Bacteroides fragilis Supplementation Deteriorated Metabolic Dysfunction, Inflammation, and Aorta Atherosclerosis by Inducing Gut Microbiota Dysbiosis in Animal Model
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Group and Intervention
2.2. Strain Recovery and Isolation Culture
2.3. Specimen Collection and Processing
2.4. Biochemical Assays in Plasma
2.5. Aortic Staining with Oil Red
2.6. Sampling DNA Extraction, 16S rDNA Cloning Library Construction and Sequencing
2.7. Gut Microbiota Bioinformatics Analysis
2.8. Inflammatory Factors Detected by qRT-PCR
2.9. Statistical Analysis
3. Results
3.1. Diet and Drinking Water
3.2. Fasting Blood Glucose
3.3. Body/Heart Weight and Cardiac Systolic Function
3.4. Blood Lipid Level
3.5. Aorta Atherosclerotic Lesion
3.6. Inflammatory Marker Expression
3.7. Total Bacterial Abundance and Diversity
3.8. Gut Microbial Abundance Changes
3.8.1. Bacteroidaceae Abundance
3.8.2. Lactobacillaceae Abundance
3.8.3. Desulfovibrionaceae Abundance
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Eckburg, P.B.; Bik, E.M.; Bernstein, C.N.; Purdom, E.; Dethlefsen, L.; Sargent, M.; Gill, S.R.; Nelson, K.E.; Relman, D.A. Diversity of the human intestinal microbial flora. Science 2005, 308, 1635–1638. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Suchodolski, J.S.; Ruaux, C.G.; Steiner, J.M.; Fetz, K.; Williams, D.A. Assessment of the qualitative variation in bacterial microflora among compartments of the intestinal tract of dogs by use of a molecular fingerprinting technique. Am. J. Vet. Res. 2005, 66, 1556–1562. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Conte, M.P.; Schippa, S.; Zamboni, I.; Penta, M.; Chiarini, F.; Seganti, L.; Osborn, J.; Falconieri, P.; Borrelli, O.; Cucchiara, S. Gut-associated bacterial microbiota in paediatric patients with inflammatory bowel disease. Gut 2006, 55, 1760–1767. [Google Scholar] [CrossRef] [Scilit]
- Emoto, T.; Hayashi, T.; Tabata, T.; Yamashita, T.; Watanabe, H.; Takahashi, T.; Gotoh, Y.; Kami, K.; Yoshida, N.; Saito, Y.; et al. Metagenomic analysis of gut microbiota reveals its role in trimethylamine metabolism in heart failure. Int. J. Cardiol. 2021, 338, 138–142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karlsson, C.L.; Onnerfält, J.; Xu, J.; Molin, G.; Ahrné, S.; Thorngren-Jerneck, K. The microbiota of the gut in preschool children with normal and excessive body weight. Obesity 2012, 20, 2257–2261. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Valdes, A.M.; Walter, J.; Segal, E.; Spector, T.D. Role of the gut microbiota in nutrition and health. BMJ 2018, 361, k2179. [Google Scholar] [CrossRef] [Scilit]
- Mendelsohn, A.R.; Larrick, J.W. Dietary modification of the microbiome affects risk for cardiovascular disease. Rejuvenation Res. 2013, 16, 241–244. [Google Scholar] [CrossRef] [Scilit]
- Duncan, S.H.; Lobley, G.E.; Holtrop, G.; Ince, J.; Johnstone, A.M.; Louis, P.; Flint, H.J. Human colonic microbiota associated with diet, obesity and weight loss. Int. J. Obes. 2008, 32, 1720–1724. [Google Scholar] [CrossRef] [Scilit]
- Li, D.Y.; Tang, W.H.W. Gut Microbiota and Atherosclerosis. Curr. Atheroscler. Rep. 2017, 19, 39. [Google Scholar] [CrossRef] [Scilit]
- Emoto, T.; Yamashita, T.; Sasaki, N.; Hirota, Y.; Hayashi, T.; So, A.; Kasahara, K.; Yodoi, K.; Matsumoto, T.; Mizoguchi, T.; et al. Analysis of Gut Microbiota in Coronary Artery Disease Patients: A Possible Link between Gut Microbiota and Coronary Artery Disease. J. Atheroscler. Thromb. 2016, 23, 908–921. [Google Scholar] [CrossRef] [Scilit]
