Skip to Content
SustainabilitySustainability
  • Article
  • Open Access

28 March 2023

New Fungal Strains from Peat Soil in Malaysia: Morphological and Molecular Characteristics

,
,
,
,
,
,
and
1
Department of Civil Engineering, Faculty of Civil Engineering and Build Environment, Universiti Tun Hussein Onn Malaysia, Parit Raja, Batu Pahat 86400, Johor, Malaysia
2
Department of Applied Microbiology, Faculty of Applied Sciences, Taiz University, Taiz 6803, Yemen
3
Micropollutant Research Centre (MPRC), Institute of Integrated Engineering, Universiti Tun Hussein Onn Malaysia, Parit Raja, Batu Pahat 86400, Johor, Malaysia
4
Faculty of Applied Sciences and Technology, Universiti Tun Hussein Onn Malaysia (UTHM), Pagoh Higher Education Hub, KM 1, Jalan Panchor, Panchor 84000, Johor, Malaysia

Abstract

Fungi have unique properties and are used in many areas of agriculture and industry because they can produce different enzymes. This study aims to study the fungal diversity in peat soil from Pontian in Johor, Malaysia. The fungal isolates were described on different culture media and on a new culture medium called EVA medium and were identified using the phenotypical characteristics and molecular properties of the D1/D2 domain of the 28S large subunit ribosomal RNA (28S rRNA) and ITS (ITS1-ITS4) rDNA regions. The results revealed that 14 fungal species (15 isolates) were identified, among them, 6 were categorized as newly isolated strains and recorded in Malaysia; these include Aspergillus arenarioides EAN603, A. iizukae EAN605, Paraconiothyrium brasiliense EAN202, Parengyodontium album EAN602, Penicillium pedernalense EAN604, and Purpureocillium lilacinum EAN601. The cultural, morphological, microstructure, and molecular characteristics of these new strains have been described in this study. It was noted that the EVA medium exhibited a moderate support for fungal growth and sporulation compared to other culture media. Furthermore, the efficiency of the new medium as an enrichment medium to isolate fungi from peat soils with high ligninolytic content was discussed.

1. Introduction

Many fungal strains were isolated from the soil because they were available for the fungus growth needs, including the decomposition of plants [1]. Hawksworth and Lücking [2] estimated that there are 3.8 million species of fungal organisms on Earth, of which only 70,000 have been identified and described. Based on next-generation sequencing, the number of fungal species ranged between 3.5 and 5.1 million [3]. Gams [4] indicates that 3150 fungal strains were isolated from the soil, and 70% were cultivated in a culture medium. Many fungi species have been isolated from the peatland of the world. Similar studies have also been conducted in Malaysia including Perak, Pahang, and [5,6]. The abundance of fungi in wetlands has changed according to the plants that dominate the soil. Johor’s peatlands account for 11% of Malaysia’s total peatlands (26,000 km2). However, there has been little research on this subject compared to the country’s total peatland area. Kin et al. [7] isolated Isaria amoenerosea and Metarhizium anisopliae from peat soil in Peninsular Malaysia. Omar et al. [8] isolated 20 fungal species belonging to Aspergillus and Penicillium from the peatland in Sarawak, Malaysia. However, these studies have been conducted in different locations. Peatlands are a rich source of fungal diversity, which play an important role in the element cycle. A wide variety of fungal species are associated with the high water and organic content of the peatland, which acts as a carbon source for fungal species growth. Exploring different types of grassland in different regions provides an opportunity to discover new fungal species of high economic and ecological value. Many fungal species, such as Ceriporiopsis subvermispora, Ganoderma lucidum, Penicillium citrinum, Peniophora incarnate, Phanerochaete chrysosporium, Phlebia tremellosa, Physisporinus rivulosus, Pleurotus ostreatus, Pleurotuseryngii, Trametes versicolor, and Trichaptum abietinum, have been isolated from soil and used in the environmental technology such as degradation of organic pollutants [9,10,11,12,13]. The high applicability of fungi in industrial and environmental applications such as fermentation and bioremediation processes are due to high extracellular enzyme production. Enzymes such as amylase, cellulase, chitinase, pectinase, lipase, protease, peroxidase, and laccase have high applicability to degrade complex compounds into simple substances.
Malaysia is one of the high-biodiversity countries in the world due to its rich natural and environmental resources [14]. The importance of flora as a valuable source of fungi needs to be studied in more depth. The information obtained could be used to activate agriculture and infrastructure. In fact, Malaysia is a subtropical country with a moderate and high-humidity climate and large forests, providing favourable conditions for fungus diversity [15]. The biodiversity of tropical forest decomposers is three times greater than that of other forest ecosystems [16]. Nevertheless, fungi isolation and screening in these places have not yet been systematically initiated [16,17]. The study aimed to explore the fungal diversity in Pontian’s peatlands to develop a fungus load inventory and to serve as a database for future research, emphasising the originality of the present work. The study also focuses on recovering the fungal isolates on different culture media and suggests a new medium (EVA or EFAQ medium) in order to provide a more suitable medium for fungal strains isolated from peat soil with high ligninolytic compounds.

2. Materials and Methods

2.1. Peat Soil Sample

The peat soil samples were collected from Kampung Medan Sari (1°28′24.5″ N 103° 26′35.96″ E) located at Pontian, Johor (Figure 1). This study location was chosen because it is far from agricultural and development activities and is classified as a virgin peatland. The sampling point area is 100 m2. The samples were obtained by scraping a freshly exposed surface at a depth of 1 m. Three samples (1 kg for each sample) were collected from each area in sterile zipper polythene bags, then immediately transferred to the laboratory of Universiti Tun Hussein Onn Malaysia (92 km from the study area) and stored at 4 °C until use within one month of collection [18].
Figure 1. The map of the sampling location at Kampung Medan Sari, Pontian, Johor, Malaysia.

2.2. Media Preparation

The morphology of the fungal isolates was observed on Potato Dextrose Agar (PDA, Oxoid, Hampshire, UK), V8 juice agar medium (V8A) (Himedia, Thane, India), Czapek-Dox Agar (CZ, R&M Marketing, Henfield, UK), Malt Extract Agar (MEA, Merck, Darmstadt, Germany), Czapek yeast extract Agar (CYA, Oxoid, UK), Sabouraud dextrose agar (SDA, HiMedia, India), and CZ medium with Rose bengal (CZR) (Himedia, India). The media were used to obtain an accurate description of the fungal isolates. According to the preparation protocol, the media were prepared by adding one litre of distilled water in a glass bottle, mixing well with magnetic stirrers, and adjusting pH (according to the preparation protocol for each media) using NaOH (0.1 M) and HCl (0.1 N).
A new medium named Pumpkin Peel Medium (with the abbreviation of EVA) was used for the first time to describe the fungal growth and its applicability in isolating fungal species from peat soil with high contents of ligninolytic substances. Pumpkin peels were used as a substrate to confirm the ability of the fungal isolates to use the ligninolytic substances as a source of carbon for their growth. Since peat soil has high ligninolytic materials, this medium was suggested as a rich medium with ligninolytic materials to recover the fungi from peatlands. EVA medium was prepared by cutting 200 g of the Pumpkin peels into small pieces (1 cm) and then by crushing using a mortar and pestle. The crushed pumpkin peels were boiled for 10 min, and then the extract was harvested using white gauze. The extract was transferred to a 1 L conical flask and filled with distilled water. Then, 15 g of agar was added, and the mixture was homogenised using a magnetic stirrer (125 rpm) for 10 min, pH was adjusted to 5.5. All cultural media were automatically autoclaved for 20 min at 15 pounds per square inch (psi) and 121 °C prior to use.
After the culture media cooled down to a lukewarm temperature, 4 mL of chloramphenicol was added to each medium to prevent bacterial growth. The media were poured into the Petri plates in a laminated flow chamber and maintained within 3 days for use.

