Soil Respiration Response to Long-Term Freezing Saline Water Irrigation with Plastic Mulching in Coastal Saline Plain
Abstract
:1. Introduction
2. Materials and methods
2.1. Site Description
2.2. Experimental Design and Measurement
2.3. Laboratory Analysis
2.4. Statistical Analysis
3. Results
3.1. Changes in Influencing Factors of Soil Respiration Rate among Different Treatments
3.1.1. Changes in Soil Surface Temperature
3.1.2. Changes in Soil Salt Contents and Soil Water Contents
3.1.3. Abundance of Bacteria, Fungi and Actinomycetes among the Four Treatments
3.2. Change in Soil Respiration Rate between Each Treatment during the Cotton Growth Period
3.3. Soil Respiration Rate Response to the Soil Surface Temperature during the Cotton Growth Period
3.4. Soil Respiration Rate Response to Soil Surface Salt and Water Contents during the Cotton Growth Period
4. Discussion
4.1. Changes in Influencing Factors of Soil Respiration Rate between Each Treatment
4.2. Effects of Different Treatments on Soil Respiration Rate
4.3. Relationship between Soil Respiration Rate and Its Influencing Factors between Each Treatment
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Wang, Z.Q. Salt-Effected Soil in China; Science Press: Beijing, China, 1993. [Google Scholar]
- Li, X.; Kang, Y.; Wan, S.; Chen, X.; Liu, S.; Xu, J. Effect of ridge planting on reclamation of coastal saline soil using drip-irrigation with saline water. CATENA 2017, 150, 24–31. [Google Scholar] [CrossRef]
- Zhang, T.; Wang, T.; Liu, K.S.; Wang, L.; Wang, K.; Zhou, Y. Effects of different amendments for the reclamation of coastal saline soil on soil nutrient dynamics and electrical conductivity responses. Agric. Water Manag. 2015, 159, 115–122. [Google Scholar] [CrossRef]
- He, B.; Cai, Y.; Ran, W.; Jiang, H. Spatial and seasonal variations of soil salinity following vegetation restoration in coastal saline land in eastern China. CATENA 2014, 118, 147–153. [Google Scholar] [CrossRef]
- Li, X.; Kang, Y.; Wan, S.; Chen, X.; Chu, L. Reclamation of very heavy coastal saline soil using drip-irrigation with saline water on salt-sensitive plants. Soil Tillage Res. 2015, 146, 159–173. [Google Scholar] [CrossRef]
- Chen, X.; Kang, Y.; Wan, S.; Li, X.; Guo, L. Influence of mulches on urban vegetation construction in coastal saline land under drip irrigation in North China. Agric. Water Manag. 2015, 158, 145–155. [Google Scholar] [CrossRef]
- Guo, K.; Liu, X. Dynamics of meltwater quality and quantity during saline ice melting and its effects on the infiltration and desalinization of coastal saline soils. Agric. Water Manag. 2014, 139, 1–6. [Google Scholar] [CrossRef]
- Li, Z.; Liu, X.; Zhang, X.; Li, W. Infiltration of melting saline ice water in soil columns: Consequences on soil moisture and salt content. Agric. Water Manag. 2008, 95, 498–502. [Google Scholar] [CrossRef]
- Huo, L.; Pang, H.; Zhao, Y.; Wang, J.; Lu, C.; Li, Y. Buried straw layer plus plastic mulching improves soil organic carbon fractions in an arid saline soil from Northwest China. Soil Tillage Res. 2017, 165, 286–293. [Google Scholar] [CrossRef]
- Niu, L.; Manxia, C.; Xiumei, G.; Xiaohua, L.; Hongbo, S.; Zhaopu, L.; Zed, R. Carbon sequestration and Jerusalem artichoke biomass under nitrogen applications in coastal saline zone in the northern region of Jiangsu, China. Sci. Total Environ. 2016, 568, 885–890. [Google Scholar] [CrossRef] [PubMed]
