Modifications in the Intestinal Functionality, Morphology and Microbiome Following Intra-Amniotic Administration (Gallus gallus) of Grape (Vitis vinifera) Stilbenes (Resveratrol and Pterostilbene)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Preparation
2.2. Polyphenols Analysis
2.2.1. Grape Sample Preparation
2.2.2. Liquid Chromatography-Mass Spectrometry (LC-MS) Analysis
2.3. Animals and Study Design
Intra-Amniotic Administration
2.4. Blood Analysis and Hemoglobin Measurements
2.5. Fe and Zn Content in the Serum and Liver Samples
2.6. Isolation of the Total RNA from the Duodenum and Liver Tissue Samples
2.7. Real-Time Polymerase Chain Reaction (RT-PCR) and Primer Design
2.8. Real-Time qPCR Design
2.9. 16S rRNA Gene Amplification and Sequencing
16S rRNA Gene Sequence Analysis
2.10. Morphometric Examination of Duodenal Tissue
2.11. Statistical Analysis
3. Results
3.1. Stilbenes Compounds Identified in Grape Samples
3.2. In Ovo Assay
3.2.1. Blood hemoglobin (Hb), Serum and Hepatic Fe and Zn Concentrations
3.2.2. Gene Expression of BBM Proteins, BBM Functionality, the Immune System and Hypertension
3.2.3. Duodenal Morphometric Parameters
3.3. Analysis of the Gut Microbiota
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Yang, J.; Xiao, Y.-Y. Grape Phytochemicals and Associated Health Benefits. Crit. Rev. Food Sci. Nutr. 2013, 53, 1202–1225. [Google Scholar] [CrossRef]
- Georgiev, V.; Ananga, A.; Tsolova, V. Recent Advances and Uses of Grape Flavonoids as Nutraceuticals. Nutrients 2014, 6, 391–415. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Renaud, S.; de Lorgeril, M. Wine, alcohol, platelets, and the French paradox for coronary heart disease. Lancet 1992, 339, 1523–1526. [Google Scholar] [CrossRef]
- Siemann, E.H.; Creasy, L.L. Concentration of the Phytoalexin Resveratrol in Wine. Am. J. Enol. Vitic. 1992, 43, 49–52. [Google Scholar]
- Berman, A.Y.; Motechin, R.A.; Wiesenfeld, M.Y.; Holz, M.K. The therapeutic potential of resveratrol: A review of clinical trials. NPJ Precis. Oncol. 2017, 1, 35. [Google Scholar] [CrossRef] [Green Version]
- Cho, S.; Namkoong, K.; Shin, M.; Park, J.; Yang, E.; Ihm, J.; Thu, V.T.; Kim, H.K.; Han, J. Cardiovascular Protective Effects and Clinical Applications of Resveratrol. J. Med. Food 2017, 20, 323–334. [Google Scholar] [CrossRef]
- International Organisation of Vine and Wine. 2019 Statistical Report on World Vitiviniculture; International Organisation of Vine and Wine: Paris, France, 2019. [Google Scholar]
- Flamini, R.; De Rosso, M.; De Marchi, F.; Dalla Vedova, A.; Panighel, A.; Gardiman, M.; Maoz, I.; Bavaresco, L. An innovative approach to grape metabolomics: Stilbene profiling by suspect screening analysis. Metabolomics 2013, 9, 1243–1253. [Google Scholar] [CrossRef]
- Pezet, R.; Pont, V.; Cuenat, P. Method to determine resveratrol and pterostilbene in grape berries and wines using high-performance liquid chromatography and highly sensitive fluorimetric detection. J. Chromatogr. A 1994, 663, 191–197. [Google Scholar] [CrossRef]
- Bavaresco, L.; Fregoni, C.; Cantù, E.; Trevisan, M. Stilbene compounds: From the grapevine to wine. Drugs Exp. Clin. Res. 1999, 25, 57–63. [Google Scholar]
