Selection of Abies nephrolepis Materials for Restoration of Genetic Diversity in Mt. Gariwangsan Degraded Area
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Site and Plant Materials
2.2. DNA Extraction and nSSR Marker Analysis
2.3. Genetic Diversity Analysis
2.4. Genetic Spatial Autocorrelation Analysis
2.5. Comparison between Sampling Strategies
3. Results
3.1. Genetic Diversity
3.2. Genetic Relationships among Populations
3.3. Genetic Spatial Structure
3.4. Comparison between Sampling Strategies
4. Discussion
4.1. Genetic Diversity of A. nephrolepis Populations
4.2. Genetic Relationship between A. nephrolepis Populations
4.3. Spatial Genetic Structure of A. nephrolepis on Mt. Gariwangsan
4.4. Selection Strategy for Restoration Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Rajora, O.P.; Mosseler, A. Challenges and opportunities for conservation of forest genetic resources. Euphytica 2001, 118, 197–212. [Google Scholar] [CrossRef]
- Ledig, F.T. Conservation of diversity in forest trees: Why and how should genes be conserved? BioScience 1988, 38, 471–479. [Google Scholar] [CrossRef]
- St. Clair, J.B.; Howe, G.T. Strategies for conserving forest genetic resources in the face of climate change. Turk. J. Bot. 2011, 35, 403–409. [Google Scholar] [CrossRef]
- Wehenkel, C.; Mariscal-Lucero, S.D.R.; Jaramillo-Correa, J.P.; López-Sánchez, C.A.; Vargas-Hernández, J.J.; Sáenz-Romero, C. Genetic diversity and conservation of Mexican forest trees. In Biodiversity and Conservation of Woody Plants; Springer: Berlin/Heidelberg, Germany, 2017; pp. 37–67. [Google Scholar] [CrossRef]
- Li, X.; Ding, X.; Chu, B.; Zhou, Q.; Ding, G.; Gu, S. Genetic diversity analysis and conservation of the endangered Chinese endemic herb Dendrobium officinale Kimura et Migo (Orchidaceae) based on AFLP. Genetica 2008, 133, 159–166. [Google Scholar] [CrossRef]
- Tang, S.; Dai, W.; Li, M.; Zhang, Y.; Geng, Y.; Wang, L.; Zhong, Y. Genetic diversity of relictual and endangered plant Abies ziyuanensis (Pinaceae) revealed by AFLP and SSR markers. Genetica 2008, 133, 21–30. [Google Scholar] [CrossRef]
- Xiao, M.; Li, Q.; Guo, L.; Luo, T.; Duan, W.X.; He, W.X.; Wang, L.; Chen, F. AFLP analysis of genetic diversity of the endangered species Sinopodophyllum hexandrum in the Tibetan Region of Sichuan Province, China. Biochem. Genet. 2006, 44, 47–60. [Google Scholar] [CrossRef] [PubMed]
- Ahn, J.Y.; Lim, H.I.; Ha, H.W.; Han, J.; Han, S.H. Genetic variation in Korean fir subpopulations in Mt. Jiri for the restoration of genetic diversity. J. Korean For. Soc. 2017, 106, 417–423. [Google Scholar] [CrossRef]
- Broadhurst, L.; Boshier, D. Seed provenance for restoration and management: Conserving evolutionary potential and utility. In Genetic Considerations in Ecosystem Restoration Using Native Tree Species. A Thematic Study for the State of the World’s Forest Genetic Resources; United Nations Rome, Ed.; Food and Agriculture Organization: Rome, Italy, 2014; pp. 27–37. [Google Scholar]
- Gapare, W.J.; Yanchuk, A.D.; Aitken, S.N. Optimal sampling strategies for capture of genetic diversity differ between core and peripheral populations of Picea sitchensis (Bong.). Carr. Conserv. Genet. 2008, 9, 411–418. [Google Scholar] [CrossRef]
- Blanc-Jolivet, C.; Degen, B. Using simulations to optimize genetic diversity in Prunus avium seed harvests. Tree Genet. Genomes 2014, 10, 503–512. [Google Scholar] [CrossRef]
- Iwaizumi, M.G.; Nasu, J.; Miyamoto, N.; Isoda, K. Genetic variation of seed pools in two mast years and a genetic preservation strategy for a population of the endemic conifer Abies veitchii var. Shikokiana. J. Jpn. Soc. 2021, 103, 172–179. (In Japanese) [Google Scholar] [CrossRef]
- Chae, S.B.; Lim, H.I.; Kim, Y.Y. Selection of restoration material for Abies koreana based on its genetic diversity on Mt. Hallasan. Forests 2022, 13, 24. [Google Scholar] [CrossRef]