- Schlesinger, J. Soil respiration and the global carbon cycle. Biogeochemistry 2000, 48, 7–20. [Google Scholar] [CrossRef]
- Raich, J.W.; Schlesinger, W.H. The global carbon dioxide flux in soil respiration and its relationship to vegetation and climate. Tellus 1992, 44, 81–99. [Google Scholar] [CrossRef]
- Yang, J. Development and prospect of the research on salt-affected soils in China. Acta Pedol. Sin. 2008, 45, 837–845. [Google Scholar]
- Pathak, H.; Rao, D.L.N. Carbon and nitrogen mineralization from added organic matter in saline and alkali soils. Soil Biol. Biochem. 1998, 30, 695–702. [Google Scholar] [CrossRef]
- Liu, R.; Pan, L.; Jenerette, G.D.; Wang, Q.; Cieraad, E.; Li, Y. High efficiency in water use and carbon gain in a wet year for a desert halophyte community. Agric. For. Meteorol. 2012, 162–163, 127–135. [Google Scholar] [CrossRef]
- Han, G.; Luo, Y.; Li, D.; Xia, J.; Xing, Q.; Yu, J. Ecosystem photosynthesis regulates soil respiration on a diurnal scale with a short-term time lag in a coastal wetland. Soil Biol. Biochem. 2014, 68, 85–94. [Google Scholar] [CrossRef]
- Yan, N.; Marschner, P. Response of soil respiration and microbial biomass to changing EC in saline soils. Soil Biol. Biochem. 2013, 65, 322–328. [Google Scholar] [CrossRef]
- Feng, X.; Zhang, X.; Guo, K.; Xie, Z.; Liu, X. Effects of Different Salt Control Measures after Saline Water Freezing Irrigation to Soil Water, Salt Dynamics, Cotton Emergence and Yield. Cotton Sci. 2015, 27, 135–142. [Google Scholar]
- Guo, K.; Zhang, X.M.; Li, X.J.; Yang, L.L.; Liu, X.J. Effect of the Water and Salt Transport on Soda Alkaline Soil after Infiltration with Melting Ice Saline Water of Different SAR. J. Soil Water Conserv. 2010, 4, 021. [Google Scholar]
- Guo, K.; Zhang, X.; Liu, X. Effect of timing of plastic film mulching on water and salt movements in coastal saline soil under freezing saline water irrigation. Acta Pedol. Sin. 2014, 51, 1202–1212. [Google Scholar]
- Hutchinson, G.L.; Livingston, G.P. Vents and seals in non-steady-state chambers used for measuring gas exchange between soil and the atmosphere. Eur. J. Soil Sci. 2001, 52, 675–682. [Google Scholar] [CrossRef]
- Song, X.; Yuan, H.; Kimberley, M.O.; Jiang, H.; Zhou, G.; Wang, H. Soil CO2 flux dynamics in the two main plantation forest types in subtropical China. Sci. Total Environ. 2013, 444, 363–368. [Google Scholar] [CrossRef] [PubMed]
- Jassal, R.; Black, A.; Novak, M.; Kai, M.; Nesic, Z.; Gaumont-Guay, D. Relationship between soil CO2 concentrations and forest-floor CO2 effluxes. Agric. For. Meteorol. 2005, 130, 176–192. [Google Scholar] [CrossRef]
- Gough, C.M.; Vogel, C.S.; Schmid, H.P.; Su, H.B.; Curtis, P.S. Multi-year convergence of biometric and meteorological estimates of forest carbon storage. Agric For. Meteorol. 2008, 148, 158–170. [Google Scholar] [CrossRef]
- Law, B.E.; Sun, O.J.; Campbell, J.; Tuyl, S.V.; Thornton, P.E. Changes in carbon storage and fluxes in a chronosequence of ponderosa pine. Glob. Chang. Biol. 2003, 9, 510–524. [Google Scholar] [CrossRef]
- Lao, J.S. Handbook of Soil and Agricultural Chemistry Analysis; Agricultural Press: Beijing, China, 1988. [Google Scholar]