- Kapetanovic, I.M.; Muzzio, M.; Huang, Z.; Thompson, T.N.; McCormick, D.L. Pharmacokinetics, oral bioavailability, and metabolic profile of resveratrol and its dimethylether analog, pterostilbene, in rats. Cancer Chemother. Pharmacol. 2011, 68, 593–601. [Google Scholar] [CrossRef] [Green Version]
- Walle, T. Bioavailability of resveratrol. Ann. N. Y. Acad. Sci. 2011, 1215, 9–15. [Google Scholar] [CrossRef]
- Sreenivasulu, K.; Raghu, P.; Nair, K.M. Polyphenol-Rich Beverages Enhance Zinc Uptake and Metallothionein Expression in Caco-2 Cells. J. Food Sci. 2010, 75, H123–H128. [Google Scholar] [CrossRef]
- Greger, J.L.; Lyle, B.J. Iron, Copper and Zinc Metabolism of Rats Fed Various Levels and Types of Tea. J. Nutr. 1988, 118, 52–60. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Navarro, G.; Martínez -Pinilla, E.; Ortiz, R.; Noé, V.; Ciudad, C.J.; Franco, R. Resveratrol and Related Stilbenoids, Nutraceutical/Dietary Complements with Health-Promoting Actions: Industrial Production, Safety, and the Search for Mode of Action. Compr. Rev. Food Sci. Food Saf. 2018, 17, 808–826. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tako, E.; Glahn, R.P. Intra-amniotic administration and dietary inulin affect the iron status and intestinal functionality of iron-deficient broiler chickens. Poult. Sci. 2012, 91, 1361–1370. [Google Scholar] [CrossRef] [PubMed]
- Tako, E.; Glahn, R.P.; Knez, M.; Stangoulis, J.C. The effect of wheat prebiotics on the gut bacterial population and iron status of iron deficient broiler chickens. Nutr. J. 2014, 13, 58. [Google Scholar] [CrossRef] [PubMed]
- Tako, E.; Rutzke, M.A.; Glahn, R.P. Using the domestic chicken (Gallus gallus) as an in vivo model for iron bioavailability. Poult. Sci. 2010, 89, 514–521. [Google Scholar] [CrossRef] [PubMed]
- Pacifici, S.; Song, J.; Zhang, C.; Wang, Q.; Glahn, R.; Kolba, N.; Tako, E. Intra Amniotic Administration of Raffinose and Stachyose Affects the Intestinal Brush Border Functionality and Alters Gut Microflora Populations. Nutrients 2017, 9, 304. [Google Scholar] [CrossRef]
- Hartono, K.; Reed, S.; Ankrah, N.A.; Glahn, R.P.; Tako, E. Alterations in gut microflora populations and brush border functionality following intra-amniotic daidzein administration. RSC Adv. 2015, 5, 6407–6412. [Google Scholar] [CrossRef]
- Hou, T.; Tako, E. The In Ovo Feeding Administration (Gallus gallus)—An Emerging In Vivo Approach to Assess Bioactive Compounds with Potential Nutritional Benefits. Nutrients 2018, 10, 418. [Google Scholar] [CrossRef]
- Reed, S.; Knez, M.; Uzan, A.; Stangoulis, J.C.R.; Glahn, R.P.; Koren, O.; Tako, E. Alterations in the Gut (Gallus gallus) Microbiota Following the Consumption of Zinc Biofortified Wheat (Triticum aestivum)-Based Diet. J. Agric. Food Chem. 2018, 66, 6291–6299. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Kolba, N.; Liang, J.; Tako, E. Alterations in gut microflora populations and brush border functionality following intra-amniotic administration (Gallus gallus) of wheat bran prebiotic extracts. Food Funct. 2019, 10, 4834–4843. [Google Scholar] [CrossRef]
