesity 2016, 24, 123–131. [Google Scholar] [CrossRef]
- Pesta, D.H.; Samuel, V.T. A high-protein diet for reducing body fat: Mechanisms and possible caveats. Nutr. Metab. 2014, 11, 1–17. [Google Scholar] [CrossRef]
- Tong, X.; Yin, L. Circadian Rhythms in Liver Physiology and Liver Diseases. Compr. Physiol. 2013, 3, 917–940. [Google Scholar] [CrossRef]
- Shetty, A.; Hsu, J.W.; Manka, P.P.; Syn, W.K. Role of the Circadian Clock in the Metabolic Syndrome and Nonalcoholic Fatty Liver Disease. Dig. Dis. Sci. 2018, 63, 3187–3206. [Google Scholar] [CrossRef]
- Afshin, A.; Forouzanfar, M.H.; Reitsma, M.B.; Sur, P.; Estep, K.; Lee, A.; Marczak, L.; Mokdad, A.H.; Moradi-Lakeh, M.; Naghavi, M.; et al. Health Effects of Overweight and Obesity in 195 Countries over 25 Years. N. Engl. J. Med. 2017, 377, 13–27. [Google Scholar] [CrossRef]
- Das, T.K.; Javadzadeh, A.; Dey, A.; Sabesan, P.; Theberge, J.; Radua, J.; Palaniyappan, L. Antioxidant defense in schizophrenia and bipolar disorder: A meta-analysis of MRS studies of anterior cingulate glutathione. Prog. Neuro-Psychoph. 2019, 91, 94–102. [Google Scholar] [CrossRef]
- Zhang, C.Y.; Wang, R.Y.; Cheng, L.H.; Li, B.J.; Xi, Z.; Yi, L. A Redox-Nucleophilic Dual-Reactable Probe for Highly Selective and Sensitive Detection of H2S: Synthesis, Spectra and Bioimaging. Sci. Rep. 2016, 6, 30148. [Google Scholar] [CrossRef]
- Manella, G.; Sabath, E.; Aviram, R.; Dandavate, V.; Ezagouri, S.; Golik, M.; Adamovich, Y.; Asher, G. The liver-clock coordinates rhythmicity of peripheral tissues in response to feeding. Nat. Metab. 2021, 3, 829–842. [Google Scholar] [CrossRef]
- Escalante-Covarrubias, Q.; Mendoza-Viveros, L.; Gonzalez-Suarez, M.; Sitten-Olea, R.; Velazquez-Villegas, L.A.; Becerril-Perez, F.; Pacheco-Bernal, I.; Carreno-Vazquez, E.; Mass-Sanchez, P.; Bustamante-Zepeda, M.; et al. Time-of-day defines NAD(+) efficacy to treat diet-induced metabolic disease by synchronizing the hepatic clock in mice. Nat. Commun. 2023, 14, 1685. [Google Scholar] [CrossRef]
- Shi, D.M.; Chen, J.; Wang, J.F.; Yao, J.F.; Huang, Y.Q.; Zhang, G.S.; Bao, Z.J. Circadian Clock Genes in the Metabolism of Non-alcoholic Fatty Liver Disease. Front. Physiol. 2019, 10, 423. [Google Scholar] [CrossRef]
- Schibler, U.; Ripperger, J.; Brown, S.A. Peripheral circadian oscillators in mammals: Time and food. J. Biol. Rhythm. 2003, 18, 250–260. [Google Scholar] [CrossRef]
- Oishi, K.; Shirai, H.; Ishida, N. CLOCK is involved in the circadian transactivation of peroxisome-proliferator-activated receptor α (PPARα) in mice. Biochem. J. 2005, 386, 575–581. [Google Scholar] [CrossRef] [PubMed]
- Badman, M.K.; Pissios, P.; Kennedy, A.R.; Koukos, G.; Maratos-Flier, E. Hepatic Fibroblast Growth Factor 21 Is Regulated by PPAR?? and Is a Key Mediator of Hepatic Lipid Metabolism in Ketotic States. Cell Metab. 2007, 5, 426–437. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Yang, G. PPARs Integrate the Mammalian Clock and Energy Metabolism. Ppar Res. 2014, 2014, 653017. [Google Scholar] [CrossRef] [PubMed]
- Zylka, M.J.; Shearman, L.P.; Weaver, D.R.; Reppert, S.M. Three period homologs in mammals: Differential light responses in the suprachiasmatic circadian clock and oscillating transcripts outside of brain. Neuron 1998, 20, 1103–1110. [Google Scholar] [CrossRef]
- Froy, O.; Chang, D.C.; Reppert, S.M. Redox potential: Differential roles in dCRY and mCRY1 functions. Curr. Biol. 2002, 12, 147–152. [Google Scholar] [CrossRef]
- Martelot, G.L.; Claudel, T.; Gatfield, D.; Schaad, O.; Sasso, G.L. REV-ERBalpha participates in circadian SREBP signaling and bile acid homeostasis. PLoS Biol. 2009, 7, e1000181. [Google Scholar] [CrossRef]