- Laikre, L.; Allendorf, F.W.; Aroner, L.C.; Baker, C.S.; Gregovich, D.P.; Hansen, M.M.; Jackson, J.A.; Kendall, K.C.; McKelvey, K.; Neel, M.C.; et al. Neglect of genetic diversity in the implementation of the Convention on Biological Diversity. Conserv. Biol. 2010, 24, 86–88. [Google Scholar] [CrossRef][Green Version]
- FAO. Global Plan of Action for the Conservation, Sustainable Use and Development of Forest Genetic Resources; Food and Agriculture Organization of the United Nations: Rome, Italy, 2014; p. 31. [Google Scholar]
- McKay, J.K.; Christian, C.E.; Harrison, S.; Rice, K.J. “How local is local?”—A review of practical and conceptual issues in the genetics of restoration. Restor. Ecol. 2005, 13, 432–440. [Google Scholar] [CrossRef]
- Bischoff, A.; Steinger, T.; Müller-Schärer, H. Iimportance of plant provenance and genotypic diversity of seed materials used for ecological restoration. Restor. Ecol. 2008, 18, 338–348. [Google Scholar] [CrossRef]
- Cho, H.J.; Bae, K.H.; Lee, C.S.; Lee, C.H. Species composition and structure of the evergreen coniferous forest vegetation of the subalpine area (South Korea). J. Korean Soc. For. Sci. 2004, 93, 372–379. (In Korean) [Google Scholar]
- Lim, J.H.; Woo, S.Y.; Kwon, M.J.; Chun, J.H.; Shin, J.H. Photosynthetic capacity and water use efficiency under different temperature regimes on healthy and declining Korean fir in Mt. Halla. J. Korean Soc. For. Sci. 2006, 95, 705–710. (In Korean) [Google Scholar]
- Lim, J.H.; Kim, E.S.; Park, G.E.; Kim, Y.S.; Jang, G.C.; Han, J.K.; Jung, S.C.; Lim, H.I.; Song, W.K.; Cho, N.H.; et al. Current Status and Conservation Strategy of Vulnerable Conifer Species in Subalpine Zone in Korea; National Institute of Forest Science: Seoul, Republic of Korea, 2019; p. 194. (In Korean) [Google Scholar]
- Ceriani, R.M.; Pierce, S.; Cerabolini, B. The survival strategy of the alpine-endemic Primula glaucescens is fundamentally unchanged throughout its climate envelope, despite superficial phenotypic variability. Plant Ecol. 2009, 204, 1–10. [Google Scholar] [CrossRef]
- Byun, J.G.; Jang, J.W.; Yang, J.C.; Lee, Y.M.; Jung, S.Y.; Ji, S.J.; Jang, J.; Lee, H.J.; Hwang, H.S.; Oh, S.H. Flora of vascular plants in the Mt. Gariwang protected area for forest genetic resource conservation in South Korea. Korean J. Plant Resour. 2013, 26, 566–588. [Google Scholar] [CrossRef][Green Version]
- Jeon, D.U.; Chon, J.H. System thinking in the resilience of the ecosystem and ecotourism of Mt. Gariwang based on the controversy around venue construction for the Pyeongchang 2018 Olympic. Korean Syst. Dyn. Rev. 2014, 15, 61–79. (In Korean) [Google Scholar]
- Lee, H.J.; Kim, Y.K.; Yoon, T.Y. Estimation of Environmental Costs for Deforestation: Focusing on the Case of Limestone Mine Development Projects. J. Environ. Policy Adm. 2022, 30, 63–91. [Google Scholar] [CrossRef]
- Chung, J.D.; Kim, J.H. A comparative study of greenhouse gas absorption in the forestry sector before and after the construction of golf courses. J. Korean Soc. Urban Environ. 2010, 10, 231–235. (In Korean) [Google Scholar]
- Kim, E.; Song, W.; Lee, D.K. Forest fragmentation and its impacts: A review. J. Korean Soc. Environ. Restor. Technol. 2012, 15, 149–162. [Google Scholar] [CrossRef][Green Version]
- Sung, C.Y.; Cho, W. Landscape analysis of habitat fragmentation in the North and South Korean border. Korean J. Environ. Ecol. 2012, 26, 952–959. (In Korean) [Google Scholar]
- Choe, G. Status and Causes of Landslides in South Korea. Mag. Korean Soc. Hazard Mitig. 2001, 1, 7–14. (In Korean) [Google Scholar]
- Son, D.C.; Yang, J.C.; Cho, Y.C.; Choi, K.; Chang, K.S.; Oh, S.H. Silvics of Korea, 3rd ed.; Korea National Arboretum: Pocheon, Republic of Korea, 2019; pp. 31–37. (In Korean)
- Zhang, D.; Katsuki, T.; Rushforth, K. Abies nephrolepis. The IUCN Red List of Threatened Species 2013. e.T42292A76095986. Available online: https://doi.org/10.2305/IUCN.UK.2013-1.RLTS.T42292A76095986.en (accessed on 31 March 2023).