- Carboni, J.; Reed, S.; Kolba, N.; Eshel, A.; Koren, O.; Tako, E. Alterations in the Intestinal Morphology, Gut Microbiota, and Trace Mineral Status Following Intra-Amniotic Administration (Gallus gallus) of Teff (Eragrostis tef) Seed Extracts. Nutrients 2020, 12, 3020. [Google Scholar] [CrossRef]
- Martino, H.S.D.; Kolba, N.; Tako, E. Yacon (Smallanthus sonchifolius) flour soluble extract improve intestinal bacterial populations, brush border membrane functionality and morphology in vivo (Gallus gallus). Food Res. Int. 2020, 137, 109705. [Google Scholar] [CrossRef] [PubMed]
- Pereira da Silva, B.; Kolba, N.; Martino, H.S.D.; Hart, J.; Tako, E. Soluble Extracts from Chia Seed (Salvia hispanica L.) Affect Brush Border Membrane Functionality, Morphology and Intestinal Bacterial Populations In Vivo (Gallus gallus). Nutrients 2019, 11, 2457. [Google Scholar] [CrossRef] [Green Version]
- Dias, D.M.; Kolba, N.; Hart, J.J.; Ma, M.; Sha, S.T.; Lakshmanan, N.; Nutti, M.R.; Martino, H.S.D.; Glahn, R.P.; Tako, E. Soluble extracts from carioca beans (Phaseolus vulgaris L.) affect the gut microbiota and iron related brush border membrane protein expression in vivo (Gallus gallus). Food Res. Int. 2019, 123, 172–180. [Google Scholar] [CrossRef]
- Dias, D.; Kolba, N.; Binyamin, D.; Ziv, O.; Regini Nutti, M.; Martino, H.; Glahn, R.; Koren, O.; Tako, E. Iron Biofortified Carioca Bean (Phaseolus vulgaris L.)—Based Brazilian Diet Delivers More Absorbable Iron and Affects the Gut Microbiota In Vivo (Gallus gallus). Nutrients 2018, 10, 1970. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tako, E.; Blair, M.W.; Glahn, R.P. Biofortified red mottled beans (Phaseolus vulgaris L.) in a maize and bean diet provide more bioavailable iron than standard red mottled beans: Studies in poultry (Gallus gallus) and an in vitro digestion/Caco-2 model. Nutr. J. 2011, 10, 113. [Google Scholar] [CrossRef] [Green Version]
- Tako, E.; Beebe, S.E.; Reed, S.; Hart, J.J.; Glahn, R.P. Polyphenolic compounds appear to limit the nutritional benefit of biofortified higher iron black bean (Phaseolus vulgaris L.). Nutr. J. 2014, 13, 28. [Google Scholar] [CrossRef]
- Caporaso, J.G.; Lauber, C.L.; Walters, W.A.; Berg-Lyons, D.; Huntley, J.; Fierer, N.; Owens, S.M.; Betley, J.; Fraser, L.; Bauer, M.; et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. ISME J. 2012, 6, 1621–1624. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef]
- Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.A.; Holmes, S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie, E.L.; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L. Greengenes, a Chimera-Checked 16S rRNA Gene Database and Workbench Compatible with ARB. Appl. Environ. Microbiol. 2006, 72, 5069–5072. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Segata, N.; Izard, J.; Waldron, L.; Gevers, D.; Miropolsky, L.; Garrett, W.S.; Huttenhower, C. Metagenomic biomarker discovery and explanation. Genome Biol. 2011, 12, R60. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Langille, M.G.I.; Zaneveld, J.; Caporaso, J.G.; McDonald, D.; Knights, D.; Reyes, J.A.; Clemente, J.C.; Burkepile, D.E.; Vega Thurber, R.L.; Knight, R.; et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nat. Biotechnol. 2013, 31, 814–821. [Google Scholar] [CrossRef] [PubMed]