2.3. Fungal Strains Isolation and Purification from Soil Samples

The fungal isolates were isolated from the peat soil samples by culture-based method (the colony-forming unit, CFU) using the standard serial dilution spread plate method on Potato Dextrose Agar (PDA, Oxoid, UK) medium [19,20], as described in previous work [21]. The isolated fungi were purified following Noman et al. [22].

2.4. Phenotypic and Molecular Analysis of Fungi Isolated from Peatland Samples

The fungal isolates were identified based on morphological and molecular analysis as follows: The colony size (mm diameter) and surface were described on nine culture media after seven days of incubation at 28 °C. The primary identification of the fungal isolates was performed following the description in different references in the literature [23,24,25,26,27,28,29]. The microstructure of fungal conidiophore and spore shapes were observed using SEM. The fungal isolates with pure culture were sub-cultured on new PDA medium, incubated at 28 °C for 2–3 days.
The molecular fungal identification was conducted based on the D1–D2 region of the 28S rRNA sequences using a PCR thermal cycler, “Veriti 96 Well Thermal Cycler”, with a primer set, F63 and LR3, to amplify the D1–D2 region of the 28S rRNA at the Centre of Chemical Biology, USM (CCB, USM). The primers’ sequences for D1/D2 region of 28S rRNA were as follows: forward primer F63 (5′ GCATATCAATAAGCGGAGGAAAAG) and reverse primer LR3 (5′ GGTCCGTGTTTCAAGACGG 3′) according to Fell et al. [30]. The internal transcribes spacer (ITS) primers, ITS 1 (5′ TCCGTAGGTGAACCTGCGG 3′) and ITS 4 (5′ TCCTCCGCTTATTGATATGC 3′) were used to amplify the ITS rDNA region [31]. For B-tubulin, primers were Bt2a Forward 5’ GGT AAC CAA ATC GGT GCT GCT TTC 3’ and Bt2b Reverse 5’ ACC CTC AGT GTA GTG ACC CTT GGC 3’ [32].
To construct the phylogenetic tree, the sequences of each fungal strain which was obtained from PCR amplification were inserted into NCBI GenBank. Among several fungal strains, the sequences with 100% similarity at the website of NCBI GenBank were downloaded. The sequences obtained were subjected to multiple alignments using ClustalX2.1. The aligned sequences for the selected fungi were inserted into the PAUP4 software program and subjected to the rotating process. The phylogenetic tree was constructed based on a neighbour joining UPGMA algorithm.

2.5. Raman Spectroscopy

The chemical composition of the fungal mycelium cell walls was analysed using Raman spectroscopy. Each fungal strain was cultured for 5 days in a PDA medium containing 1% dimethyl sulphoxide (DMSO) to prevent the production of fungal pigment that could negatively affect the analysis. A small piece of fungal mycelium (1 × 1 cm) was placed on the surface of a glass slide and employed in Raman spectroscopy (Horiba, Kyoto, Japan) for analysis.

3. Results and Discussion

3.1. Fungal Isolates from Peat Soil

A total of 14 fungal species were isolated from 9 peat soil samples. The fungal strains were recognised in 9 genera and 15 strains and deposited in NCBI (Table 1).
Table 1. Fungal strains from peatlands and their accession number.
Six fungal strains were identified for the first time in Malaysia based on the comparison with the checklist of fungi in Malaysia, as reported by only one study conducted by Lee et al. [33]. Moreover, to confirm the list of fungi in Malaysia up to 2020, the Scopus database (877 documents) for fungi in Malaysia using specific key works (“Malaysia” AND “fungi” OR “macrofungi”) was downloaded and subjected to bibliometric analysis based on the keywords using VOSviewer software. The 877 documents were compared with the list of all the fungi reported in Malaysia and compared to the fungal list identified in the current study (Figure 2). The 28S and ITS rDNA sequences of fungal isolates are illustrated in Table S1.
Figure 2. Bibliometric analysis for the fungi reported in Malaysia up to date (20 September 2020).
Each fungal species was searched in the Scopus database as “Malaysia” and fungal species name, for example, Aspergillus arenarioides, to confirm whether it has been reported before. It was noted that the fungal strains named Aspergillus arenarioides EAN603, Parengyodontium album EAN602, Aspergillus iizukae EAN605, Paraconiothyrium brasiliense EAN202, Purpureocillium lilacinum EAN601, and Penicillium pedernalense EAN604 were new strains, and this is the first report about them in Malaysia. According to the Scopus database record, the new fungal strains have very few studies; for example, it was noted that A. arenarioides has only been reported in two studies conducted in USA and Brazil [34,35], while Penicillium pedernalense has only been reported in one study conducted in Spain [36].

3.2. Culture Morphology of the Fungal Isolates from Peat Soil

3.2.1. Aspergillus spp.

The fungal strains were described on nine different culture media, including PDA, V8, MEA, CYA, CZ, SDA (4%), SDA, EVA, and DCZ. Three fungal strains were identified as species of Aspergillus and deposited in NCBI as Aspergillus iizukae EAN605 (MK518343), Aspergillus aculeatus EAN506 (MK518351), and Aspergillus arenarioides EAN603 (MK518366) (Figure 3). These strains exhibited differences in form, texture, colour, margin, growth pattern, elevation, and colony size (Figure 3). The colonies of A. aculeatus were black with a diameter ranging from 29 ± 7.4 mm in SDA to 80 mm on V8A and CZ medium; the fungus grown well at 37 °C (the colonies ranged from 40 ± 3.9 mm on CYA to 25 ± 6.6 mm on SDA) (Table S1). In comparison, A. arenarioides were grow in light brown and white orchards with 17 ± 1.74 mm in CZRB and 45 ± 6.3 mm on MEA, and no growth was detected for this fungal strain at 37 °C (Figure 4). A. aculeatus produced high sporulation on different culture media compared to A. arenarioides. A. iizukae EAN605 showed rapid growth in a single white wool texture and a brown reversal in different cultural media (Figure 3). Hubka et al. [37] mentioned that A. iizukae grows with a red or brownish soluble pigment. The fungus had high variable characteristics in the different culture media. The colonies of A. iizukae ranged from 23 ± 1.8 on DCZ to 33 ± 5.2 mm on SDA, considered the best for fungal growth. The fungus exhibited a weak growth at 37 °C, ranging from 10 ± 1.4 on CYA to 18 ± 0.3 on SDA (Table S1). Similar findings were also reported by Hubka et al. [37], where the colonies’ diameters ranged from 16 to 32 mm on CYA at 25 °C to 18–21 mm at 37 °C. On EVA medium, A. aculeatus EAN506 exhibited similar growth to that noted on V8A and CZ with a colony size of 80 ± 0.0 mm. However, the colonies were black on EVA while brown on the V8A. Aspergillus arenarioides EAN603 had a weak growth (19 ± 1.4 mm) on EVA medium compared to MEA (21 ± 0.4 mm), but similar colonial morphology was noted on both media. A. aculeatus exhibited very high sporulation in SDA and EVA media; at 37 °C, the fungus colonies were 40 ± 3.9 mm on CYA and 25 ± 6.6 mm on SDA (Table S1). In comparison, A. arenarioides has low sporulation on CZ, CYA, PDA, EVA, and SDA media, while no sporulation was recorded on MEA and V8A media. No growth of the fungus was observed at 37 °C.
Figure 3. Aspergillus iizukae EAN605, Aspergillus arenarioides EAN603, and Aspergillus aculeatus EAN506, obtained from peat soil cultured on different culture media (at 28 °C for 7 days).
Figure 4. Culture morphology of Penicillium crustosum EFAQ406, Penicillium verruculosum EAN203, Penicillium pedernalense EAN604, and Penicillium crustosum EFAQ405, obtained from peat soil cultured on different culture media (at 28 °C for 7 days).