- Zhang, Y.; Papazyan, R.; Damle, M.; Fang, B.; Jager, J.; Feng, D.; Peed, L.C.; Guan, D.; Sun, Z.; Lazar, M.A. The hepatic circadian clock fine-tunes the lipogenic response to feeding through RORα/γ. Genes. Dev. 2017, 31, 1202–1211. [Google Scholar] [CrossRef]
- Shimano, H.; Yahagi, N.; Amemiya-Kudo, M.; Hasty, A.H.; Osuga, J.; Tamura, Y.; Shionoiri, F.; Iizuka, Y.; Ohashi, K.; Harada, K.; et al. Sterol regulatory element-binding protein-1 as a key transcription factor for nutritional induction of lipogenic enzyme genes. J. Biol. Chem. 1999, 274, 35832–35839. [Google Scholar] [CrossRef]







| Composition (g/kg) | CON Group | HF-LP Group | HF-HP Group |
|---|---|---|---|
| Milk protein concentrate | 165.0 | 206.0 | 412.0 |
| Sucrose | 91.1 | 91.1 | 91.1 |
| Corn starch | 466.1 | 235.4 | 29.4 |
| Maltodextrin | 125.0 | 125.0 | 125.0 |
| Soya bean oil | 20.0 | 20.0 | 20.0 |
| Lard | 20.0 | 210.0 | 210.0 |
| Mineral mixture | 50.0 | 50.0 | 50.0 |
| Vitamin mixture | 10.0 | 10.0 | 10.0 |
| Cellulose | 40.0 | 40.0 | 40.0 |
| Sodium carboxymethyl cellulose | 10.0 | 10.0 | 10.0 |
| Choline bitartrate | 2.5 | 2.5 | 2.5 |
| Total | 1000 | 1000 | 1000 |
| Protein/% | 17 | 17 | 35 |
| Fat/% | 10 | 44 | 44 |
| Carbohydrate/% | 73 | 39 | 21 |
| Gene | Upstream Primer (5′−3′) | Downstream Primer (3′−5′) |
|---|---|---|
| β-actin | GTGACGTTGACATCCGTAAAGA | GCCGGACTCATCGTACTCC |
| ACC | GGCAGCAGTTACACCACATAC | TCATTACCTCAATCTCAGCATAGC |
| FAS | ATGCTGTGGATCTGGGCTGTC | CAGTTTCACGAACCCGCCTC |
| HSL | AGACCACATCGCCCACA | CCTTTATTGTCAGCTTCTTCAAGG |
| ACOX | TCGAAGCCAGCGTTACGAG | ATCTCCGTCTGGGCGTAGG |
| SCD | TCATCCCATCGCCTGCTCTACCC | TGGTGTAGGCGAGTGGCGGAA |
| PPARα | ATGGAGACCTTGTGTATGG | ATCTGGATGGTTGCTCTG |
| CBS | CCAGGCACCTGTGGTCAAC | GGTCTCGTGATTGGATCTGCT |
| CSE | TTCCTGCCTAGTTTCCAGCAT | GGAAGTCCTGCTTAAATGTGGTG |
| NRF2 | CTGAACTCCTGGACGGGACTA | CGGTGGGTCTCCGTAAATGG |
| GCLM | AGGAGCTTCGGGACTGTATCC | GGAAACTCCCTGACTAAATCGG |
| CLOCK | AGCACACACACTTCCTCTCTGACAT | ATCAAGGGACTGAACACTCAAGACC |
| BMAL1 | AGTCAGATTGAAAAGAGGCGTCG | AGAAATGTTGGCTTGTAGTTTGCTT |
| PER2 | TTCTCTGCTGTTCTTGTATCCTTTT | GCTTTCTGCTGGGAGCTAATG |
| CRY | CACTGGTTCCGAAAGGGACTC | CTGAAGCAAAAATCGCCACCT |
| CON | HF-LP | HF-HP | |
|---|---|---|---|
| Final body weight/g | 27.70 ± 1.60 | 34.20 ± 2.30 ** | 31.70 ± 2.50 ## |
| Energy intake/(kJ/d) | 45.62 ± 1.28 | 54.18 ± 3.82 ** | 57.75 ± 3.78 |
| Liver ratio/% | 3.42 ± 0.16 | 3.58 ± 0.23 | 3.46 ± 0.29 |
| Fat ratio/% | 2.70 ± 0.46 | 4.86 ± 0.98 ** | 3.85 ± 0.72 ## |
| Muscle index/% | 6.45 ± 0.45 | 5.98 ± 0.75 ** | 6.36 ± 0.50 ## |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Deng, G.; Jiang, Z.; Lu, H.; Lu, N.; Zhu, R.; Zhu, C.; Zhou, P.; Tang, X. A Study on the Amelioration of Circadian Rhythm Disorders in Fat Mice Using High-Protein Diets. Nutrients 2023, 15, 3459. https://doi.org/10.3390/nu15153459
Deng G, Jiang Z, Lu H, Lu N, Zhu R, Zhu C, Zhou P, Tang X. A Study on the Amelioration of Circadian Rhythm Disorders in Fat Mice Using High-Protein Diets. Nutrients. 2023; 15(15):3459. https://doi.org/10.3390/nu15153459
Chicago/Turabian StyleDeng, Guoliang, Zhiqing Jiang, Hui Lu, Naiyan Lu, Rongxiang Zhu, Chengkai Zhu, Peng Zhou, and Xue Tang. 2023. "A Study on the Amelioration of Circadian Rhythm Disorders in Fat Mice Using High-Protein Diets" Nutrients 15, no. 15: 3459. https://doi.org/10.3390/nu15153459
APA StyleDeng, G., Jiang, Z., Lu, H., Lu, N., Zhu, R., Zhu, C., Zhou, P., & Tang, X. (2023). A Study on the Amelioration of Circadian Rhythm Disorders in Fat Mice Using High-Protein Diets. Nutrients, 15(15), 3459. https://doi.org/10.3390/nu15153459