- Tako, E.; Ferket, P.; Uni, Z. Changes in chicken intestinal zinc exporter mRNA expression and small intestinal functionality following intra-amniotic zinc-methionine administration. J. Nutr. Biochem. 2005, 16, 339–346. [Google Scholar] [CrossRef]
- Knez, M.; Stangoulis, J.; Glibetic, M.; Tako, E. The Linoleic Acid: Dihomo-γ-Linolenic Acid Ratio (LA:DGLA)—An Emerging Biomarker of Zn Status. Nutrients 2017, 9, 825. [Google Scholar] [CrossRef]
- Knez, M.; Tako, E.; Glahn, R.P.; Kolba, N.; de Courcy-Ireland, E.; Stangoulis, J.C.R. Linoleic Acid:Dihomo-γ-Linolenic Acid Ratio Predicts the Efficacy of Zn-Biofortified Wheat in Chicken (Gallus gallus). J. Agric. Food Chem. 2018, 66, 1394–1400. [Google Scholar] [CrossRef]
- Reed, S.; Qin, X.; Ran-Ressler, R.; Brenna, J.; Glahn, R.; Tako, E. Dietary Zinc Deficiency Affects Blood Linoleic Acid: Dihomo-γ-linolenic Acid (LA:DGLA) Ratio; a Sensitive Physiological Marker of Zinc Status in vivo (Gallus gallus). Nutrients 2014, 6, 1164–1180. [Google Scholar] [CrossRef]
- Mariat, D.; Firmesse, O.; Levenez, F.; Guimarăes, V.; Sokol, H.; Doré, J.; Corthier, G.; Furet, J.-P. The Firmicutes/Bacteroidetes ratio of the human microbiota changes with age. BMC Microbiol. 2009, 9, 123. [Google Scholar] [CrossRef]
- Akinwumi, B.; Bordun, K.-A.; Anderson, H. Biological Activities of Stilbenoids. Int. J. Mol. Sci. 2018, 19, 792. [Google Scholar] [CrossRef] [Green Version]
- Salehi, B.; Mishra, A.; Nigam, M.; Sener, B.; Kilic, M.; Sharifi-Rad, M.; Fokou, P.; Martins, N.; Sharifi-Rad, J. Resveratrol: A Double-Edged Sword in Health Benefits. Biomedicines 2018, 6, 91. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.-R.; Li, S.; Lin, C.-C. Effect of resveratrol and pterostilbene on aging and longevity. BioFactors 2018, 44, 69–82. [Google Scholar] [CrossRef] [PubMed]
- Jeandet, P.; Delaunois, B.; Conreux, A.; Donnez, D.; Nuzzo, V.; Cordelier, S.; Clément, C.; Courot, E. Biosynthesis, metabolism, molecular engineering, and biological functions of stilbene phytoalexins in plants. BioFactors 2010, 36, 331–341. [Google Scholar] [CrossRef] [PubMed]
- Rimando, A.M.; Cuendet, M.; Desmarchelier, C.; Mehta, R.G.; Pezzuto, J.M.; Duke, S.O. Cancer Chemopreventive and Antioxidant Activities of Pterostilbene, a Naturally Occurring Analogue of Resveratrol. J. Agric. Food Chem. 2002, 50, 3453–3457. [Google Scholar] [CrossRef]
- Lv, M.; Liu, K.; Fu, S.; Li, Z.; Yu, X. Pterostilbene attenuates the inflammatory reaction induced by ischemia/reperfusion in rat heart. Mol. Med. Rep. 2015, 11, 724–728. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Etxeberria, U.; Hijona, E.; Aguirre, L.; Milagro, F.I.; Bujanda, L.; Rimando, A.M.; Martínez, J.A.; Portillo, M.P. Pterostilbene-induced changes in gut microbiota composition in relation to obesity. Mol. Nutr. Food Res. 2017, 61, 1500906. [Google Scholar] [CrossRef] [PubMed]