3.2.2. Penicillium spp.

Four fungal strains were classified within Penicillium spp., including P. verruculosum EAN203 (MK518350), P. crustosum EFAQ406 (MK530088), P. pedernalense EAN604 (MK518385), and P. crustosum EFAQ405 (MK530708). It was observed that the strains EFAQ405 and EFAQ406 belonged to P. crustosum. However, the strains exhibited little difference in their culture characteristics (colony morphology and diameter) (Figure 4). The colonies of P. crustosum EFAQ405 ranged from 15 ± 1.9 on SDA (4% sucrose) to 25 ± 2.5 mm on PDA. In contrast, P. crustosum EFAQ406 was between 16 ± 0.6 on SDA (4% sucrose) and 30 ± 8.3 mm in V8A. In EVA medium, the average number of colonies of P. crustosum EFAQ405 was 23 ± 1.8 mm, while it was 12 ± 3.1 mm for P. crustosum EFAQ406. P. verruculosum EAN203 grows with black to white colonies and pink edges, while P. pedernalense EAN604 is a dark green colony with white edges (Figure 3). In EVA medium, the P. verruculosum EAN203 colonies had a gelatine-like colour with an average size of 28 ± 2.8 mm, while P. pedernalense EAN604 was dark green in EVA medium with a size of 30 ± 1.8 mm. Among the Penicillium spp., only P. verruculosum EAN203 exhibited at 37 °C with a colony size of 17 ± 0.8 mm on CYA and 15 ± 0.6 mm on SDA medium.

3.2.3. Other Fungal Isolates

Trichoderma viride 102UTHM (MK518057) and Trichoderma asperellum 303UTHM (MK518056) (Figure 3) exhibited similar cultural characteristics. Both strains exhibited high growth (the colony size was 80 ± 0.0 mm on all media). The Paraconiothyrium brasiliense EAN202 strain grew well in all culture media and exhibited high differences in the colony’s morphologies and sizes (Figure 5). It was noted that the strain was grown with a white colony on PDA (the diameter was 21 ± 2.2 mm) and yellow colonies on V8A (the diameter was 39 ± 4.9 mm) and that the strain exhibited good growth on the EVA medium (the colony size was 18 ± 1.4 mm). No fungal growth was observed at 37 °C.
Figure 5. Culture morphology of Trichoderma asperellum 303UTHM, Trichoderma viride 102UTHM Cochliobolus geniculatus EAN403, and Paraconiothyrium brasiliense EAN202, obtained from peat soil cultured on different culture media (at 28 °C for 7 days).
Cochliobolus geniculatus EAN403 showed the highest growth on EVA, MEA, CYA, CZ and SDA medium (the colony size was 18 ± 1.4 mm) (Figure 5). On EVA medium, colonies appeared green in colour, while they were brownish on V8A. On average, the growth at 37 °C was 17 mm on both CYA and SDA. The Fusarium solani 504EFAQ strain has white colonies in all culture media, with sizes ranging from 56 ± 5.9 mm on SDA to 71 ± 7.4 mm on V8A (Figure 6). On EVA, the colony size was 68 ± 2.7 mm. The fungi exhibited weak growth at 37 °C with colony sizes of 5 ± 0.6 mm on CYA and 8 ± 0.6 mm on SDA. The fungus exhibited high sporulation of the different culture medium. The Purpureocillium lilacinum EAN601 strain had a similar colony morphology in the different culture media but with different colony sizes (Figure 6). The highest growth was observed in V8A (36 ± 7.8 mm), while the lowest growth appeared on DCZ (9 ± 0.65 mm), without growth recorded at 37 °C. The Parengyodontium album EAN602 strain has a weak and slow growth on all culture media, with the colony sizes ranging from 9 ± 0.7 mm on SDA (4% sucrose) to 39 ± 4.9 mm on V8A medium.
Figure 6. Culture morphology of Purpureocillium lilacinum EAN601, Fusarium solani 504EFAQ, Schizophyllum commune 104UTHM, and Parengyodontium album EAN602, obtained from peat soil cultured on different culture media (at 28 °C for 7 days).
The results of this study show that the PDA and V8A media support the growth of a variety of fungi; both are standard means of isolating fungi. These findings agree with those reported by Saha et al. [38]. However, V8A has been shown to be necessary to isolate fungi with complex growth and spore growth requirements [39].