- Suzuki, M.T.; Taylor, L.T.; Delong, E.F. Quantitative Analysis of Small-Subunit rRNA Genes in Mixed Microbial Populations via 5′-Nuclease Assays. Appl. Environ. Microbiol. 2000, 66, 4605–4614. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.M.; Kachur, S.; Dwan, M.G.; Abraham, A.G.; Aziz, M.; Hsueh, P.R.; Huang, Y.T.; Busch, J.D.; Lamit, L.J.; Gehring, C.A.; et al. FungiQuant: A broad-coverage fungal quantitative real-time PCR assay. BMC Microbiol. 2012, 12, 255. [Google Scholar] [CrossRef] [PubMed]
- Heuer, H.; Krsek, M.; Baker, P.; Smalla, K.; Wellington, E.M. Analysis of actinomycete communities by specific amplification of genes encoding 16S rRNA and gel-electrophoretic separation in denaturing gradients. Appl. Environ. Microbiol. 1997, 63, 3233. [Google Scholar] [PubMed]
- Xu, M.; Qi, Y. Spatial and Seasonal Variations of Q10 Determined by Soil Respiration Measurements at a Sierra Nevadan Forest. Glob. Biogeochem. Cycles 2001, 15, 687–696. [Google Scholar] [CrossRef]
- Zeng, X.; Zhang, W.; Shen, H.; Cao, J.; Zhao, X. Soil respiration response in different vegetation types at Mount Taihang, China. CATENA 2014, 116, 78–85. [Google Scholar] [CrossRef]
- Lloyd, J.; Taylor, J.A. On the Temperature Dependence of Soil Respiration. Funct. Ecol. 1994, 8, 315–323. [Google Scholar] [CrossRef]
- Xu, L.; Baldocchi, D.D.; Tang, J. How soil moisture, rain pulses, and growth alter the response of ecosystem respiration to temperature. Glob. Biogeochem. Cycles 2004, 18, 187–206. [Google Scholar] [CrossRef]
- Guo, K.; Liu, X. Infiltration of meltwater from frozen saline water located on the soil can result in reclamation of a coastal saline soil. Irrig. Sci. 2015, 33, 441–452. [Google Scholar] [CrossRef]
- Raich, J.W.; Tufekciogul, A. Vegetation and soil respiration: Correlations and controls. Biogeochemistry 2000, 48, 71–90. [Google Scholar] [CrossRef]
- Stoyan, H.; Depolli, H.; Böhm, S.; Robertson, G.P.; Paul, E.A. Spatial heterogeneity of soil respiration and related properties at the plant scale. Plant Soil 2000, 222, 203–214. [Google Scholar] [CrossRef]
- Epron, D.; Farque, L.; Lucot, E.; Badot, P.M. Soil CO2 efflux in a beech forest: The contribution of root respiration. Ann. For. Sci. 1999, 56, 289–295. [Google Scholar] [CrossRef]
- Wang, R.; Gao, M.; Ji, S.; Wang, S.; Meng, Y.; Zhou, Z. Carbon allocation, osmotic adjustment, antioxidant capacity and growth in cotton under long-term soil drought during flowering and boll-forming period. Plant Physiol. Biochem. 2016, 107, 137–146. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.; Luo, Z.; Liu, S.; Li, W.; Dong, H. Effects of deficit irrigation and plant density on the growth, yield and fiber quality of irrigated cotton. Field Crops Res. 2016, 197, 1–9. [Google Scholar] [CrossRef]
- Houghton, R.A. The Worldwide Extent of Land-Use Change. Bioscience 1994, 44, 305–313. [Google Scholar] [CrossRef]
- Houghton, R.A.; Hackler, J.L.; Lawrence, K.T. The U.S. Carbon budget: Contributions from land-Use change. Science 1999, 285, 574–578. [Google Scholar] [CrossRef] [PubMed]
- Pacala, S.W.; Hurtt, G.C.; Baker, D.; Peylin, P.; Houghton, R.A.; Birdsey, R.A.; Heath, L.; Sundquist, E.T.; Stallard, R.F.; Ciais, P.; et al. Consistent land- and atmosphere-based U.S. carbon sink estimates. Science 2001, 292, 2316–2320. [Google Scholar] [CrossRef] [PubMed]
- Schimel, D.S. Terrestrial ecosystems and the carbon cycle. Glob. Chang. Biol. 2006, 1, 77–91. [Google Scholar] [CrossRef]
- Keeling, C.D.; Whorf, T.P.; Jfs, C. Increased activity of northern vegetation inferred from atmospheric CO2 measurements. Nature 1996, 382, 146–149. [Google Scholar] [CrossRef]