- Milton-Laskibar, I.; Marcos-Zambrano, L.J.; Gómez-Zorita, S.; Fernández-Quintela, A.; Carrillo de Santa Pau, E.; Martínez, J.A.; Portillo, M.P. Gut Microbiota Induced by Pterostilbene and Resveratrol in High-Fat-High-Fructose Fed Rats: Putative Role in Steatohepatitis Onset. Nutrients 2021, 13, 1738. [Google Scholar] [CrossRef] [PubMed]
- Adrian, M.; Jeandet, P.; Breuil, A.C.; Levite, D.; Debord, S.; Bessis, R. Assay of resveratrol and derivative stilbenes in wines by direct injection high performance liquid chromatography. Am. J. Enol. Vitic. 2000, 51, 37–41. [Google Scholar]
- Birchenough, G.M.H.; Johansson, M.E.; Gustafsson, J.K.; Bergström, J.H.; Hansson, G.C. New developments in goblet cell mucus secretion and function. Mucosal Immunol. 2015, 8, 712–719. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bergstrom, K.; Shan, X.; Casero, D.; Batushansky, A.; Lagishetty, V.; Jacobs, J.P.; Hoover, C.; Kondo, Y.; Shao, B.; Gao, L.; et al. Proximal colon–derived O-glycosylated mucus encapsulates and modulates the microbiota. Science 2020, 370, 467–472. [Google Scholar] [CrossRef] [PubMed]
- Montagne, L.; Piel, C.; Lalles, J.P. Effect of Diet on Mucin Kinetics and Composition: Nutrition and Health Implications. Nutr. Rev. 2004, 62, 105–114. [Google Scholar] [CrossRef] [PubMed]
- Gomes, M.J.C.; Martino, H.S.D.; Tako, E. Effects of iron and zinc biofortified foods on gut microbiota in vivo (Gallus gallus): A systematic review. Nutrients 2021, 13, 189. [Google Scholar] [CrossRef]
- Liong, E.M.; McDonald, C.M.; Suh, J.; Westcott, J.L.; Wong, C.P.; Signorell, C.; King, J.C. Zinc-Biofortified Wheat Intake and Zinc Status Biomarkers in Men: Randomized Controlled Trial. J. Nutr. 2021, 151, 1817–1823. [Google Scholar] [CrossRef]
- Oguma, T.; Nakayama, K.; Kuriyama, C.; Matsushita, Y.; Yoshida, K.; Hikida, K.; Obokata, N.; Tsuda-Tsukimoto, M.; Saito, A.; Arakawa, K.; et al. Intestinal Sodium Glucose Cotransporter 1 Inhibition Enhances Glucagon-Like Peptide-1 Secretion in Normal and Diabetic Rodents. J. Pharmacol. Exp. Ther. 2015, 354, 279–289. [Google Scholar] [CrossRef] [Green Version]
- Kellett, G.L. The facilitated component of intestinal glucose absorption. J. Physiol. 2001, 531, 585–595. [Google Scholar] [CrossRef]
- Smirnov, A.; Tako, E.; Ferket, P.R.; Uni, Z. Mucin Gene Expression and Mucin Content in the Chicken Intestinal Goblet Cells Are Affected by In Ovo Feeding of Carbohydrates. Poult. Sci. 2006, 85, 669–673. [Google Scholar] [CrossRef]
- Teng, H.; Chen, L. Polyphenols and bioavailability: An update. Crit. Rev. Food Sci. Nutr. 2019, 59, 2040–2051. [Google Scholar] [CrossRef] [PubMed]
- Abdel-Moneim, A.E.; Shehata, A.M.; Alzahrani, S.O.; Shafi, M.E.; Mesalam, N.M.; Taha, A.E.; Swelum, A.A.; Arif, M.; Fayyaz, M.; Abd El-Hack, M.E. The role of polyphenols in poultry nutrition. J. Anim. Physiol. Anim. Nutr. 2020, 104, 1851–1866. [Google Scholar] [CrossRef]
- Liu, S.; Li, Y.; Yi, F.; Liu, Q.; Chen, N.; He, X.; He, C.; Xiao, P. Resveratrol oligomers from Paeonia suffruticosa protect mice against cognitive dysfunction by regulating cholinergic, antioxidant and anti-inflammatory pathways. J. Ethnopharmacol. 2020, 260, 112983. [Google Scholar] [CrossRef] [PubMed]