3.3. Microscopic Morphology of the Fungal Isolates from Peat Soil

Scanning electron micrographs of A. aculeatus reveal that this fungal strain has a long and smooth conidiophore with a round vein, a radiating head, and a biseriate phialid (Figure 7A). The spores are globular and ornamented with echinulate spiny texture (Figure 4), and the spore size ranges from 1.45 to 4.02 µm (Table S1, Figure S2). Moreover, A. arenarioides has a long, smooth conidiophore, a small column head, and a biseriate phialid (Figure 7B). The spores are globular and subglobular, and the texture of the spore is smooth/finely ripe (Figure 7B1). The spore size was between 1.6 and 4.3 µm (Table S1). A. iizukae EAN605 showed a spiny and long conidiophore with globose or pyriform vesicle, radiate head, and biseriate phialids (Figure 4). Furthermore, the fungal spores were globular in shape/smooth of texture. The spore size ranged from 2.6 to 4.1 µm (Figure 7 and Figure S2, Table S1). A similar observation was also recognised in the previous identification of this fungal strain in the Czech Republic [37]. The phylogenetic analysis of A. iizukae EAN605 recognised the strain with A. flavipes, A. neo flavipes, and A. spelaeus. According to Peterson [40], the analysis of large subunit rDNA sequences indicated that A. iizukae belongs to the Aspergillus section Flavipedes. Sect. Flavipedes members are distributed in subtropical and tropical soils [4,41]. Similarly, Varga and colleagues [42] found similar tree topology in the analysis of ITS rDNA. A. iizukae, A. frequent, and A. mangaliensis are species distributed worldwide, with sequence data deposited at GenBank. It has been isolated as herb and tree endophytes [43,44,45,46].
Figure 7. SEM images of fungi; (A) A. aculeatus EAN506 conidiophore (600×); (A1) spores (3000×); (B) A. arenarioides EAN603 conidiophore (2000×); (B1) spores (3000×); (C) A. iizukae EAN605 conidiophore (1500×); (C1) spores (500×).
Aspergillus iizukae Sugiy. 1967, J Fac Sci Univ Tokyo, Sect 3, Bot: 390; FIGS. 3, 7, Typification. JAPAN. GYMNA PREFECTURE: Fujioka, ex-soil from stratigraphic drilling core, 26 Jun 1969, J. Sugiyama (holotype TI 0007. Ex-holotype culture NRRL 3750 5 CBS 541.69 5 IMI 141, 552 5 CCF 4548).
Aspergillus iizukae is distributed worldwide in soil, including in the Czech Republic, Germany, Japan, and Romania, as well as in the USA [37]. However, it has not been reported in Malaysia. Moreover, very few studies have been conducted on A. iizukae based on the Scopus database search. The studies included the application of the fungus as potential antiviral xanthones [47], biological control agents of Duponchelia fovealis [48], Antioxidant aromatic butenolides [49], a source for diphenyl derivatives [50], and bioactive secondary metabolites [43,51].
P. crustosum 405EFAQ conidiophore appeared with a smooth surface, while P. crustosum 406EFAQ had a spiny conidiophore (Figure 8 and Figure S2). Furthermore, the spore size of the EFAQ405 strain ranged from 3.05 to 5.54 µm, while it ranged from 2.47 to 4.29 µm for the EFAQ406 strain. The P. verruculosum EAN203 and P. pedernalense EAN604 strains have a similar conidiophore structure and length, as well as the texture of the spore (Figure 9 and Figure S4). However, the 28S rRNA sequences revealed that the strains belonged to different fungal species. The spores’ sizes ranged from 1.65–3.25 µm for P. verruculosum EAN203 to 1.66–3.33 µm for P. pedernalense EAN604.
Figure 8. SEM images of fungi; (A) P. crustosum 405EFAQ conidiophore (1200×); (A1) spores (3000×); (B) P. crustosum 406EFAQ conidiophore (2000×); (B1) spores (5000×).
Figure 9. SEM images of fungi; (A) P. verruculosum EAN203 conidiophore (3000×); (A1) spores (9000×); (B) P. pedernalense EAN604 conidiophore (1610×); (B1) spores (5000×).
Trichoderma viride 102UTHM (MK518057) (Figure 10A and Figure S5) and Trichoderma asperellum 303UTHM (MK518056) (Figure 7B) also exhibited similar cultural characteristics. However, the main differences were shown in the spore texture, as determined by SEM analysis. The spore size of Trichoderma viride 102UTHM was between 2.0 and 4.4 µm, while T. asperellum 303UTHM had a spore size between 2.2 and 3.8 µm. P. album EAN602 strain (Figure 11A) has no spores, while P. brasiliense EAN202 (Figure 11B) exhibited very low sporulation on V8A, MEA, and SDA. The microstructures of both fungi have no clear conidiophore and spores. In contrast, C. geniculatus had very high sporulation on all media, with a clear microstructure (Figure 11). F. solani EFAQ504 ranged from 7.95 to 26.17 µm, while P. lilacinum EAN601 has a spore size between 1.65 and 2.01 µm, and both fungal strains have long and smooth conidiophores (Figure 12A,B and Figure S7).
Figure 10. SEM images of fungi: (A) T. viride 102UTHM (1000×); (A1) spores (13,120×); (B) T. asperellum 303UTHM (1000×); (B1) spores (13,120×).
Figure 11. SEM images of fungi: (A) P. album EAN602 (329×); (A1) P. brasiliense EAN202 (500×); (B) C. geniculatus EAN403 (200 ×); (B1) spores (1000×).
Figure 12. Scanning electron micrographs of fungal strains from peatland: (A) F. solani EFAQ504 (2000×); (B) P. lilacinum EAN601 (2000×).
S. commune 104UTHM, having a hyaline, smooth, septate, and branched hyphae of two widths, included wider hyphae and narrower width hyphae, with clamp connections and spicules (Figure 13). Won et al. [52] and Chowdhary et al. [53] reported similar findings. S. commune 104UTHM exhibited dikaryotic (binucleate condition) and monokaryotic stages in the life cycle. Moreover, the microscopic morphology of S. commune 104UTHM shows binucleate in the hyphae as well as spicules and clamp connections on hyphae.
Figure 13. SEM images of S. commune 104UTHM (A) a wider hypha; (B) a narrower width hypha; (C) the clamp connections and spicules (2000×).
The microstructure characteristics, cultural characteristics, and molecular analysis are useful for identifying the fungal strains. However, Hubka et al. [37] reported that the significant variability in the shape and dimensions among the same Aspergillus spp. make these structures unsuitable for the identification process. The length, texture, shape, and orientation were also helpful in identifying the fungal strains. However, the conidiophores’ lengths vary greatly. Many fungal species are longer than 1mm, so their characteristics are inaccurate and do not help with species identification [33]. Therefore, culture and morphological characteristics are insufficient to accurately fungal identification. Molecular analysis based on the D1/D2 of the 28S rRNA sequence was used to confirm the identification of fungi. Many studies have stated that sequencing of the D1/D2 region is the recognised gold standard for fungal identification [54]. However, the morphological findings and molecular data were compared to ensure consistency and identification of the fungus strains in the current work.