- Oh, B.U.; Jo, D.G.; Ko, S.C.; Choi, B.H.; Paik, W.K.; Chung, G.Y.; Jang, C.G. Target Plants Adaptable to Climate Change in the Korean Peninsula; Korea National Arboretum: Pocheon, Republic of Korea, 2010; Volume 300. (In Korean)
- Altukhov, Y.P.; Salmenkova, E.A. DNA polymorphism in population genetics. Russ. J. Genet. 2002, 38, 1173–1195. [Google Scholar] [CrossRef]
- Hong, Y.P.; Ahn, J.Y.; Kim, Y.M.; Yang, B.H.; Song, J.H. Genetic variation of nSSR markers in natural populations of Abies koreana and Abies nephrolepis in South Korea. J. Korean Soc. Forest Sci. 2011, 100, 577–584. (In Korean) [Google Scholar]
- Struss, D.; Plieske, J. The use of microsatellite markers for detection of genetic diversity in barley populations. Theor. Appl. Genet. 1998, 97, 308–315. [Google Scholar] [CrossRef]
- Hong, J.K.; Lim, J.; Lee, B.Y.; Kwak, M. Isolation and characterization of novel microsatellites for Abies koreana and A. nephrolepis (Pinaceae). Genet. Mol. Res. 2016, 15, gmr-15027542. [Google Scholar] [CrossRef] [PubMed]
- Lian, C.; Goto, S.; Hogetsu, T. Microsatellite markers for sacchalin fir (Abies sachalinensis Masters). Mol. Ecol. Notes 2007, 7, 896–898. [Google Scholar] [CrossRef]
- Hansen, O.K.; Vendramin, G.G.; Sebastiani, F.; Edwards, K.J. Development of Microsatellite Markers in Abies Nordmanniana (Stev.) Spach and cross-species amplification of the Abies genus. Mol. Ecol. Notes 2005, 5, 784–787. [Google Scholar] [CrossRef]
- Postolache, D.; Leonarduzzi, C.C.; Piotti, A.A.; Spanu, I.; Roig, A.; Fady, B.; Roschanski, A.; Liepelt, S.; Vendramin, G.G. Transcriptome versus Genomic Microsatellite Markers: Highly Informative Multiplexes for Genotyping Abies alba Mill. and Congeneric Species. Plant Mol. Biol. Report. 2014, 32, 750–760. [Google Scholar] [CrossRef]
- Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar] [CrossRef]
- Peakall, R.O.D.; Smouse, P.E. GenAlEx 6: Genetic analysis in Excel. Population Genetics Software for Teaching and Research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar] [CrossRef]
- Takezaki, N.; Nei, M.; Tamura, K. POPTREE2: Software for constructing population trees from allele frequency data and computing other population statistics using a Windows interface. Mol. Biol. Evol. 2010, 27, 747–752. [Google Scholar] [CrossRef][Green Version]
- Li, Y.L.; Liu, J.X. Structure selector: A web-based software to select and visualize the optimal number of clusters using multiple methods. Mol. Ecol. Resour. 2018, 18, 176–177. [Google Scholar] [CrossRef] [PubMed]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multi-locus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef]
- Smouse, P.E.; Peakall, R.O.D. Spatial autocorrelation analysis of individual multi-allele and multi-locus genetic structures. Heredity 1999, 82, 561–573. [Google Scholar] [CrossRef][Green Version]
- De Mendiburu, F.; de Mendiburu, M.F. Package “Agricolae”; R Package Version 1,2019, 2–8. Available online: https://cran.r-project.org/web/packages/agricolae/agricolae.pdf (accessed on 2 May 2023).