- Ghanim, H.; Sia, C.L.; Korzeniewski, K.; Lohano, T.; Abuaysheh, S.; Marumganti, A.; Chaudhuri, A.; Dandona, P. A Resveratrol and Polyphenol Preparation Suppresses Oxidative and Inflammatory Stress Response to a High-Fat, High-Carbohydrate Meal. J. Clin. Endocrinol. Metab. 2011, 96, 1409–1414. [Google Scholar] [CrossRef] [Green Version]
- Li, X.; Dai, Y.; Yan, S.; Shi, Y.; Li, J.; Liu, J.; Cha, L.; Mu, J. Resveratrol lowers blood pressure in spontaneously hypertensive rats via calcium-dependent endothelial NO production. Clin. Exp. Hypertens. 2016, 38, 287–293. [Google Scholar] [CrossRef] [PubMed]
- Riche, D.M.; Riche, K.D.; Blackshear, C.T.; McEwen, C.L.; Sherman, J.J.; Wofford, M.R.; Griswold, M.E. Pterostilbene on Metabolic Parameters: A Randomized, Double-Blind, and Placebo-Controlled Trial. Evid.-Based Complement. Altern. Med. 2014, 2014, 459165. [Google Scholar] [CrossRef] [PubMed]
- Uni, Z.; Noy, Y.; Sklan, D. Posthatch development of small intestinal function in the poult. Poult. Sci. 1999, 78, 215–222. [Google Scholar] [CrossRef]
- Cortés-Martín, A.; Selma, M.V.; Tomás-Barberán, F.A.; González-Sarrías, A.; Espín, J.C. Where to Look into the Puzzle of Polyphenols and Health? The Postbiotics and Gut Microbiota Associated with Human Metabotypes. Mol. Nutr. Food Res. 2020, 64, 1900952. [Google Scholar] [CrossRef] [PubMed]
- Shreiner, A.B.; Kao, J.Y.; Young, V.B. The gut microbiome in health and in disease. Curr. Opin. Gastroenterol. 2015, 31, 69–75. [Google Scholar] [CrossRef]
- Chen, Y.; Zhang, H.; Chen, Y.; Jia, P.; Ji, S.; Zhang, Y.; Wang, T. Resveratrol and its derivative pterostilbene ameliorate intestine injury in intrauterine growth-retarded weanling piglets by modulating redox status and gut microbiota. J. Anim. Sci. Biotechnol. 2021, 12, 70. [Google Scholar] [CrossRef]
- Da Silva, C.C.; Monteil, M.A.; Davis, E.M. Overweight and Obesity in Children Are Associated with an Abundance of Firmicutes and Reduction of Bifidobacterium in Their Gastrointestinal Microbiota. Child. Obes. 2020, 16, 204–210. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bird, J.K.; Raederstorff, D.; Weber, P.; Steinert, R.E. Cardiovascular and Antiobesity Effects of Resveratrol Mediated through the Gut Microbiota. Adv. Nutr. An. Int. Rev. J. 2017, 8, 839–849. [Google Scholar] [CrossRef] [PubMed]
- Romano, K.A.; Vivas, E.I.; Amador-Noguez, D.; Rey, F.E. Intestinal Microbiota Composition Modulates Choline Bioavailability from Diet and Accumulation of the Proatherogenic Metabolite Trimethylamine- N -Oxide. MBio 2015, 6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wilson, A.; McLean, C.; Kim, R.B. Trimethylamine-N-oxide: A link between the gut microbiome, bile acid metabolism, and atherosclerosis. Curr. Opin. Lipidol. 2016, 27, 148–154. [Google Scholar] [CrossRef] [PubMed]
