1. Introduction
2. Materials and Methods
3. Results and Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- EFSA (European Food Safety Authority). Workshop on Xylella fastidiosa: Knowledge Gaps and Research Priorities for the EU. EFSA Supporting Publication 2016: EN-1039. 2016. Available online: https://efsa.onlinelibrary.wiley.com/doi/epdf/10.2903/sp.efsa.2016.EN-1039 (accessed on 3 June 2018).
- IOC (International Olive Council). 2016. Available online: http://www.internationaloliveoil.org/ (accessed on 3 June 2018).
- Saponari, M.; Boscia, D.; Nigro, D.; Martelli, G.P. Identification of DNA sequences related to Xylella fastidiosa in oleander, almond and olive trees exhibiting leaf scorch symptoms in Apulia (Southern Italy). J. Plant Pathol. 2013, 95, 668. [Google Scholar] [CrossRef]
- EPPO (European and Mediterranean Plant Protection Organization). Available online: http://www.eppo.int/QUARANTINE/special_topics/Xylella_fastidiosa/Xylella_fastidiosa.htm (accessed on 3 June 2018).
- MAPAMA (Ministerio de Agricultura y Pesca, Alimentación y Medio Ambiente). Available online: http://www.mapama.gob.es/es/agricultura/temas/sanidad-vegetal/xylella-fastidiosa/ (accessed on 3 June 2018).
- Boletín Oficial de la Comunidad de Madrid. No. 86. Available online: https://www.bocm.es/boletin/CM_Orden_BOCM/2018/04/11/BOCM-20180411-16.PDF (accessed on 3 June 2018).
- Boletín Oficial de la Junta de Andalucía. No. 81. Available online: http://www.juntadeandalucia.es/eboja/2018/81/BOJA18-081-00005-7337-01_00134737.pdf (accessed on 3 June 2018).
- Plant Health and Biosecurity, European Commission. Available online: https://ec.europa.eu/food/plant/plant_health_biosecurity/legislation/emergency_measures/xylella-fastidiosa_en (accessed on 3 June 2018).
- Saponari, M.; Loconsole, G.; Cornara, D.; Yokomi, R.K.; De Stradis, A.; Boscia, D.; Bosco, D.; Martelli, G.P.; Krugner, R.; Porcelli, F. Infectivity and Transmission of Xylella fastidiosa by Philaenus spumarius (Hemiptera: Aphrophoridae) in Apulia, Italy. J. Econ. Entomol. 2014, 107, 1316–1319. [Google Scholar] [CrossRef] [PubMed]
- Luvisi, A.; Nicolì, F.; De Bellis, L. Sustainable Management of Plant Quarantine Pests: The Case of Olive Quick Decline Syndrome. Sustainability 2017, 9, 659. [Google Scholar] [CrossRef]
- Bucci, E.M. Xylella fastidiosa, a new plant pathogen that threatens global farming: Ecology, molecular biology, search for remedies. Biochem. Biophys. Res. Commun. 2018, 502, 173–182. [Google Scholar] [CrossRef] [PubMed]
- Soubeyrand, S.; Jerphanion, P.; Martin, O.; Saussac, M.; Manceau, C.; Hendrikx, P.; Lannou, C. Inferring pathogen dynamics from temporal count data: The emergence of Xylella fastidiosa in France is probably not recent. New Phytol. 2018, 219, 824–836. [Google Scholar] [CrossRef] [PubMed]
- MAPAMA (Ministerio de Agricultura y Pesca, Alimentación y Medio Ambiente). Available online: http://www.mapama.gob.es/es/agricultura/temas/sanidad-vegetal/xylellafastidiosa_contingencia_febrero2018_tcm30-445867.pdf (accessed on 23 June 2018).