- Kwak, M.; Hong, J.K.; Park, J.H.; Lee, B.Y.; Suh, M.H.; Kim, C.S. Genetic assessment of Abies koreana (Pinaceae), the endangered Korean fir, and conservation implications. Conserv. Genet. 2017, 18, 1165–1176. [Google Scholar] [CrossRef]
- Iwaizumi, M.G.; Ohtani, M.; Nasu, J.Y.; Takahashi, M. Development of highly polymorphic genomic microsatellite markers and their application to gene flow in a natural population of Abies firma. J. For. Res. 2019, 24, 330–334. [Google Scholar] [CrossRef]
- Belletti, P.; Ferrazzini, D.; Ducci, F.; De Rogatis, A.A.; Mucciarelli, M. Genetic diversity of Italian populations of Abies alba. Dendrobiology 2017, 77, 147–159. [Google Scholar] [CrossRef]
- Sękiewicz, K.; Dering, M.; Sękiewicz, M.; Boratyńska, K.; Iszkuło, G.; Litkowiec, M.; Ok, T.; Dagher-Kharrat, M.B.; Boratyński, A. Effect of geographic range discontinuity on species diferentiation—East-Mediterranean Abies cilicica: A case study. Tree Genet. Genomes 2015, 11, 810. [Google Scholar] [CrossRef][Green Version]
- Cobo-Simón, I.; Méndez-Cea, B.; Jump, A.S.; Seco, J.; Gallego, F.J.; Linares, J.C. Understanding the Genetic Diversity of Relict Forests. Linking long-term isolation legacies and current habitat fragmentation in the Abies pinsapo boiss. For. Ecol. Manag. 2020, 461, 117947. [Google Scholar] [CrossRef]
- Potter, K.M.; Frampton, J.; Josserand, S.A.; Nelson, C.D. Genetic variation and population structure in Fraser fir (Abies fraseri): A microsatellite assessment of young trees. Can. J. For. Res. 2008, 38, 2128–2137. [Google Scholar] [CrossRef]
- Maghuly, F.; Pinsker, W.; Praznik, W.; Fluch, S. Genetic diversity in managed subpopulations of Norway spruce [Picea abies (L.) Karst.]. For. Ecol. Manag. 2006, 222, 266–271. [Google Scholar] [CrossRef]
- Pazouki, L.; Shanjani, P.S.; Fields, P.D.; Martins, K.; Suhhorutšenko, M.; Viinalass, H.; Niinemets, Ü. Large within-population genetic diversity of the widespread conifer Pinus sylvestris at its soil fertility limit, characterized by nuclear and chloroplast microsatellite markers. Eur. J. For. Res. 2016, 135, 161–177. [Google Scholar] [CrossRef]
- Qiu, Y.; Liu, Y.; Kang, M.; Yi, G.; Huang, H. Spatial and temporal population genetic variation and structure of Nothotsuga longibracteata (Pinaceae), a relic conifer species endemic to subtropical China. Genet. Mol. Biol. 2013, 36, 598–607. [Google Scholar] [CrossRef][Green Version]
- Aleksić, J.M.; Piotti, A.; Geburek, T.; Vendramin, G.G. Exploring and conserving a “microcosm”: Whole-population genetic characterization within a refugial area of the endemic, relict conifer Picea omorika. Conserv. Genet. 2017, 18, 777–788. [Google Scholar] [CrossRef]
- Tong, Y.W.; Lewis, B.J.; Zhou, W.M.; Mao, C.R.; Wang, Y.; Zhou, L.; Yu, D.P.; Dai, L.M.; Qi, L. Genetic diversity and population structure of natural Pinus koraiensis populations. Forests 2019, 11, 39. [Google Scholar] [CrossRef][Green Version]