- Jie, Z.; Xia, H.; Zhong, S.-L.; Feng, Q.; Li, S.; Liang, S.; Zhong, H.; Liu, Z.; Gao, Y.; Zhao, H.; et al. The gut microbiome in atherosclerotic cardiovascular disease. Nat. Commun. 2017, 8, 845. [Google Scholar] [CrossRef] [Scilit]
- Qin, J.; Li, R.; Raes, J.; Arumugam, M.; Burgdorf, K.S.; Manichanh, C.; Nielsen, T.; Pons, N.; Levenez, F.; Yamada, T.; et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature 2010, 464, 59–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bäckhed, F.; Manchester, J.K.; Semenkovich, C.F.; Gordon, J.I. Mechanisms underlying the resistance to diet-induced obesity in germ-free mice. Proc. Natl. Acad. Sci. USA 2007, 104, 979–984. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, T.; Gao, J.; Du, M.; Mao, X. Milk fat globule membrane supplementation modulates the gut microbiota and attenuates metabolic endotoxemia in high-fat diet-fed mice. J. Funct. Foods 2018, 47, 56–65. [Google Scholar] [CrossRef] [Scilit]
- Sun, F.; Zhang, Q.; Zhao, J.; Zhang, H.; Zhai, Q.; Chen, W. A potential species of next-generation probiotics? The dark and light sides of Bacteroides fragilis in health. Food Res. Int. 2019, 126, 108590. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Xu, H.; Sun, Z.; Hou, Q.; Kwok, L.-Y.; Laga, W.; Wang, Y.; Ma, H.; Yu, Z.; Menghe, B.; et al. Effect of dietary interventions on the intestinal microbiota of Mongolian hosts. Sci. Bull. 2016, 61, 1605–1614. [Google Scholar] [CrossRef] [Scilit]
- Child, J.; Chen, X.; Mistry, R.D.; Somme, S.; MacBrayne, C.; Anderson, P.L.; Jones, R.N.; Parker, S.K. Pharmacokinetic and Pharmacodynamic Properties of Metronidazole in Pediatric Patients With Acute Appendicitis: A Prospective Study. J. Pediatric Infect. Dis. Soc. 2019, 8, 297–302. [Google Scholar] [CrossRef] [Scilit]
- Dejea, C.M.; Fathi, P.; Craig, J.M.; Boleij, A.; Taddese, R.; Geis, A.L.; Wu, X.; DeStefano Shields, C.E.; Hechenbleikner, E.M.; Huso, D.L.; et al. Patients with familial adenomatous polyposis harbor colonic biofilms containing tumorigenic bacteria. Science 2018, 359, 592–597. [Google Scholar] [CrossRef] [Scilit]
- Kalyana Chakravarthy, S.; Jayasudha, R.; Ranjith, K.; Dutta, A.; Pinna, N.K.; Mande, S.S.; Sharma, S.; Garg, P.; Murthy, S.I.; Shivaji, S. Alterations in the gut bacterial microbiome in fungal Keratitis patients. PLoS ONE 2018, 13, e0199640. [Google Scholar] [CrossRef] [Scilit]
- Walters, S.S.; Quiros, A.; Rolston, M.; Grishina, I.; Li, J.; Fenton, A.; DeSantis, T.Z.; Thai, A.; Andersen, G.L.; Papathakis, P.; et al. Analysis of Gut Microbiome and Diet Modification in Patients with Crohn’s Disease. SOJ Microbiol. Infect. Dis. 2014, 2, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Ignacio, A.; Fernandes, M.R.; Rodrigues, V.A.A.; Groppo, F.C.; Cardoso, A.L.; Avila-Campos, M.J.; Nakano, V. Correlation between body mass index and faecal microbiota from children. Clin. Microbiol. Infect. 2016, 22, e251–e258. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nikitina, A.S.; Kharlampieva, D.D.; Babenko, V.V.; Shirokov, D.A.; Vakhitova, M.T.; Manolov, A.I.; Shkoporov, A.; Taraskina, A.E.; Manuvera, V.A.; Lazarev, V.N.; et al. Complete Genome Sequence of an Enterotoxigenic Bacteroides fragilis Clinical Isolate. Genome Announc. 2015, 3, e00450-15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hecht, A.L.; Casterline, B.W.; Choi, V.M.; Bubeck Wardenburg, J. A Two-Component System Regulates Bacteroides fragilis Toxin to Maintain Intestinal Homeostasis and Prevent Lethal Disease. Cell Host Microbe 2017, 22, 443–448.e445. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rhee, K.-J.; Wu, S.; Wu, X.; Huso, D.L.; Karim, B.; Franco, A.A.; Rabizadeh, S.; Golub, J.E.; Mathews, L.E.; Shin, J.; et al. Induction of persistent colitis by a human commensal, enterotoxigenic Bacteroides fragilis, in wild-type C57BL/6 mice. Infect. Immun. 2009, 77, 1708–1718. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, S.; Rhee, K.J.; Zhang, M.; Franco, A.; Sears, C.L. Bacteroides fragilis toxin stimulates intestinal epithelial cell shedding and gamma-secretase-dependent E-cadherin cleavage. J. Cell Sci. 2007, 120, 1944–1952. [Google Scholar] [CrossRef] [Scilit]
- Tomkovich, S.; Jobin, C. Microbial networking in cancer: When two toxins collide. Br. J. Cancer 2018, 118, 1407–1409. [Google Scholar] [CrossRef] [Scilit]
- Wick, E.C.; Rabizadeh, S.; Albesiano, E.; Wu, X.; Wu, S.; Chan, J.; Rhee, K.-J.; Ortega, G.; Huso, D.L.; Pardoll, D.; et al. Stat3 activation in murine colitis induced by enterotoxigenic Bacteroides fragilis. Inflamm. Bowel Dis. 2014, 20, 821–834. [Google Scholar] [CrossRef] [Scilit]
- Lukiw, W.J. Bacteroides fragilis Lipopolysaccharide and Inflammatory Signaling in Alzheimer’s Disease. Front. Microbiol. 2016, 7, 1544. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Y.; Lukiw, W.J. Bacteroidetes Neurotoxins and Inflammatory Neurodegeneration. Mol. Neurobiol. 2018, 55, 9100–9107. [Google Scholar] [CrossRef] [Scilit]
- Erridge, C.; Spickett, C.M.; Webb, D.J. Non-enterobacterial endotoxins stimulate human coronary artery but not venous endothelial cell activation via Toll-like receptor 2. Cardiovasc. Res. 2007, 73, 181–189. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Li, X.; Song, Y.; Wang, Z. MicroRNA-217 attenuates intima-media complex thickness of ascending aorta measured by ultrasound bio-microscopy and inhibits inflammation and lipid metabolism in atherosclerotic models of ApoE(-/-) mice. Lipids Health Dis. 2018, 17, 170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kong, Y.-Y.; Li, G.-Q.; Zhang, W.-J.; Hua, X.; Zhou, C.-C.; Xu, T.-Y.; Li, Z.-Y.; Wang, P.; Miao, C.-Y. Nicotinamide phosphoribosyltransferase aggravates inflammation and promotes atherosclerosis in ApoE knockout mice. Acta Pharmacol. Sin. 2019, 40, 1184–1192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Merino, V.F.; Todiras, M.; Mori, M.A.; Sales, V.M.T.; Fonseca, R.G.; Saul, V.; Tenner, K.; Bader, M.; Pesquero, J.B. Predisposition to atherosclerosis and aortic aneurysms in mice deficient in kinin B1 receptor and apolipoprotein E. J. Mol. Med. 2009, 87, 953–963. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shibata, M.-A.; Shibata, E.; Maemura, K.; Kondo, Y.; Harada-Shiba, M. Pathological and molecular analyses of atherosclerotic lesions in ApoE-knockout mice. Med. Mol. Morphol. 2017, 50, 130–144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van den Munckhof, I.C.L.; Kurilshikov, A.; Ter Horst, R.; Riksen, N.P.; Joosten, L.A.B.; Zhernakova, A.; Fu, J.; Keating, S.T.; Netea, M.G.; De Graaf, J.; et al. Role of gut microbiota in chronic low-grade inflammation as potential driver for atherosclerotic cardiovascular disease: A systematic review of human studies. Obes. Rev. 2018, 19, 1719–1734. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nagata, S.; Chiba, Y.; Wang, C.; Yamashiro, Y. The effects of the Lactobacillus casei strain on obesity in children: A pilot study. Benef. Microbes 2017, 8, 535–543. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roediger, W.E.; Moore, J.; Babidge, W. Colonic sulfide in pathogenesis and treatment of ulcerative colitis. Dig. Dis. Sci. 1997, 42, 1571–1579. [Google Scholar] [CrossRef] [Scilit]