- Rios-Covian, D.; Salazar, N.; Gueimonde, M.; de los Reyes-Gavilan, C.G. Shaping the Metabolism of Intestinal Bacteroides Population through Diet to Improve Human Health. Front. Microbiol. 2017, 8, 376. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lagkouvardos, I.; Lesker, T.R.; Hitch, T.C.A.; Gálvez, E.J.C.; Smit, N.; Neuhaus, K.; Wang, J.; Baines, J.F.; Abt, B.; Stecher, B.; et al. Sequence and cultivation study of Muribaculaceae reveals novel species, host preference, and functional potential of this yet undescribed family. Microbiome 2019, 7, 28. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Calderón-Pérez, L.; Llauradó, E.; Companys, J.; Pla-Pagà, L.; Pedret, A.; Rubió, L.; Gosalbes, M.J.; Yuste, S.; Solà, R.; Valls, R.M. Interplay between dietary phenolic compound intake and the human gut microbiome in hypertension: A cross-sectional study. Food Chem. 2021, 344, 128567. [Google Scholar] [CrossRef]
- Sakata, T. Stimulatory effect of short-chain fatty acids on epithelial cell proliferation in the rat intestine: A possible explanation for trophic effects of fermentable fibre, gut microbes and luminal trophic factors. Br. J. Nutr. 1987, 58, 95–103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Analyte | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Base Pairs Length | GI Identifier |
---|---|---|---|---|
Calcium Metabolism | ||||
TRPV6 | GCTCCCAGAACCTTCTCTATTT | CCAGGTAATCCTGAGCTCTAATG | 123 | 418,307 |
PMCA1b | TGCAGATGCTGTGGGTAAAT | CCATAAGGCTTCCGCAATAGA | 100 | 374,244 |
NCX1 | CCTGACGGAGAAATAAGGAAGA | CCCAGGAGAAGACACAGATAAA | 114 | 395,760 |
Iron Metabolism | ||||
DMT1 | TTGATTCAGAGCCTCCCATTAG | GCGAGGAGTAGGCTTGTATTT | 101 | 206,597,489 |
Ferroportin | CTCAGCAATCACTGGCATCA | ACTGGGCAACTCCAGAAATAAG | 98 | 61,098,365 |
DcytB | CATGTGCATTCTCTTCCAAAGTC | CTCCTTGGTGACCGCATTAT | 103 | 20,380,692 |
Immune Response | ||||
IL-1β | CTCACAGTCCTTCGACATCTTC | TGTTGAGCCTCACTTTCTGG | 119 | 88,702,685 |
IL-6 | ACCTCATCCTCCGAGACTTTA | GCACTGAAACTCCTGGTCTT | 105 | 302,315,692 |
TNF-α | GACAGCCTATGCCAACAAGTA | TTACAGGAAGGGCAACTCATC | 109 | 53,854,909 |
Magnesium Metabolism | ||||
MRS2 | GCTGGTAACCGGGATTATGT | GCAGGAACATGAGGAGGTAAT | 105 | 420,820 |
TRPM6 | ACAGATGCTGCTGACTGATATG | AAGATAGTGGGTGGTAGGAGAA | 99 | 1,008,596,03 |
TRPM7 | GCGTGGGATAGAGTTGACATT | TCACAAGGGCATCCAACATAG | 100 | 427,502 |
Zinc Metabolism | ||||
ZnT1 | GGTAACAGAGCTGCCTTAACT | GGTAACAGAGCTGCCTTAACT | 105 | 54,109,718 |
ZnT7 | GGAAGATGTCAGGATGGTTCA | CGAAGGACAAATTGAGGCAAAG | 87 | 56,555,152 |
ZIP9 | CTAAGCAAGAGCAGCAAAGAAG | CATGAACTGTGGCAACGTAAAG | 100 | 237,874,618 |
Δ-6-desaturase | GGCGAAAGTCAGCCTATTGA | AGGTGGGAAGATGAGGAAGA | 93 | 261,865,208 |
Hypertension | ||||
ACE * | CATGGCCTTGTCTGTCTCC | GAGGTATCCAAAGGGCAGG | 142 | 424,059 |
AT1R * | TCATCTGGCTCCTTGCTGG | AACCTAGCCCAACCCTCAG | 138 | 396,065 |
BBM Functionality | ||||
AP | CGTCAGCCAGTTTGACTATGTA | CTCTCAAAGAAGCTGAGGATGG | 138 | 45,382,360 |
SI | CCAGCAATGCCAGCATATTG | CGGTTTCTCCTTACCACTTCTT | 95 | 2,246,388 |
SGLT1 | GCATCCTTACTCTGTGGTACTG | TATCCGCACATCACACATCC | 106 | 8,346,783 |
18s rRNA | GCAAGACGAACTAAAGCGAAAG | TCGGAACTACGACGGTATCT | 100 | 7,262,899 |
Polyphenolic Compounds | Mean (Da) | M + H (Da) | Retention Time (min) | Concentration (ng/g) |
---|---|---|---|---|
Resveratrol | 228.24 | 229.24 | 5.334 ± 0.008 | CF: 64.7 ± 3.9 Noire: 60.2 ± 2.8 Concord: 1.85 ± 0.3 |
