Next Article in Journal
In Vitro Effects of PCDDs/Fs on NK-like Cell Activity of Eisenia andrei Earthworms
Previous Article in Journal
Anti-Thromboxane B2 Antibodies Protect Against Acetaminophen-Induced Liver Injury in Mice
 
 
Journal of Xenobiotics is published by MDPI from Volume 10 Issue 1 (2020). Previous articles were published by another publisher in Open Access under a CC-BY (or CC-BY-NC-ND) licence, and they are hosted by MDPI on mdpi.com as a courtesy and upon agreement with PAGEPress.
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Phenolic Compounds and Osmotic Stress on the Expression of Penicillin Biosynthetic Genes from Penicillium chrysogenum var. halophenolicum Strain

by
Sumaya Ferreira Guedes
1,2 and
Ana Lúcia Leitão
1,*
1
Departamento de Ciências e Tecnologia da Biomassa, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, Campus de Caparica, Portugal
2
Instituto de Química, Universidade Estadual de Campinas (UNICAMP), Portugal
*
Author to whom correspondence should be addressed.
J. Xenobiotics 2012, 2(1), e2; https://doi.org/10.4081/xeno.2012.e2 (registering DOI)
Submission received: 9 November 2011 / Revised: 9 January 2012 / Accepted: 9 January 2012 / Published: 11 January 2012

Abstract

Phenol and phenolic compounds are aromatic pollutants that inhibit biological treatment of wastewaters. Penicillium chrysogenum var. halophenolicum is a halotolerant fungus that previously showed the ability to degrade phenol and resorcinol in high salinity conditions. The presence of the penicillin biosynthetic cluster in P. chrysogenum var. halophenolicum was recently described. In this article, we examined the expression of pcbAB, pcbC and penDE, genes responsible for δ-(L-α-aminoadipyl)-L-cysteinyl-D-valine syn-thetase, isopenicillin N synthase and isopenicillin N acyltransferase activities, respectively, in P. chrysogenum var. halophenolicum. A quantitative PCR (qPCR) approach was used to determine how these genes were expressed in media with 2% and 5.9% NaCl supplemented with phenol, catechol, hydroquinone and resorcinol as the sole carbon source. The effect of salt on the capability of P. chrysogenum var. halophenolicum to degrade aromatic compounds was measured using HPLC. qPCR analysis of RNA extracted from P. chrysogenum var. halophenolicum indicated that the expression levels of pcbAB, pcbC and penDE decreased in high saline concentrations compared to the levels expressed in media with glucose. High concentrations of salt significantly repress the expression of pcbAB and penDE. The pcbC gene was expressed differentially in catechol containing medium. There was no evident relationship between the expression levels of penicillin biosynthetic genes and yields of penicillin. Meanwhile, the presence of phenol and phenolic compounds seems to positively influence the antibiotic production; high concentrations of salt stimulated penicillin production. These results support the hypothesis that phenol, phenolic compounds and high concentrations of salt could act like a stress factor for P. chrysogenum var. halophenolicum resulting in higher yields of β-lactam antibiotic production.