- Santas, J.; Espadaler, J.; Mancebo, R.; Rafecas, M. Selective in vivo effect of chitosan on fatty acid, neutral sterol and bile acid excretion: A longitudinal study. Food Chem. 2012, 134, 940–947. [Google Scholar] [CrossRef] [Scilit]
- Kang, Y.M.; Lee, B.-J.; Kim, J.I.; Nam, B.-H.; Cha, J.-Y.; Kim, Y.-M.; Ahn, C.-B.; Choi, J.-S.; Choi, I.S.; Je, J.-Y. Antioxidant effects of fermented sea tangle (Laminaria japonica) by Lactobacillus brevis BJ20 in individuals with high level of γ-GT: A randomized, double-blind, and placebo-controlled clinical study. Food Chem. Toxicol. 2012, 50, 1166–1169. [Google Scholar] [CrossRef] [Scilit]
- Kullisaar, T.; Songisepp, E.; Mikelsaar, M.; Zilmer, K.; Vihalemm, T.; Zilmer, M. Antioxidative probiotic fermented goats’ milk decreases oxidative stress-mediated atherogenicity in human subjects. Br. J. Nutr. 2003, 90, 449–456. [Google Scholar] [CrossRef] [Scilit]
- Paik, H.D.; Park, J.S.; Park, E. Effects of Bacillus polyfermenticus SCD on lipid and antioxidant metabolisms in rats fed a high-fat and high-cholesterol diet. Biol. Pharm. Bull. 2005, 28, 1270–1274. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X.; Coker, O.O.; Chu, E.S.; Fu, K.; Lau, H.C.H.; Wang, Y.-X.; Chan, A.W.H.; Wei, H.; Yang, X.; Sung, J.J.Y.; et al. Dietary cholesterol drives fatty liver-associated liver cancer by modulating gut microbiota and metabolites. Gut 2021, 70, 761–774. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.-H.; Wang, Y.-C.; Chiu, C.-C.; Lee, Y.-P.; Hung, S.-W.; Huang, C.-C.; Chiu, C.-F.; Chen, T.-H.; Huang, W.-C. Housing condition-associated changes in gut microbiota further affect the host response to diet-induced nonalcoholic fatty liver. J. Nutr. Biochem. 2020, 79, 108362. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hulin, S.J.; Singh, S.; Chapman, M.A.S.; Allan, A.; Langman, M.J.S.; Eggo, M.C. Sulphide-induced energy deficiency in colonic cells is prevented by glucose but not by butyrate. Aliment. Pharmacol. Ther. 2002, 16, 325–331. [Google Scholar] [CrossRef] [Scilit]
- Bisson-Boutelliez, C.; Massin, F.; Dumas, D.; Miller, N.; Lozniewski, A. Desulfovibrio spp. survive within KB cells and modulate inflammatory responses. Mol. Oral Microbiol. 2010, 25, 226–235. [Google Scholar] [CrossRef] [Scilit]
- Xu, C.; Liu, J.; Gao, J.; Wu, X.; Cui, C.; Wei, H.; Zheng, R.; Peng, J. Combined Soluble Fiber-Mediated Intestinal Microbiota Improve Insulin Sensitivity of Obese Mice. Nutrients 2020, 12, 351. [Google Scholar] [CrossRef] [Scilit]
- Van Hecke, T.; De Vrieze, J.; Boon, N.; De Vos, W.H.; Vossen, E.; De Smet, S. Combined Consumption of Beef-Based Cooked Mince and Sucrose Stimulates Oxidative Stress, Cardiac Hypertrophy, and Colonic Outgrowth of Desulfovibrionaceae in Rats. Mol. Nutr. Food Res. 2019, 63, e1800962. [Google Scholar] [CrossRef] [Scilit]





| Primer Sequence | |
|---|---|
| 520F2 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTACGATGCTAYTGGGYDTAAAGNG |
| 520F3 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAGACTGTCAYTGGGYDTAAAGNG |
| 520F4 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAGCATCGTAYTGGGYDTAAAGNG |
| 520F5 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTATCGTAGCAYTGGGYDTAAAGNG |
| 520F8 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCGTAGCATAYTGGGYDTAAAGNG |
| 520F9 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCTACGATGAYTGGGYDTAAAGNG |