- Seabra, S.G.; Pina-Martins, F.; Marabuto, E.; Yurtsever, S.; Halkka, O.; Quartau, J.A.; Paulo, O.S. Molecular phylogeny and DNA barcoding in the meadow-spittlebug Philaenus spumarius (Hemiptera, Cercopidae) and its related species. Mol. Phylogenet. Evol. 2010, 56, 462–467. [Google Scholar] [CrossRef] [PubMed]
- Cornara, D.; Saponari, M.; Zeilinger, A.R.; de Stradis, A.; Boscia, D.; Loconsole, G.; Bosco, D.; Martelli, G.P.; Almeida, R.P.P.; Porcelli, F. Spittlebugs as vectors of Xylella fastidiosa in olive orchards in Italy. J. Pest Sci. 2017, 90, 521–530. [Google Scholar] [CrossRef] [PubMed]
- Albertini, A.; Pizoloto, R.; Petacchi, R. Carabid patterns in olive orchards and woody semi-natural habitats: First implications for conservation biological control against Bactrocera oleae. BioControl 2017, 62, 71. [Google Scholar] [CrossRef]
- Rosenheim, J.A.; Limburg, D.D.; Colfer, R.G. Impact of generalist predators on a biological control agent, Chrysoperla carnea: Direct observations. Ecol. Appl. 1999, 9, 409–417. [Google Scholar] [CrossRef]
- Symondson, W.O.C. Molecular identification of prey in predator diets. Mol. Ecol. 2002, 11, 627–641. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Brown, P.M.J.; Ingels, B.; Wheatley, A.; Rhule, E.L.; de Clercq, P.; van Leeuwen, P.; Thomas, A. Intraguild predation by Harmonia axyridis (Coleoptera: Coccinellidae) on native insects in Europe: Molecular detection from field samples. Entomol. Sci. 2015, 18, 130–133. [Google Scholar] [CrossRef]
- MacDonald, A.J.; Young, M.J.; Lintermans, M.; Sarre, S.D. Primers for detection of Macquarie perch from environmental and trace DNA samples. Conserv. Genet. Resour. 2014, 6, 551–553. [Google Scholar] [CrossRef]
- Pentinsaari, M.; Salmela, H.; Mutanen, M.; Roslin, T. Molecular evolution of a widely-adopted taxonomic marker (COI) across the animal tree of life. Sci. Rep. 2016, 6, 35275. [Google Scholar] [CrossRef] [PubMed][Green Version]
- BOLD Database. Available online: http://v3.boldsystems.org/index.php/databases (accessed on 3 June 2018).
- GenBank Database. Available online: https://www.ncbi.nlm.nih.gov/genbank/ (accessed on 3 June 2018).
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/ NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- EMBL-EBI (European Bioinformatics Institute) Tools: Multiple Sequence Alignment. Available online: https://www.ebi.ac.uk/Tools/msa/ (accessed on 3 June 2018).
- Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae). Span. J. Agric. Res. 2017, 15, e1002. [Google Scholar] [CrossRef]
- Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar] [PubMed]
- Harper, G.L.; King, R.A.; Dodd, C.S.; Harwood, J.D.; Glen, D.M.; Bruford, M.W.; Symondson, W.O.C. Rapid screening of invertebrate predators for multiple prey DNA targets. Mol. Ecol. 2005, 14, 819–827. [Google Scholar] [CrossRef] [PubMed]
- Harwood, J.D.; Desneux, N.; Yoo, H.J.; Rowley, D.I.; Greenstone, M.H.; Obrycki, J.J.; O’Neil, R.J. Tracking the role of alternative prey in soybean aphid predation by Orius insidiosus: A molecular approach. Mol. Ecol. 2007, 16, 4390–4400. [Google Scholar] [CrossRef] [PubMed]
- King, R.A.; Moreno-Ripoll, R.; Agusti, N.; Shayler, S.P.; Bell, J.R.; Bohan, D.A.; Symondson, W.O.C. Multiplex reactions for the molecular detection of predation on pest and non pest invertebrates in agroecosystems. Mol. Ecol. Resour. 2010, 11, 370–373. [Google Scholar] [CrossRef] [PubMed]
- Monzó, C.; Sabater-Muñóz, B.; Urbaneja, A.; Casta-era, P. Tracking medfly predation by the wolf spider, Pardosa cribata Simon, in citrus orchards using PCR-based gut content analysis. Bull. Entomol. Res. 2010, 100, 145–152. [Google Scholar] [CrossRef] [PubMed]
- Moreno-Ripoll, R.; Gabarra, R.; Symondson, W.O.C.; King, R.A.; Agustí, N. Trophic relationships between predators, whiteflies and their parasitoids in tomato greenhouses: A molecular approach. Bull. Entomol. Res. 2012, 102, 415–423. [Google Scholar] [CrossRef] [PubMed]
- Hajibabaei, M.; Janzen, D.H.; Burns, J.M.; Hallwachs, W.; Hebert, P.D.N. DNA barcodes distinguish species of tropical Lepidoptera. PNAS 2005, 103, 968–971. [Google Scholar] [CrossRef] [PubMed]
- León, J.H.; Fournier, V.; Hagler, J.R.; Daane, K.M. Development of molecular diagnostic markers for sharpshooters Homalodisca coagulate and Homalodisca liturata for use in predator gut content examinations. Entomol. Exp. Appl. 2006, 119, 109–119. [Google Scholar] [CrossRef]
- Rowley, C.; Cherrill, A.J.; Leather, S.R.; McCormack, A.W.; Skarp, J.E.; Pope, T.W. PCR-based gut content analysis to identify arthropod predators of Haplodiplosis marginata. Biol. Control 2017, 115, 112–118. [Google Scholar] [CrossRef]





Primer Name | Primer Sequence 5′–3′ |
---|---|
Phi 1F | GCTCCTGACATAGCATTCCCA |
Phi 2F | GCTTCCTCCTTCATTAACGCTT |
Phi 3F | CCTGACATAGCATTCCCACGA |
Phi 4F | TGCTTCCTCCTTCATTAACGCTT |
Phi 1R | TAGCTAAATCAACACATGCACCAG |
Phi 2R | GGAGGATAAACTGTTCATCCC |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).