- Moriguchi, Y.; Kang, K.S.; Lee, K.Y.; Lee, S.W.; Kim, Y.Y. Genetic variation of Picea jezoensis populations in South Korea revealed using chloroplast, mitochondrial, and nuclear DNA markers. J. Plant Res. 2009, 122, 153–160. [Google Scholar] [CrossRef]
- Hamrick, J.L.; Godt, M.W. Effects of life history traits on genetic diversity in plant species. Phil. Trans. R. Soc. Lond. B Biol. Sci. 1996, 351, 1291–1298. [Google Scholar] [CrossRef]
- Kim, M.; Lee, S.; Lee, S.; Yi, K.; Kim, H.S.; Chung, S.; Chung, J.; Kim, H.S.; Yoon, T.K. Seed dispersal models for natural regeneration: A review and prospects. Forests 2022, 13, 659. [Google Scholar] [CrossRef]
- Song, Z.; Li, X.; Wang, H.; Wang, J. Genetic diversity and population structure of Salvia miltiorrhiza Bge. in China revealed by ISSR and SRAP. Genetica 2010, 138, 241–249. [Google Scholar] [CrossRef] [PubMed]
- Hamrick, J.L.; Godt, M.J.W.; Sherman-Broyles, S.L. Factors influencing levels of genetic diversity in woody plant species. In Population Genetics of Forest Trees: Proceedings of the International Symposium on Population Genetics of Forest Trees, Corvallis, OR, USA, 31 July–2 August 1990; Springer: Dordrecht, The Netherlands, 1992; pp. 95–124. [Google Scholar]
- Nybom, H. Comparison of different nuclear DNA markers for estimating intraspecific genetic diversity in plants. Mol. Ecol. 2004, 13, 1143–1155. [Google Scholar] [CrossRef] [PubMed]
- Hong, Y.P.; Kwon, H.Y.; Kim, I.S. The I-SSR markers revealed inconsistent phylogeographic patterns among Japanese red pine populations in Korea. Silvae Genet. 2007, 56, 22–26. [Google Scholar] [CrossRef][Green Version]
- Doligez, A.; Joly, H.I. Genetic diversity and spatial structure within a natural stand of a tropical forest tree species, Carapa procera (Meliaceae) in French Guiana. Heredity 1997, 79, 72–82. [Google Scholar] [CrossRef]
- Hamrick, J.L.; Murawski, D.A.; Nason, J.D. The Influences of Seed Dispersal Mechanisms on the Genetic Structure of tropical tree populations. Vegetatio 1993, 107, 281–297. [Google Scholar] [CrossRef]
- Thomson, F.J.; Moles, A.T.; Auld, T.D.; Kingsford, R.T. Seed dispersal distance is more strongly correlated with plant height than with seed mass. J. Ecol. 2011, 99, 1299–1307. [Google Scholar] [CrossRef]
No. | Populations | Abbreviation | Latitude (°) | Longitude (°) | Altitude (m) | Number of Samples | Height (m) | DBH (cm) |
---|---|---|---|---|---|---|---|---|
1 | Mt. Gariwangsan | GW | 37.46111 | 128.56313 | 1423 | 35 | 5.2 1 | 12.7 1 |
2 | Mt. Joongwangsan | JW | 37.46390 | 128.52214 | 1252 | 30 | 9.5 | 18.8 |
3 | Mt. Seoraksan | SA | 38.11941 | 128.46472 | 1550 | 34 | 10.8 | 18.6 |
4 | Mt. Taebaeksan | TB | 37.09839 | 128.91628 | 1375 | 36 | 10.6 | 22.0 |
5 | Mt. Odeasan | OD | 37.79536 | 128.54371 | 1276 | 36 | 12.0 | 18.9 |
6 | Mt. Hwaaksan | HA | 37.99501 | 127.50381 | 1350 | 31 | 8.8 | 20.8 |
7 | Mt. Sobaeksan | SB | 36.95816 | 128.48391 | 1320 | 18 | 7.6 | 19.9 |
8 | Mt. Jangsan | JA | 37.12484 | 128.86293 | 1350 | 36 | 14.3 | 25.4 |
9 | Mt. Balwangsan | BW | 37.60722 | 128.67102 | 1435 | 36 | 9.3 | 17.7 |