3.4. Molecular Characteristics of Fungal Isolates from Peat Soil

In comparison between the molecular analysis and morphological characteristics (culture and microstructure), it was noted that the morphological characteristics accomplished the identification process of the fungal isolates alongside the molecular analysis. The identification of the current fungal isolates based on ITS and 28S rRNA was not sufficient to identify and establish the fungal strains, while the morphological characteristics provided the details which helped to determine the fungal strains. For examples, P. crustosum (405EFAQ and 406EFAQ) shares the highest homology with P. ulaiense, P. crustosum, P. resticulosum, P. granulatum, P. solitum, P. caseifulvum, and P. italicum (Figure 14), while the morphological characteristics supported the identification of the fungal species as P. crustosum, according to Sang et al. [55]. However, the conidiophore of P. crustosum (405EFAQ) occurred with a smooth surface and size between 3.05 to 5.54 µm, while P. crustosum 406EFAQ has a spiny conidiophore, and size between 2.47 and 4.29 µm. Therefore, we considered that these isolates belong to same fungal species but different strains. A. iizukae EAN605 shows the highest homology with A. flavipes and A. neo flavipes (Figure 11). However, the culture morphology and microstructure were more similar to that reported by Hubka et al. [37]; therefore, it was recognized as A. iizukae. Further, A. arenarioides EAN603 shows the highest homology with A. petersonii (Figure 14); however, with the morphological characteristics and microstructure of the conidiospores and spores the fungal strain was more related to A. arenarioides EAN603, similar to the descriptions of Visagie et al. [56], since A. petersonii has high spiny conidiospores with a different ornament spore surface [34]. A. aculeatus EAN506 shows the highest homology with A. violaceofuscus, A. niger, A. fijiensis, A. brunneoviolaceus, and A. japonicus (Figure 14). However, based on the culture morphology and microstructure properties and compared to previous studies which described the fungal species [57,58], the fungal strain was identified as A. aculeatus EAN506. P. pedernalense EAN604 shows the highest homology with P. mariae-crucis, P. brasilianum, P. simplicissimum, P. pulvillorum, and T. biappendiculata (Figure 11) However, T. biappendiculata was totally excluded since it has different spore morphology [59]; P. brasilianum was excluded based on the culture morphology reported by Freire et al. [60]; while P. pulvillorum was excluded based on the spore’s morphology as reported by Mansouri et al. [61]. Together with the morphological characteristics in comparison with Laich and Andrade [36], the fungal strain was recognized as P. pedernalense EAN604. P. verruculosum EAN203 grew with black to white colonies and pink edges, while P. pedernalense EAN604 occurred as a dark green colony with a white edge. Both strains have a similar conidiophore structure and length as well as the spore texture. However, the 28S rRNA sequences revealed that the strains belonged to different fungal species. P. verruculosum EAN203 exhibited the highest homology with P. flavus, P. marneffei, T. aculeatus, T. verruculosus, T. angelicus, and T. flavus (Figure 14). The excluding of T. flavus was based on the morphology described by Dethoup et al. [62]; T. aculeatus and T. verruculosus were excluded according to the description by Yilmaz et al. [63]; P. marneffei was excluded based on the description by [64]; and T. angelicus was excluded according to the description by Sang et al. [65]; according to Shah et al., the fungal strains were closer to P. verruculosum EAN203 [66].
Figure 14. Phylogenetic tree showing the relationship between Aspergillus spp. and Penicillium spp. and the relevant selected sequences based on 28S rRNA sequence comparisons.
Trichoderma viride 102UTHM and Trichoderma asperellum 303UTHM share the highest homology in the 28S rRNA sequences with T. viride, T. paucispinum, T. asperellum, T. atroviride, T. hamatum, and T. pubescens (Figure 15), as well as the cultural characteristics on the culture media. Together with the morphological identification, we determined the strain 303UTHM to be T. asperellum, as described by Wu et al. [67]. However, T. viride 102UTHM also exhibited similar culture characteristics. The main differences appeared in the spore texture determined by SEM analysis. T. viride 102UTHM spores were between 2.0 and 4.4 µm with strong warted surface, while T. asperellum 303UTHM spores were between 2.2 and 3.8 µm, with a less strongly warted surface. These observations were also reported by Meyer and Plaskowitz [68], who revealed that T. viride had warted more strongly, while T. asperellum had fewer conidia or weak warted conidia [69,70].
Figure 15. Phylogenetic tree showing the relationship between Trichoderma spp. and the relevant selected sequences based on 28S rRNA sequence comparisons.
Parengyodontium album EAN602 shows the highest homology with Verticillium sp. (Figure 16). However, according to previous studies for both species [71,72,73], the fungal isolate is closer to P. album EAN602. P. lilacinum EAN601 shows the highest homology with Aschersonia sp. (Figure 17), which was excluded according to the spore’s morphology as reported by Sudiarta et al. [74], and recognized as closer to P. lilacinum according to Deng et al. [75] and Perdomo et al. [76].
Figure 16. Phylogenetic tree showing the relationship between Parengyodontium album EAN602 and the relevant selected sequences based on 28S rRNA sequence comparisons.
Figure 17. Phylogenetic tree showing the relationship between Purpureocillium lilacinum EAN601 and the relevant selected sequences based on 28S rRNA sequence comparisons.
Fungal isolate no, 403UTHM shows the highest homology with C. geniculatus and is recognized as C. geniculatus 403UTHM, along with the morphological and culture characteristics as described by Kusai et al. [77] (Figure 18). Fungal isolate no. 104UTHM shows the highest homology with S. commune and was recognized as S. commune 104UTHM according to the description provided by Won et al. [52] and Chowdhary et al. [53] (Figure 19). Fungal isolate EAN202 exhibited the highest homology with Paraconiothyrium brasiliense (Figure 20).
Figure 18. Phylogenetic tree showing the relationship between Cochliobolus geniculatus 403UTHM and the relevant selected sequences based on 28S rRNA sequence comparisons.
Figure 19. Phylogenetic tree showing the relationship between Schizophyllum commune 104UTHM and the relevant selected sequences based on 28S rRNA sequence comparisons.
Figure 20. Phylogenetic tree showing the relationship between Paraconiothyrium sp. EAN202 and the relevant selected sequences based on 28S rRNA sequence comparisons.
It must be mentioned that it was very difficult to identify the isolates affiliated with Aspergillus and Penicillium into the taxonomical level of species in the absence of more sensitive gene sequences. Therefore, ITS and beta-tublin was used to confirm the fungal strain identification. A. aculeatus ITS sequences exhibited a similar homology to that reported using 28S rRNA and was identified as A. aculeatus EAN506, as mentioned above, while fungal isolates EFAQ405 and EAN403 ITS sequences exhibited the highest homology with only P. crustosum and C. geniculatus, respectively (Figure 21). In contrast, beta-tublin exhibited more accuracy and a homology closer to fungal strains such as Parengyodontium album EAN602, Aspergillus arenarioides EAN603, and Penicillium pedernalense EAN604, which facilitated and confirmed the identification process (Figure 22). However, it must be mentioned that the sequences of these strains have not been deposited in NCBI yet. Since, in many samples, the non-specific bands appeared, we used a gel extraction kit to purify the PCR products. More work is currently being conducted on these species for further studies.
Figure 21. Phylogenetic tree showing the relationship between Aspergillus aculeatus EAN506 (A), Penicillium crustosum EFAQ405 (B), Cochliobolus geniculatus EAN403 (C), and the relevant selected sequences based on ITS sequence comparisons.
Figure 22. Phylogenetic tree showing the relationship between Parengyodontium album EAN602 (A), Aspergillus arenarioides EAN603 (B), and Penicillium pedernalense EAN604 (C), and the relevant selected sequences based on ITS sequence comparisons.

3.5. Chemical Structure of the Fungal Mycelium

To explore the chemical structure of the mycelium cell wall, the mycelium for each fungal strain was analysed using Raman spectroscopy (Figure 23). The results showed that bands between 1300 and 1600 cm−1 indicate the presence of CH2 and CH3, and lipid deformation occurs on the surface of mycelium. In contrast, peaks from 1000 to 1050 cm−1 can be linked to the presence of lipids, fatty acids, and phenylalanine, as indicated by Fazio et al. [78]. The 1600 cm−1 peaks indicate an unsaturated fatty acid group attributed to the C=C expansion vibration [79]. These groups might have been contributed during the decolourisation of the dye and might have improved the adsorption of the dye on the surface of the fungal mycelium. P. pedernalense EAN604 and C. geniculatus EAN403 have a high peak between 2850 and 2950 cm−1, indicating cyclohexane compounds, such as symmetric CH2 stretching and asymmetric CH3 stretching, as well as polyethylene, polypropylene, and methine in these fungal strains.
Figure 23. Raman spectroscopy analysis of fungal strains’ mycelium cells.

4. Conclusions

Peat soil has a high fungal diversity with unique characteristics. This study has identified six fungal strains that are categorized as newly isolated strains and recorded in Malaysia. Different culture media differ in their ability to support fungal growth and sporulation. The EVA medium demonstrated good efficiency in supporting the fungal strains isolated from the soil due to its similar contents, such as the presence of the lignin. The chemical composition of the fungal strain, as determined using Raman spectroscopy, includes a variety of chemical compounds on the fungal surface (spores). However, since there is no database for fungal surface chemical composition, the Raman spectroscopy analysis is not applicable. Therefore, molecular analysis is used to confirm fungal identification.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/su15075902/s1.

Author Contributions

Conceptualisation, E.A.N. and A.A.A.-G.; methodology, E.A.N.; software, A.A.A.-G. and R.A.; validation, B.A.T., R.M.S.R.M., N.A.-S. and H.A.E.E.; formal analysis, R.M.S.R.M. and R.A.; investigation, E.A.N.; resources, R.M.S.R.M.; data curation, E.A.N.; writing—original draft preparation, F.A.A.-W. and E.A.N.; writing—review and editing, N.A.-S., A.A.A.-G., B.A.T., R.M.S.R.M. and H.A.E.E.; visualisation, B.A.T.; supervision, B.A.T. and R.M.S.R.M.; project administration, B.A.T. and A.A.A.-G.; funding acquisition, B.A.T. and H.A.E.E. All authors have read and agreed to the published version of the manuscript.

Funding

The authors acknowledge the financial support from Universiti Tun Hussein Onn (UTHM) and Teknologi Malaysia (UTM) through Industrial Grants (R.J130000.7609.4C359 and R.J130000.7609.4C468).