Introduction

The production of penicillin by filamentous fungi has been considered as the beginning of modern pharmaceutical industry. In 2002, the total world market of β-lactam antibiotics was estimated to be approximately 15 billion US dollars; penicillin accounts for sales of approx- imately 5 billion US dollars.[1]
Penicillium chrysogenum is an ascomycete fungus able to synthesize penicillin with both aromatic and non-aromatic side chains.[2] The genes for the synthesis of secondary metabo-lites, like antibiotics, are frequently arranged in clusters.[3] In the case of penicillin biosynthe-sis, the cluster is constituted by three genes, pcbAB, pcbC and penDE, comprising a 15-kb DNA region (Figure 1). While in Fleming´s iso- late this region contains only a single copy of the cluster, in industrial penicillin overproduc- er strains this segment is amplified in tandem repeats. For example, in the AS-P-78 strain, an overproducer strain obtained at Antibioticos SA (Léon, Spain), the amplified region is pres- ent in five or six copies.[4] The pcbAB and pcbC genes are expressed from a 1.16-kb bidirec- tional promoter region in opposite directions and encode δ-(L-α-aminoadipyl)-L-cysteinyl- D-valine synthetase and isopenicillin N syn- thase, respectively.[5,6] The third gene, penDE, is responsible for the activity of isopenicillin N acyltransferase.[6] In the penicillin biosynthesis pathway, the first step is the non-ribosomal condensation of the three precursor amino acids, L-α-aminoadipic acid, L-cystein, and L- valine, by the enzyme synthetase that was found to be associated with membranes or small organelles.[5,6] The product of this reaction is the tripeptide δ(L-α-aminoadipyl)-L-cys- teinyl-D-valine (ACV), which is cyclized to isopenicillin N (IPN) by the activity of cytoso- lic enzyme, the isopenicillin synthase.[7,8] The isopenicillin N is later modified by the enzyme isopenicillin acyltransferase that was located in organelles to form penicillin G (Figure 1).[8]
It is well documented that the expression of the three genes, pcbAB, pcbC and penDE, is controlled by a complex regulatory network, comprising both nutritional and developmental factors.[5,9] For example, glucose and sucrose negatively regulated the penicillin biosynthe- sis in P. chrysogenum, maltose, galactose and fructose had a less negative effect.[9] Indeed, glucose strongly represses the transcription of pcbAB and pcbC in P. chrysogenum; in opposi- tion to that the gene pcbC is expressed in media with lactose.[10]
Phenol, catechol, hydroquinone and resorci-nol are xenobiotic compounds present in many industrial wastewaters that can be used by sev- eral bacteria and fungi; however a very limited number of these microorganisms have the ability to utilize all of them, particularly under saline conditions.[11,12,13,14] Recently, our group described the characterization of a halotoler- ant Penicillium chrysogenum strain isolated from a salt-mine and named as Penicillium chrysogenum var. halophenolicum.[15] The pres- ence of the full penicillin biosynthetic gene cluster (pcbAB, pcbC and penDE genes) and the biosynthesis of penicillin have been demonstrated in the Penicillium chrysogenum var. halophenolicum strain by Southern hybridizations.[15] Penicillium chrysogenum var. halophenolicum can metabolize up to 300 mg/L of phenol and resorcinol at 5.9% (w/v) of NaCl concentration.[16,17] However, the effects of phe- nolic compounds and sodium chloride on the genomic output of the penicillin biosynthesis cluster in Penicillium chrysogenum var. halophenolicum remain unknown. In the pres- ent work, we aimed to study the effect of phe- nol, catechol, hydroquinone and resorcinol on the expression of penicillin genes cluster of P. chrysogenum var. halophenolicum, when used as the sole carbon source. The effect of these compounds was also investigated at two differ- ent saline concentrations (5.9% and 2% of NaCl, under osmotic and non-osmotic stress condition, respectively), giving an insight into how high salinities affect the expression levels of penicillin G. Therefore, one of the purposes of this study was to obtain more information on the relationship between primary and sec- ondary metabolism of P. chrysogenum var. halophenolicum during the biodegradation of phenolic compounds.

Materials and Methods

Strains

P. chrysogenum var. halophenolicum was used throughout this study; this strain was iso- lated from a salt mine in Algarve, Portugal, and has been previously characterized.[17]

Chemicals

The phenol, catechol, hydroquinone and resorcinol used in this study were of chromato- graphic grade (purity ≥99%), and were obtained from Sigma-Aldrich (St. Louis, USA). HPLC grade acetonitrile was obtained from Lab-Scan (Dublin, Ireland). All other reagents are of analytical-reagent grade and were obtained from Riedel-de Haën (Seelze, Germany). Water purified by a Mili-Q system was used in all the experiments and nutrient agar (NA) was purchased from Difco (Detroit, USA).

Culture conditions

P. chrysogenum var. halophenolicum was maintained at 4 ºC on nutrient agar plates with 5.9% (w/v) NaCl. Precultures of cells were rou- tinely aerobically cultivated (160 rpm in an INNOVA 4000 Incubator (New Brunswick Scientific, New Jersey, USA) in 100 mL of com- plex medium (MC: glucose 30 g/L; NaNO3 3.0 g/L; MgSO4.7H2O 0.5 g/L; NH4Fe(SO4)2.12H2O 10 mg/L; K2HPO4, 1.0 g/L; yeast extract 5.0 g/L; NaCl 58.5 g/L or 20 g/L; pH 5.6).
To investigate the use of phenolic com- pounds and β-lactam antibiotic production, the strain was cultivated in 500-mL flasks contain- ing 100 mL of complex medium MC during 68 h. Cells were collected by centrifugation and washed in 0.85% (w/v) of NaCl solution pre- pared in mili-Q water. A 10% of the preinocu- lum (5.0 mL) was inoculated in 45 mL of min- eral medium (1.0 g/L K2HPO4, 1.0/L (NH4)2SO4, 200 mg/L MgSO4.7H2O, 33 mg/L FeCl3.6H2O, 100 mg/L CaCl2, 58.5 g/L or 20 g/L NaCl; final pH was adjusted to 5.6-5.8 with 5 mol/L HCl), with phenol or catechol or hydroquinone or resorcinol or glucose (final concentration of 2.67 mM). After 45 h and 68 h of culture, cells were harvested and 1.0 mL of supernatant was maintained at -60ºC for antibiotic and aromat- ic compound determinations. The cells were washed with PBS (pH 7) and 1.0 mL of Trizol reagent was added to 0.5 mL of cells before analysis of gene expression by qPCR.