- Caspersen, J.P.; Pacala, S.W.; Jenkins, J.C.; Hurtt, G.C.; Moorcroft, P.R.; Birdsey, R.A. Contributions of land-use history to carbon accumulation in U.S. forests. Science 2000, 290, 1148–1151. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Tian, H.; Liu, M.; Melillo, J.; Pan, S.; Zhang, C. Effect of land-cover change on terrestrial carbon dynamics in the southern United States. J. Environ. Qual. 2006, 35, 1533–1547. [Google Scholar] [CrossRef] [PubMed]
- Defries, R.S.; Field, C.B.; Fung, I.; Collatz, G.J.; Bounoua, L. Combining satellite data and biogeochemical models to estimate global effects of human-induced land cover change on carbon emissions and primary productivity. Glob. Biogeochem. Cycles 1999, 13, 803–815. [Google Scholar] [CrossRef]
- Dai, W.H.; Huang, Y.; Wu, L.; Yu, J. Relationships between soil organic matter content (SOM) and pH in topsoil of zonal soils in China. Acta Pedol. Sin. 2009, 46, 851–860. [Google Scholar]
- Anthony, W.K.; William, R.E.; Wullschleger, S.D.; Post, W.M. In search of the missing carbon sink: A model of terrestrial biospheric response to land-use change and atmospheric CO2. Tellus Ser. B Chem. Phys. Meteorol. 1995, 47, 501–519. [Google Scholar]
- Levy, P.E.; Friend, A.D.; White, A.; Cannell, M.G.R. The Influence of Land Use Change on Global-Scale Fluxes of Carbon from Terrestrial Ecosystems. Clim. Chang. 2004, 67, 185–209. [Google Scholar] [CrossRef]
- Tans, P.P.; Fung, I.Y.; Takahashi, T. Observational Constraints on the Global Atmospheric CO2 Budget. Science 1990, 247, 1431–1438. [Google Scholar] [CrossRef] [PubMed]
- Jin, H.M.; Sun, Q.J.; Luo, Z.K.; Liu, J. Dynamics of soil respiration in sparse Ulmus pumila woodland under semi-arid climate. Ecol. Res. 2009, 24, 731–739. [Google Scholar] [CrossRef]
- Saiz, G.; Byrne, K.A.; Butterbachbahl, K.; Kiese, R.; Blujdea, V.; Farrell, E.P. Stand age-related effects on soil respiration in a first rotation Sitka spruce chronosequence in central Ireland. Glob. Chang. Biol. 2006, 12, 1007–1020. [Google Scholar] [CrossRef]
- Wang, W.; Fang, J. Soil respiration and human effects on global grasslands. Glob. Planet. Chang. 2009, 67, 20–28. [Google Scholar] [CrossRef]
- Kirschbaum, M.U.F. The temperature dependence of organic-matter decomposition—Still a topic of debate. Soil Biol. Biochem. 2006, 38, 2510–2518. [Google Scholar] [CrossRef]
- Liu, H.S.; Liu, H.J.; Wang, Z.P.; Xu, M.; Han, X.G.; Li, L.H. The Temperature Sensitivity of Soil Respiration. Prog. Geogr. 2008, 27, 51–60. [Google Scholar]
- Liu, X.; Zhang, W.; Zhang, B.; Yang, Q.; Chang, J.; Hou, K. Diurnal variation in soil respiration under different land uses on Taihang Mountain, North China. Atmos. Environ. 2016, 125, 283–292. [Google Scholar] [CrossRef]
- Wang, X.; Piao, S.; Ciais, P.; Janssens, I.A.; Reichstein, M.; Peng, S.; Wang, T. Are ecological gradients in seasonal Q10 of soil respiration explained by climate or by vegetation seasonality? Soil Biol. Biochem. 2010, 42, 1728–1734. [Google Scholar] [CrossRef]
- Jiang, J.; Guo, S.; Zhang, Y.; Liu, Q.; Wang, R.; Wang, Z.; Li, N.; Li, R. Changes in temperature sensitivity of soil respiration in the phases of a three-year crop rotation system. Soil Tillage Res. 2015, 150, 139–146. [Google Scholar] [CrossRef]