Institutional Review Board Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

The authors acknowledge the PhD Thesis of Efaq Ali Noman, UTHM (“Peatland fungi: identification, application in dye decolourisation and bacterial inactivation in greywater”), from which the text, tables, and figures in this article were derived.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Gaitnieks, T.; Silbauma, L.; Muižnieks, I.; Zaļuma, A.; Kļaviņa, D.; Burņeviča, N.; Grosberga, M.; Lazdiņš, A.; Piri, T. Spread of Heterobasidion genotypes in Norway spruce stands on drained peat soil in Latvia. Can. J. For. Res. 2022, 52, 499–510. [Google Scholar] [CrossRef] [Scilit]
  2. Hawksworth, D.L.; Lücking, R. Fungal diversity revisited: 2.2 to 3.8 million species. Microbiol. Spectr. 2017, 5. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Blackwell, M. The Fungi: 1, 2, 3… 5.1 million species? Am. J. Bot. 2011, 98, 426–438. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Gams, W. Biodiversity of soil-inhabiting fungi. Biodivers. Conserv. 2007, 16, 69–72. [Google Scholar] [CrossRef] [Scilit]
  5. Latiffah, Z.; Nurul Izzati, H.; Baharuddin, S. Fusarium species isolated from peat soil of Pondok Tanjung and Sungai Beriah, Perak. Malays. J. Microbiol. 2010, 6, 102–105. [Google Scholar] [CrossRef] [Scilit]
  6. Karim, N.F.A.; Mohd, M.; Nor, N.M.I.M.; Zakaria, L. Saprophytic and potentially pathogenic Fusarium species from peat soil in Perak and Pahang. Trop. Life Sci. Res. 2016, 27, 1–20. [Google Scholar]
  7. Kin, P.K.; Azmi, W.A.; Kamarudin, N.; Ali, S.; Moslim, R. The occurrence of entomopathogenic fungi on mineral and peat soils in Peninsular Malaysia, American. J. Agric. Biol. Sci. 2017, 12, 1–12. [Google Scholar] [CrossRef] [Scilit]
  8. Omar, F.N.; Ismael, N.H.; Ali, S.R.A. Fungi associated with deep peat soil Sarawak. In Proceedings of the UMT 11th International Annual Symposium on Sustainability Science and Management, Kuala Terengganu, Malaysia, 9–11 July 2012; pp. 239–245. [Google Scholar]
  9. Allen, L.V., Jr. Quality Control: Water Activity Considerations for Beyond-use Dates. Int. J. Pharm. Compd. 2018, 22, 288–293. [Google Scholar]
  10. Khan, S.; Ali, S.A.; Ali, A.S. Biodegradation of low-density polyethylene (LDPE) by mesophilic fungus ‘Penicillium citrinum’ isolated from soils of plastic waste dump yard, Bhopal, India. Environ. Technol. 2022, 1–15. [Google Scholar] [CrossRef] [Scilit]
  11. Ruiz-Dueñas, F.J.; Morales, M.; García, E.; Miki, Y.; Martínez, M.J.; Martínez, A.T. Substrate oxidation sites in versatile peroxidase and other basidiomycete peroxidases. J. Exp. Bot. 2008, 60, 441–452. [Google Scholar] [CrossRef] [Scilit]
  12. Cañas, A.I.; Camarero, S. Laccases and their natural mediators: Biotechnological tools for sustainable eco-friendly processes. Biotechnol. Adv. 2010, 28, 694–705. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Lee, H.; Jang, Y.; Choi, Y.S.; Kim, M.J.; Lee, J.; Lee, H.; Hong, J.H.; Lee, Y.M.; Kim, G.H.; Kim, J.J. Biotechnological procedures to select white rot fungi for the degradation of PAHs. J. Microbiol. Methods 2014, 97, 56–62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Talaat, W.I.A.W.; Tahir, N.M.; Husain, M.L. Sustainable management of forest biodiversity and the present Malaysian policy and legal framework. J. Sustain. Dev. 2012, 5, 76. [Google Scholar] [CrossRef] [Scilit]
  15. Paterson, R.R.M.; Lima, N. Climate change affecting oil palm agronomy, and oil palm cultivation increasing climate change, require amelioration. Ecol. Evol. 2018, 8, 452–461. [Google Scholar] [CrossRef] [Scilit]
  16. Evans, C.S.; Hedger, J.N. November. Degradation of plant cell wall polymers. In British Mycological Society Symposium Series; Elsevier: Amsterdam, The Netherlands, 2001; Volume 23, pp. 1–26. [Google Scholar]
  17. Lodge, D.J.; Cantrell, S. Fungal communities in wet tropical forests: Variation in time and space. Can. J. Bot. 1995, 73, 1391–1398. [Google Scholar] [CrossRef] [Scilit]
  18. Al-Enazi, N.M.; Awaad, A.S.; Al-Othman, M.R.; Al-Anazi, N.K.; Alqasoumi, S.I. Isolation, identification and anti-candidal activity of filamentous fungi from Saudi Arabia soil. Saudi Pharm. J. 2018, 26, 253–257. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. APHA. Standard Methods for the Examination of Water and Waste Water, 22nd ed.; American Public Health Association, American Water Works Association, Water Environment Federation: Washington, DC, USA, 2012. [Google Scholar]
  20. Collee, J.G.; Miles, R.S.; Watt, B. Tests for the Identification of Bacteria. In Mackie & McCartney Practical Medical Microbiology, 14th ed.; Collee, J.G., Marmion, B.P., Fraser, A.G., Simmons, A., Eds.; Churchill Livingstone: New York, NY, USA, 1996; pp. 131–151. [Google Scholar]
  21. Noman, E.; Talip, B.A.; Al-Gheethi, A.; Mohamed, R.; Nagao, H. Decolourisation of dyes in greywater by mycoremediation and mycosorption process of fungi from peatland; primary study. Mater. Today Proc. 2020, 31, 23–30. [Google Scholar] [CrossRef] [Scilit]
  22. Noman, E.; Al-Gheethi, A.A.; Rahman, N.K.; Talip, B.; Mohamed, R.; Kadir, O.A. Single spore isolation as a simple and efficient technique to obtain fungal pure culture. In IOP Conference Series: Earth & Environmental Science; IOP Publishing: Bristol, UK, 2018; Volume 140, p. 012055. [Google Scholar]
  23. Rifal, M.A. A revision of the genus Trichoderma. Mycol. Pap. 1969, 116, 1–55. [Google Scholar]
  24. Watanabe, T. Pictorial Atlas of Soil and Seed Fungi: Morphologies of Cultured Fungi and Key to Species, 2nd ed.; CRC: Boca Raton, FL, USA, 2002. [Google Scholar]
  25. Samson, R.A.; Houbraken, J.; Thrane, U.; Frisvad, J.C.; Andersen, B. Food and indoor fungi. In CBS Laboratory Manual Series 2; CBS-Fungal Biodiversity Centre: Utrecht, The Netherlands, 2010. [Google Scholar]
  26. Robert, A.S.; János, V.; Christian, F.J. Taxonomic Studies on the Genus Aspergillus–DTU Orbit; CBS-KNAW Fungal Biodiversity Centre (Studies in Mycology): Utrecht, The Netherlands, 2011. [Google Scholar]
  27. Silva, D.M.; Batista, L.R.; Rezende, E.F.; Fungaro, M.H.P.; Sartori, D.; Alves, E. Identification of fungi of the genus Aspergillus section nigri using polyphasic taxonomy. Braz. J. Microbiol. 2011, 42, 761–773. [Google Scholar] [CrossRef] [Scilit]