10 | Mt. Bangtaesan | BT | 37.89494 | 128.35559 | 1293 | 34 | 5.1 | 11.2 |
Primer | Dye | DNA Sequences (5′ → 3′) | Repeat Motif | Product Size | Tm (°C) | Reference | |
---|---|---|---|---|---|---|---|
Aat04 | JOE | F R | CCATGTATGGTGCTCCTCCT CCTTCATTGCAGAAAAGCAA | (CAG)11 | 158–191 | 63 (touchdown) | [38] |
NFF07 | FAM | F R | CCCAAACTGGAAGATTGGAC ATCGCCATCCATCATCAGA | (GA)33 | 107–173 | 58 | [37] |
As13 | FAM | F R | ATGCAAGCAACCATCGATATG GTTTCTTCCATAGAACACCTC | (TG)22 | 220–262 | 55 | [36] |
As20 | FAM | F R | TCTTGCAACGAGGGGATCCATAACCTG CTAAGCATTGAGCCACATAATTC | (TG)9 | 172–226 | 55 | [36] |
AK087 | FAM | F R | GCAGCCTTATCTTCATTTTGTC CACTTGAGCCACACTTGAACTA | (TG)15 | 263–294 | 58 | [35] |
AK240 | FAM | F R | AGAGAAGGGTCGAGGAATTATC TGAAAGTAGCAAGTGTAACTTATGC | (CA)12 | 177–212 | 58 | [35] |
AK246 | FAM | F R | TAGATTGGCATATTGGACATCA ATAGGTTGTTGAGCTGGATGTT | (TG)11 | 135–155 | 58 | [35] |
Populations | N | A | Ae | Ho | He | F |
---|---|---|---|---|---|---|
GW | 35.0 | 11.4 | 6.726 | 0.792 | 0.786 | −0.008 |
JW | 30.0 | 7.9 | 4.417 | 0.671 | 0.725 | 0.069 |
SA | 33.7 | 10.6 | 5.980 | 0.768 | 0.780 | 0.021 |
TB | 36.0 | 10.9 | 6.321 | 0.813 | 0.808 | −0.009 |
OD | 35.9 | 13.4 | 6.672 | 0.817 | 0.802 | −0.022 |
HA | 30.6 | 10.4 | 5.987 | 0.794 | 0.777 | −0.014 |
SB | 18.0 | 10.6 | 6.673 | 0.865 | 0.812 | −0.061 |
JA | 35.9 | 12.1 | 7.055 | 0.824 | 0.823 | −0.005 |
BW | 35.4 | 12.4 | 6.325 | 0.780 | 0.789 | 0.016 |
BT | 34.0 | 11.4 | 6.438 | 0.815 | 0.805 | −0.013 |
Total | 1 32.4 ± 0.63 | 11.1 ± 0.50 | 6.259 ± 0.394 | 0.794 ± 0.016 | 0.791 ± 0.013 | −0.002 ± 0.010 |
Degrees of Freedom | Sum of Squares | Mean Squares | Estimated Variation | Percent of Variation (%) | p | |
---|---|---|---|---|---|---|
Among populations | 9 | 110.64 | 12.294 | 0.203 | 3 | 0.001 |
Within populations | 316 | 1802.39 | 5.704 | 5.704 | 97 | |
Total | 325 | 1913.03 | 5.906 | 100 |
No. of Samples | Mean ± SD |
---|---|
5 | 65.52 ± 9.82 c |
10 | 84.51 ± 6.79 b |
15 | 94.45 ± 3.89 a |
20 | 97.38 ± 1.86 a |
25 | 99.27 ± 1.01 a |
30 | 99.64 ± 0.94 a |
35 | 99.87 ± 0.34 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Seo, H.-N.; Park, J.-H.; Lim, H.-I. Selection of Abies nephrolepis Materials for Restoration of Genetic Diversity in Mt. Gariwangsan Degraded Area. Sustainability 2023, 15, 7749. https://doi.org/10.3390/su15107749
Seo H-N, Park J-H, Lim H-I. Selection of Abies nephrolepis Materials for Restoration of Genetic Diversity in Mt. Gariwangsan Degraded Area. Sustainability. 2023; 15(10):7749. https://doi.org/10.3390/su15107749
Chicago/Turabian StyleSeo, Han-Na, Jae-Hyun Park, and Hyo-In Lim. 2023. "Selection of Abies nephrolepis Materials for Restoration of Genetic Diversity in Mt. Gariwangsan Degraded Area" Sustainability 15, no. 10: 7749. https://doi.org/10.3390/su15107749
APA StyleSeo, H.-N., Park, J.-H., & Lim, H.-I. (2023). Selection of Abies nephrolepis Materials for Restoration of Genetic Diversity in Mt. Gariwangsan Degraded Area. Sustainability, 15(10), 7749. https://doi.org/10.3390/su15107749