- Chen, B.; Liu, S.; Ge, J.; Chu, J. Annual and seasonal variations of Q10 soil respiration in the sub-alpine forests of the Eastern Qinghai-Tibet Plateau, China. Soil Biol. Biochem. 2010, 42, 1735–1742. [Google Scholar] [CrossRef]
- Chatterjee, A.; Jenerette, G.D. Changes in soil respiration Q10 during drying–rewetting along a semi-arid elevation gradient. Geoderma 2011, 163, 171–177. [Google Scholar] [CrossRef]
- Bekku, Y.S.; Nakatsubo, T.; Kume, A.; Adachi, M.; Koizumi, H. Effect of warming on the temperature dependence of soil respiration rate in arctic, temperate and tropical soils. Appl. Soil Ecol. 2003, 22, 205–210. [Google Scholar] [CrossRef]
- Kaisermann, A.; Roguet, A.; Nunan, N.; Maron, P.A.; Ostle, N.; Lata, J.C. Agricultural management affects the response of soil bacterial community structure and respiration to water-stress. Soil Biol. Biochem. 2013, 66, 69–77. [Google Scholar] [CrossRef]
- Wei, X.Y.; Liu, X.J. Microbial ecological characteristics of planted saline-alkali soil in coastal saline area by freezing saline water irrigation. J. Agric. Univ. Hebei 2014, 37, 22–26. [Google Scholar]
Abandoned Saline Soil | |
---|---|
Salinity (g/kg) | 7.74 ± 1.83 |
Organic matter (g/kg) | 3.61 ± 0.05 |
Available P (mg/kg) | 2.81 ± 0.36 |
Available K (mg/kg) | 29.9 ± 2.95 |
Ammonium N (mg/kg) | 1.78 ± 0.33 |
Nitrate N (mg/kg) | 14.5 ± 1.11 |
Bulk density (g/cm3) | 1.57 ± 0.07 |
pH (H2O, 1:5) | 8.15 ± 0.17 |
Target Group | Primers | Sequences | |
---|---|---|---|
Bacteria (16S) | 1369F | CGGTGAATACGTTCYCGG | [27] |
1492R | GGWTACCTTGTTACGACTT | ||
Probe TM1389F | CTTGTACACACCGCCCGTC | ||
Fungi (18S) | FungiQuant-F | GGRAAACTCACCAGGTCCAG | [28] |
FungiQuant-R | GSWCTATCCCCAKCACGA | ||
Actinomycetes | 243F | GGATGAGCCCGCGGCCTA | [29] |
513R | CGGCCGCGGCTGCTGGCACGTA |
Treatments | Seedling Stage | Bud Stage | Flowering Boll-Forming Stage | Boll Opening Stage |
---|---|---|---|---|
FSWI + Mulch | 1.26 ± 0.07a | 1.13 ± 0.08b | 1.29 ± 0.12b | 1.23 ± 0.04b |
Mulch | 1.42 ± 0.25a | 1.20 ± 0.17b | 1.41 ± 0.35ab | 1.47 ± 0.16ab |
FSWI | 1.24 ± 0.16a | 1.43 ± 0.07a | 1.60 ± 0.29a | 1.63 ± 0.29a |
CK | 1.46 ± 0.29a | 1.46 ± 0.05a | 1.59 ± 0.24a | 1.60 ± 0.07a |
Treatments | Taproot (g) | Limb (g) | Foliage (g) | Yield (hm2/kg) |
---|---|---|---|---|
FSWI + Mulch | 22.07 ± 2.35a | 92.86 ± 5.67b | 74.86 ± 3.89b | 10.55 ± 0.54a |
Mulch | 15.97 ± 1.98b | 104.21 ± 3.78a | 88.58 ± 4.23a | 4.21 ± 0.21b |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, X.; Guo, K.; Feng, X.; Liu, H.; Liu, X. Soil Respiration Response to Long-Term Freezing Saline Water Irrigation with Plastic Mulching in Coastal Saline Plain. Sustainability 2017, 9, 621. https://doi.org/10.3390/su9040621
Li X, Guo K, Feng X, Liu H, Liu X. Soil Respiration Response to Long-Term Freezing Saline Water Irrigation with Plastic Mulching in Coastal Saline Plain. Sustainability. 2017; 9(4):621. https://doi.org/10.3390/su9040621
Chicago/Turabian StyleLi, Xiaoguang, Kai Guo, Xiaohui Feng, Haiman Liu, and Xiaojing Liu. 2017. "Soil Respiration Response to Long-Term Freezing Saline Water Irrigation with Plastic Mulching in Coastal Saline Plain" Sustainability 9, no. 4: 621. https://doi.org/10.3390/su9040621
APA StyleLi, X., Guo, K., Feng, X., Liu, H., & Liu, X. (2017). Soil Respiration Response to Long-Term Freezing Saline Water Irrigation with Plastic Mulching in Coastal Saline Plain. Sustainability, 9(4), 621. https://doi.org/10.3390/su9040621