  28. Campbell, C.K.; Johnson, E.M.; Warnock, D.W. Identification of Pathogenic Fungi, 2nd ed.; John Wiley and Sons: Hoboken, NJ, USA, 2013. [Google Scholar]
  29. NMRC; Mycology Online. National Mycology Reference Centre; the University of Adelaide: Adelaide, South Australia, 2019. [Google Scholar]
  30. Fell, J.W.; Boekhout, T.; Fonseca, A.; Scorzetti, G.; Statzell-Tallman, A. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 2000, 50, 1351–1371. [Google Scholar] [CrossRef] [Scilit]
  31. White, T.J.; Bruns, T.D.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols, a Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: San Diego, CA, USA, 1990; pp. 315–322. [Google Scholar]
  32. Samson, R.A.; Seifert, K.A.; Kuijpers, A.F.; Houbraken, J.A.M.P.; Frisvad, J.C. Phylogenetic analysis of Penicillium subgenus Penicillium using partial β-tubulin sequences. Stud. Mycol. 2004, 49, pp. 175–200. [Google Scholar]
  33. Lee, S.S.; Horak, E.; Alias, S.A.; Thi, B.K.; Nazura, Z.; Jones, E.B.G.; Nawawi, A. Checklist of Literature on Malaysian Macrofungi; Forest Research Institute Malaysia: Kuala Lumpur, Malaysia, 2008.
  34. Jurjević, Ž.; Kubátová, A.; Kolařík, M.; Hubka, V. Taxonomy of Aspergillus section Petersonii sect. nov. encompassing indoor and soil-borne species with predominant tropical distribution. Plant Syst. Evol. 2015, 301, 2441–2462. [Google Scholar] [CrossRef] [Scilit]
  35. Pinto, A.C.; Palomar, T.; Alves, L.C.; da Silva, S.H.M.; Monteiro, R.C.; Macedo, M.F.; Vilarigues, M.G. Fungal biodeterioration of stained-glass windows in monuments from Belém do Pará (Brazil). Int. Biodeterior. Biodegrad. 2019, 138, 106–113. [Google Scholar] [CrossRef] [Scilit]
  36. Laich, F.; Andrade, J. Penicillium pedernalense sp. nov., isolated from whiteleg shrimp heads waste compost. Int. J. Syst. Evol. Microbiol. 2016, 66, 4382–4388. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Hubka, V.; Nováková, A.; Kolařík, M.; Jurjević, Ž; Peterson, S.W. Revision of Aspergillus section Flavipedes: Seven new species and proposal of section Jani sect. nov. Mycologia 2015, 107, 169–208. [Google Scholar] [CrossRef] [Scilit]
  38. Saha, A.; Mandal, P.; Dasgupta, S.; Saha, D. Influence of culture media and environmental factors on mycelial growth and sporulation of Lasiodiplodia theobromae (Pat.) Griffon and Maubl. J. Environ. Biol. 2008, 29, 407. [Google Scholar] [PubMed]
  39. Choi, Y.W.; Hyde, K.D.; Ho, W.H. Single spore isolation of fungi. Fungal Divers. 1999, 3, 29–38. [Google Scholar]
  40. Peterson, S.W. Phylogenetic analysis of Aspergillus species using DNA sequences from four loci. Mycologia 2008, 100, 205–226. [Google Scholar] [CrossRef] [PubMed]
  41. Klich, M.A. Biogeography of Aspergillus species in soil and litter. Mycologia 2002, 94, 21–27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Varga, J.; To’th, B.; Kocsube’, S.; Farkas, B.; Szaka’cs, G.; Te’ren, J.; Kozakiewicz, Z. Evolutionary relationships among Aspergillus terreus isolates and their relatives. Antonie Leeuwenhoek 2005, 88, 141–150. [Google Scholar] [CrossRef] [Scilit]
  43. El-Elimat, T.; Raja, H.A.; Graf, T.N.; Faeth, S.H.; Cech, N.B.; Oberlies, N.H. Flavonolignans from Aspergillus iizukae, a fungal endophyte of milk thistle (Silybum marianum). J. Nat. Prod. 2014, 77, 193–199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Yuan, Z.L.; Rao, L.B.; Chen, Y.C.; Zhang, C.L.; Wu, Y.G. From pattern to process: Species and functional diversity in fungal endophytes of Abies beshanzuensis. Fungal Biol. 2011, 115, 197–213. [Google Scholar] [CrossRef] [Scilit]
  45. Shan, T.; Sun, W.; Lou, J.; Gao, S.; Mou, Y.; Zhou, L. Antibacterial activity of the endophytic fungi from medicinal herb, Macleaya cordata. Afr. J. Biotechnol. 2012, 11, 4354–4359. [Google Scholar]
  46. Macia’-Vicente, J.G.; Ferraro, V.; Burruano, S.; Lopez-Llorca, L.V. Fungal assemblages associated with roots of halophytic and non-halophytic plant species vary differentially along a salinity gradient. Microbiol. Ecol. 2012, 64, 668–679. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Kang, H.H.; Zhang, H.B.; Zhong, M.J.; Ma, L.Y.; Liu, D.S.; Liu, W.Z.; Ren, H. Potential antiviral xanthones from a Coastal Saline Soil Fungus Aspergillus iizukae. Mar. Drugs 2018, 16, 449. [Google Scholar] [CrossRef] [Scilit]
  48. Poitevin, C.G.; Porsani, M.V.; Poltronieri, A.S.; Zawadneak, M.A.C.; Pimentel, I.C. Fungi isolated from insects in strawberry crops act as potential biological control agents of Duponchelia fovealis (Lepidoptera: Crambidae). Appl. Entomol. Zool. 2018, 53, 323–331. [Google Scholar] [CrossRef] [Scilit]
  49. Li, L.J.; Li, T.X.; Kong, L.Y.; Yang, M.H. Antioxidant aromatic butenolides from an insect-associated Aspergillus iizukae. Phytochem. Lett. 2016, 16, 134–140. [Google Scholar] [CrossRef] [Scilit]
  50. Liu, D.; Yan, L.; Ma, L.; Huang, Y.; Pan, X.; Liu, W.; Lv, Z. Diphenyl derivatives from coastal saline soil fungus Aspergillus iizukae. Arch. Pharmacal Res. 2015, 38, 1038–1043. [Google Scholar] [CrossRef] [Scilit]
  51. Zhang, H.; Zhang, S.; He, F.; Qin, X.; Zhang, X.; Yang, Y. Characterisation of a manganese peroxidase from white-rot fungus Trametes sp. 48424 with strong ability of degrading different types of dyes & polycyclic aromatic hydrocarbons. J. Hazard. Mater. 2016, 320, 265–277. [Google Scholar]
  52. Won, E.J.; Shin, J.H.; Lim, S.C.; Shin, M.G.; Suh, S.P.; Ryang, D.W. Molecular identification of Schizophyllum commune as a cause of allergic fungal sinusitis. Ann. Lab. Med. 2012, 32, 375–379. [Google Scholar] [CrossRef] [Scilit]
  53. Chowdhary, A.; Randhawa, H.S.; Gaur, S.N.; Agarwal, K.; Kathuria, S.; Roy, P.; Klaassen, C.H.; Meis, J.F. Schizophyllum commune as an emerging fungal pathogen: A review and report of two cases. Mycoses 2013, 56, 1–10. [Google Scholar] [CrossRef] [Scilit]
  54. Kang, M.J.; Choi, Y.S.; Kim, S. A Comparison of the Ability of Fungal Internal Transcribed Spacers and D1/D2 Domain Regions to Accurately Identify Candida glabrata Clinical Isolates Using Sequence Analysis. Biomed. Sci. Lett. 2018, 24, 430–434. [Google Scholar] [CrossRef] [Scilit]