| 520F10 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGACAGTCTAYTGGGYDTAAAGNG |
| 520F11 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGCATCGTAAYTGGGYDTAAAGNG |
| 520F12 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTACTGCAAYTGGGYDTAAAGNG |
| 520F13 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTAGCATCAYTGGGYDTAAAGNG |
| 520F14 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTACGATGCAYTGGGYDTAAAGNG |
| 520F15 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTCACGAGTAYTGGGYDTAAAGNG |
| 520F16 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTCGACTAGAYTGGGYDTAAAGNG |
| 803R3 | CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTACCRGGGTATCTAATCC |
| 803R4 | CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTACCRGGGTATCTAATCC |
| 803R5 | CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTACCRGGGTATCTAATCC |
| 803R6 | CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTACCRGGGTATCTAATCC |
| 803R7 | CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTACCRGGGTATCTAATCC |
| 803R9 | CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTACCRGGGTATCTAATCC |
| 520F2 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTACGATGCTAYTGGGYDTAAAGNG |
| 502F7 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCGATGCTAAYTGGGYDTAAAGNG |
| 803R12 | CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTACCRGGGTATCTAATCC |
| Gene | Primers | Length (bp) | ||
|---|---|---|---|---|
| F4/80 | F | 5′ | GAATACAGAGACGGGGTTTA3′ | 198 |
| R | 5′ | CGTGTCCTTGAGTTTAGAGA3′ | ||
| Tlr2 | F | 5′ | TTTTCACCACTGCCCGTA3′ | 144 |
| R | 5′ | CAGCTCGCTCACTACGTC3′ | ||
| CD36 | F | 5′ | AAGCCAGCTAGAAAAATAG3′ | 184 |
| R | 5′ | AAGCCAGCTAGAAAAATAG3′ | ||
| Tlr4 | F | 5′ | GCTTTCACCTCTGCCTTCACTAC3′ | 172 |
| R | 5′ | GACACTACCACAATAACCTTCCG3′ | ||
| GAPDH | F | 5′ | CTTTGGCATTGTGGAAGGGCTC3′ | 194 |
| R | 5′ | GCAGGGATGATGTTCTGGGCAG3′ |
| Index | Bacteroidesfragilis Supplementation | Control Group | p Value |
|---|---|---|---|
| body weight (g) | 28.36 ± 1.55 | 24.18 ± 1.83 | 0.005 |
| heart weight (g) | 0.19 ± 0.014 | 0.15 ± 0.027 | 0.016 |
| heart weight/body weight (mg/g) | 6.90 ± 0.72 | 6.25 ± 0.75 | 0.201 |
| EF (%) | 68.39 ± 3.74 | 66.24 ± 5.24 | 0.308 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shi, G.; Lin, Y.; Wu, Y.; Zhou, J.; Cao, L.; Chen, J.; Li, Y.; Tan, N.; Zhong, S. Bacteroides fragilis Supplementation Deteriorated Metabolic Dysfunction, Inflammation, and Aorta Atherosclerosis by Inducing Gut Microbiota Dysbiosis in Animal Model. Nutrients 2022, 14, 2199. https://doi.org/10.3390/nu14112199
Shi G, Lin Y, Wu Y, Zhou J, Cao L, Chen J, Li Y, Tan N, Zhong S. Bacteroides fragilis Supplementation Deteriorated Metabolic Dysfunction, Inflammation, and Aorta Atherosclerosis by Inducing Gut Microbiota Dysbiosis in Animal Model. Nutrients. 2022; 14(11):2199. https://doi.org/10.3390/nu14112199
Chicago/Turabian StyleShi, Guoxiang, Yubi Lin, Yuanyuan Wu, Jing Zhou, Lixiang Cao, Jiyan Chen, Yong Li, Ning Tan, and Shilong Zhong. 2022. "Bacteroides fragilis Supplementation Deteriorated Metabolic Dysfunction, Inflammation, and Aorta Atherosclerosis by Inducing Gut Microbiota Dysbiosis in Animal Model" Nutrients 14, no. 11: 2199. https://doi.org/10.3390/nu14112199
APA StyleShi, G., Lin, Y., Wu, Y., Zhou, J., Cao, L., Chen, J., Li, Y., Tan, N., & Zhong, S. (2022). Bacteroides fragilis Supplementation Deteriorated Metabolic Dysfunction, Inflammation, and Aorta Atherosclerosis by Inducing Gut Microbiota Dysbiosis in Animal Model. Nutrients, 14(11), 2199. https://doi.org/10.3390/nu14112199