Pterostilbene | 256.3 | 257.3 | 10.341 ± 0.007 | ND |
Treatment Group | Liver (µg/g) | Serum (µg/g) | |||
---|---|---|---|---|---|
Hb (g/dL) | Fe | Zn | Fe | Zn | |
No Injection | 8.75 ± 0.80 a | 32.47 ± 2.83 b | 15.79 ± 0.95 b | 2.09 ± 0.24 b | 0.86 ± 0.08 c |
18 MΩ H2O | 8.70 ± 0.59 a | 37.93 ± 4.93 a,b | 16.12 ± 0.96 b | 2.00 ± 0.27 b | 0.84 ± 0.07 c |
5% Inulin | 8.86 ± 0.69 a | 48.96 ± 4.39 a | 18.23 ± 0.88 a,b | 2.76 ± 0.33 b | 0.97 ± 0.08 b,c |
5% Resveratrol | 9.71 ± 0.53 a | 46.45 ± 4.71 a | 16.72 ± 1.58 b | 2.42 ± 0.23 b | 0.97 ± 0.12 b,c |
5% Pterostilbene | 8.95 ± 0.77 a | 37.43 ± 1.52 a,b | 14.43 ± 0.49 b | 2.94 ± 0.44 b | 1.33 ± 0.20 a |
Synergistic | 8.04 ± 0.94 b | 50.96 ± 6.08 a | 21.22 ± 3.36 a | 3.87 ± 0.41 a | 1.24 ± 0.11 a,b |
Treatment Group | Villus Length (µm) | Villus Diameter (µm) | Depth of Crypts (µm) |
---|---|---|---|
No Injection | 235.86 ± 4.08 e | 52.14 ± 0.67 b | 66.30 ± 1.33 a |
18 MΩ H2O | 223.29 ± 4.53 e | 52.52 ± 5.21 c | 53.42 ± 1.11 b |
5% Inulin | 262.54 ± 3.76 d | 44.57 ± 0.79 d | 51.30 ± 1.07 b |
5% Resveratrol | 294.92 ± 3.48 c | 54.47 ± 0.70 b | 63.73 ± 1.20 a |
5% Pterostilbene | 451.58 ± 11.2 b | 81.33 ± 4.95 a | 66.41 ± 1.19 a |
Synergistic | 573.92 ± 9.14 a | 77.37 ± 0.99 a | 63.98 ± 1.13 a |
Treatment Group | Goblet Cell Diameter (µM) | Crypt Goblet Cell Number | Villus Goblet Cell Type Number | ||
---|---|---|---|---|---|
Acidic | Neutral | Mixed | |||
No Injection | 7.27 ± 0.05 c | 9.53 ± 0.32 c,d | 10.22 ± 0.26 b | 0.12 ± 0.03 a | 0.13 ± 0.03 c,d |
18 MΩ H2O | 6.75 ± 0.05 e | 10.01 ± 0.22 c | 9.46 ± 0.23 c | 0.00 ± 0.00 b | 0.05 ± 0.03 d,e |
5% Inulin | 7.12 ± 0.06 d | 12.27 ± 0.33 a | 10.65 ± 0.25 a,b | 0.00 ± 0.00 b | 0.02 ± 0.01 e |
5% Resveratrol | 7.94 ± 0.06 b | 10.91 ± 0.21 b | 10.97 ± 0.23 a | 0.00 ± 0.00 b | 0.17 ± 0.03 c |
5% Pterostilbene | 7.81 ± 0.07 b | 10.04 ± 0.18 c | 10.78 ± 0.22 a,b | 0.00 ± 0.00 b | 0.28 ± 0.05 b |
Synergistic | 8.55 ± 0.07 a | 9.02 ± 0.15 d | 8.29 ± 0.17 d | 0.00 ± 0.00 b | 0.66 ± 0.05 a |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gomes, M.J.C.; Kolba, N.; Agarwal, N.; Kim, D.; Eshel, A.; Koren, O.; Tako, E. Modifications in the Intestinal Functionality, Morphology and Microbiome Following Intra-Amniotic Administration (Gallus gallus) of Grape (Vitis vinifera) Stilbenes (Resveratrol and Pterostilbene). Nutrients 2021, 13, 3247. https://doi.org/10.3390/nu13093247
Gomes MJC, Kolba N, Agarwal N, Kim D, Eshel A, Koren O, Tako E. Modifications in the Intestinal Functionality, Morphology and Microbiome Following Intra-Amniotic Administration (Gallus gallus) of Grape (Vitis vinifera) Stilbenes (Resveratrol and Pterostilbene). Nutrients. 2021; 13(9):3247. https://doi.org/10.3390/nu13093247
Chicago/Turabian StyleGomes, Mariana Juste Contin, Nikolai Kolba, Nikita Agarwal, Dean Kim, Adi Eshel, Omry Koren, and Elad Tako. 2021. "Modifications in the Intestinal Functionality, Morphology and Microbiome Following Intra-Amniotic Administration (Gallus gallus) of Grape (Vitis vinifera) Stilbenes (Resveratrol and Pterostilbene)" Nutrients 13, no. 9: 3247. https://doi.org/10.3390/nu13093247