  55. Sang, H.K.; Choi, Y.P.; Yu, S.H. Phylogenetic analysis, morphology and pathogenicity of Penicillium spp. associated with blue mold of apple in Korea. Korean J. Agric. Sci. 2010, 37, 341–350. [Google Scholar]
  56. Visagie, C.M.; Hirooka, Y.; Tanney, J.B.; Whitfield, E.; Mwange, K.; Meijer, M.; Amend, A.S.; Seifert, K.A.; Samson, R.A. Aspergillus, Penicillium and Talaromyces isolated from house dust samples collected around the world. Stud. Mycol. 2014, 78, 63–139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  57. Bedi, A.; Singh, B.R.; Deshmukh, S.K.; Adholeya, A.; Barrow, C.J. An Aspergillus aculateus strain was capable of producing agriculturally useful nanoparticles via bioremediation of iron ore tailings. J. Environ. Manag. 2018, 215, 100–107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  58. Nyongesa, B.W.; Okoth, S.; Ayugi, V. Identification key for Aspergillus species isolated from maize and soil of Nandi County, Kenya. Adv. Microbiol. 2015, 5, 205. [Google Scholar] [CrossRef]
  59. Tanaka, K.; Harada, Y.; Barr, M.E. Trematosphaeria: Taxonomic concepts, new species from Japan and key to species. Fungal Divers. 2005, 19, 145–156. [Google Scholar]
  60. Freire, K.T.; Araújo-Magalhães, G.R.; Nascimento, S.S.; Paiva, L.M.; Barbosa, R.N.; Bezerra, J.D.; Souza-Motta, C.M. First report of Penicillium brasilianum Bat., P. cluniae Quintan., and P. echinulonalgiovense S. Abe ex Houbraken & RN Barbosa (Eurotiales, Aspergillaceae) as endophytes from a bromeliad in the Caatinga dry forest in Brazil. Check List 2020, 16, 1055. [Google Scholar]
  61. Mansouri, S.; Houbraken, J.; Samson, R.A.; Frisvad, J.C.; Christensen, M.; Tuthill, D.E.; Koutaniemi, S.; Hatakka, A.; Lankinen, P. Penicillium subrubescens, a new species efficiently producing inulinase. Antonie Van Leeuwenhoek 2013, 103, 1343–1357. [Google Scholar] [CrossRef] [Scilit]
  62. Dethoup, T.; Manoch, L.; Visarathanonth, N.; Chamswarng, C.; Kijjoa, A. Morphology and distribution of Talaromyces flavus from soil and potential use as a biological control agent against plant pathogenic fungi. Thai. J. Agric. Sci. 2007, 40, 37–50. [Google Scholar]
  63. Yilmaz, N.; Visagie, C.M.; Houbraken, J.; Frisvad, J.C.; Samson, R.A. Polyphasic taxonomy of the genus Talaromyces. Stud. Mycol. 2014, 78, 175–341. [Google Scholar] [CrossRef] [Scilit]
  64. Wong, S.Y.; Wong, K. Penicillium marneffei infection in AIDS. Pathol. Res. Int. 2011, 2011, 764293. [Google Scholar] [CrossRef]
  65. Sang, H.; An, T.J.; Kim, C.S.; Shin, G.S.; Sung, G.H.; Yu, S.H. Two novel Talaromyces species isolated from medicinal crops in Korea. J. Microbiol. 2013, 51, 704–708. [Google Scholar] [CrossRef] [Scilit]
  66. Shah, S.G.; Shier, W.T.; Tahir, N.; Hameed, A.; Ahmad, S.; Ali, N. Penicillium verruculosum SG: A source of polyketide and bioactive compounds with varying cytotoxic activities against normal and cancer lines. Arch. Microbiol. 2014, 196, 267–278. [Google Scholar] [CrossRef] [Scilit]
  67. Wu, Q.; Sun, R.; Ni, M.; Yu, J.; Li, Y.; Yu, C.; Dou, K.; Ren, J.; Chen, J. Identification of a novel fungus, Trichoderma asperellum GDFS1009, and comprehensive evaluation of its biocontrol efficacy. PLoS ONE 2017, 12, e0179957. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  68. Meyer, R.; Plaskowitz, J.S. Scanning electron microscopy of conidia and conidial matrix of Trichoderma. Mycologia 1989, 81, 312–317. [Google Scholar] [CrossRef] [Scilit]
  69. Lieckfeldt, E.; Samuels, G.J.; Nirenberg, H.I.; Petrini, O. A morphological and molecular perspective of Trichoderma viride: Is it one or two species? Appl. Environ. Microbiol. 1999, 65, 2418–2428. [Google Scholar] [CrossRef] [Scilit]
  70. Samuels, G.J.; Lieckfeldt, E.; Nirenberg, H.I. Trichoderma asperellum, a new species with warted conidia, & redescription T. viride. Sydowia 1999, 51, 71–88. [Google Scholar]
  71. Jabnoun-Khiareddine, H.; Daami-Remadi, M.; Barbara, D.J.; El Mahjoub, M. Morphological variability within and among Verticillium species collected in Tunisia. Tunis. J. Plant Prot. 2010, 5, 19–38. [Google Scholar]
  72. Tsang, C.C.; Chan, J.F.; Pong, W.M.; Chen, J.H.; Ngan, A.H.; Cheung, M.; Lai, C.K.; Tsang, D.N.; Lau, S.K.; Woo, P.C. Cutaneous hyalohyphomycosis due to Parengyodontium album gen. et comb. nov. Med. Mycol. 2016, 54, 699–713. [Google Scholar] [CrossRef] [Scilit]
  73. Leplat, J.; François, A.; Bousta, F. Parengyodontium album, a frequently reported fungal species in the cultural heritage environment. Fungal Biol. Rev. 2020, 34, 126–135. [Google Scholar] [CrossRef] [Scilit]
  74. Sudiarta, I.P.; Suputra, I.P.W.; Wirya, G.N.A.S. New Report of Insect Pathogenic Fungi (Aschersonia sp.) of Citrus Whitefly (Dialeurodes sp.) in Bali Indonesia. Res. Agric. Vet. Sci. 2019, 3, 22–27. [Google Scholar]
  75. Deng, J.X.; Paul, N.C.; Sang, H.K.; Lee, J.H.; Hwang, Y.S.; Yu, S.H. First report on isolation of Penicillium adametzioides and Purpureocillium lilacinum from decayed fruit of Cheongsoo grapes in Korea. Mycobiology 2012, 40, 66–70. [Google Scholar] [CrossRef] [Scilit]
  76. Perdomo, H.; Cano, J.; Gené, J.; García, D.; Hernández, M.; Guarro, J. Polyphasic analysis of Purpureocillium lilacinum isolates from different origins and proposal of the new species Purpureocillium lavendulum. Mycologia 2013, 105, 151–161. [Google Scholar] [CrossRef] [Scilit]
  77. Kusai, N.A.; Mior Zakuan Azmi, M.; Zulkifly, S.; Yusof, M.T.; Mohd Zainudin, N.A.I. Morphological and molecular characterization of Curvularia and related species associated with leaf spot disease of rice in Peninsular Malaysia. Rend. Lincei 2016, 27, 205–214. [Google Scholar] [CrossRef] [Scilit]
  78. Fazio, A.T.; López, M.M.; Temperini, M.L.; de Faria, D.L.A. Surface enhanced Raman spectroscopy and cultural heritage biodeterioration: Fungi identification in earthen architecture from Paraíba Valley (São Paulo, Brazil). Vib. Spectrosc. 2018, 97, 129–134. [Google Scholar] [CrossRef] [Scilit]
  79. De Gelder, J. Raman Spectroscopy as a Tool for Studying Bacterial Cell Compounds Doctoral Disserta; Ghent University: Ghent, Belgium, 2008. [Google Scholar]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Article Metrics

Citations

Article Access Statistics

Multiple requests from the same IP address are counted as one view.