Quantification of gene expression by qPCR

Total RNA was extracted by using a modified protocol that combined a Trizol reagent extrac- tion (Stratagene, USA) together with column purification. Briefly, fungal mycelia harvested under several growing conditions were homo-geneized with Trizol, and extracted once with chloroform following the manufacturer’s instructions. The aqueous phase was mixed with 1.5 volumes of absolute ethanol and loaded onto an RNAeasy mini-spin column for purifica- tion (Qiagen, USA). Columns were washed and eluted following the manufacturer’s instruc- tions. RNA was quantified by spectrophotomet- ric absorption in a Nanodrop 1000 spectropho- tometer (Thermo Scientific, USA) and its quali- ty verified by microfluidics analysis with an Agilent Bioanalyzer 2100 (Agilent, USA).
First strand cDNA was synthesized by reverse transcriptase (Superscript II, Invitrogen, USA) from total RNA using oligo(dT)17 primer using 250 ng of total RNA per reaction.
The first strand cDNA was used as a tem- plate for the quantification of the relative expression levels of pcbAB, pcbC and penDE by qPCR analysis with an ABI Prism 7000 sequence detection system (Applied Biosystems, USA). Quantitative PCR reactions were performed in a 20 μL reaction mixture containing 1X SYBR Green Master Mix (Exiqon, Denmark), 0.2 μM each of the for- ward and reverse reaction primers, and diluted first-strand cDNA. Primer pairs used for quan- titative real time PCR reactions were designed using PRIMER3-plus software[18] from the known sequences for the penicillin biosynthet- ic genes pcbAB, pcbC and penDE genes, and for the constitutively expressed reference gapdh gene from P. chrysogenum. The PCR conditions were 95ºC for 10 min, followed by 40 cycles of 95ºC for 15 sec and 60ºC for 1 min. Each PCR reaction was run in triplicate.
For the pcbAB gene, the forward primer 5’- TGTGCAGGCCAAGGTAAAC-3’ corresponding to nucleotides 3806 to 3825 relative to the start codon and the reverse primer 5’- CCAGTTCAGTCTGGTGCTCA-3’ complementary to the nucleotides 3948 to 3967 amplified a 162-bp PCR product. For the penDE gene, the forward primer 5’-CGAAGAAGACGGACGAAGA- 3’ corresponding to nucleotides 118 to 137 rel- ative to the start codon and the reverse primer 5’- TGCGGGTATTAAGCATGACA -3’ complemen-tary to the nucleotides 249 to 268 amplified a 151-bp PCR product. For the pcbC gene, the forward primer 5’-ACGGCACCAAATTGAGTTTC- 3’ corresponding to nucleotides 614 to 633 rel- ative to the start codon and the reverse primer 5’- GGTGATGTGTGCCATGTAGC-3’ complemen-tary to the nucleotides 764 to 783 amplified a 170-bp PCR product. For the reference gene gapdh, the forward primer 5’-TCG- GTATCGTTGAGGGTCTC-3’ corresponding to nucleotides 500 to 519 relative to the start codon and the reverse primer 5’-GGTGGAG- GAGGGGATAATGT-3’ complementary to the nucleotides 611 to 630 amplified a 131-bp PCR product. The amplification efficiencies of the primers used for pcbAB, pcbC, penDE and gapdh genes was tested by the standard curve method. Relative expression values were cal- culated by the comparative ΔΔCt method. ΔCt values were determined for all the transcripts using gapdh as a reference gene transcript and the results normalized against the expression data obtained for each mRNA in the medium containing glucose as a sole carbon source.
A parallel assay was performed in each inde-pendent experiment to check the differences in PCR efficiency. This parallel assay was designed for analyzing penicillin gene expres- sion by qPCR from two additional carbon sources (glucose and phenol) obtained from the same preinoculum.

Antibiotic production

Penicillin was estimated by bioassay using the agar-diffusion method with Micrococcus luteus ATCC 9341 (kindly provided by Prof. JF Martín, León University) as an indicator strain as previously described.[19]

Phenol and phenolic compound concentrations

Phenol, catechol, resorcinol and hydro- quinone concentrations were quantified by High Performance Liquid Chromatography (L- 7100 LaChrom HPLC System, Merck), equipped with a quaternary pump system, and L-7400 UV detector according to a previously published method.[17] Aromatic compounds were separated and concentrations estimated with- in 10 min.

Results

Effect of phenol and phenolic compounds in the expression level of penicillin biosynthetic cluster

The gene expression levels of penicillin biosynthetic cluster of P. chrysogenum var. halophenolicum when grown in mineral medi- um with 2% NaCl and supplemented with glu- cose, phenol, catechol, hydroquinone and resorcinol as the sole carbon source were ana- lyzed by qPCR. The results of the expression of pcbAB, pcbC and penDE genes, expressed as normalized quantities for each gene relative to the glucose sample, are shown in Figure 2. From this figure, it can be seen that despite the relative abundance of each transcript, dif- ferences were observed in samples depending on carbon source and culture time, particular- ly at 45 h. The expression level of penicillin biosynthetic cluster increased for all the car- bon sources tested compared to the glucose batch. This increment in pcbAB, pcbC and penDE gene expression was at least a 100-fold in phenol and phenolic coumponds batches compared to glucose batch.
The expression of pcbAB was higher in batch cultures supplemented with phenol as the sole carbon source; meanwhile, the expres- sion of pcbAB was not significantly affected by phenolic compound. Maximal induction was observed for the pcbC gene, particularly in the case of catechol at 45 h of cultivation. Expression of pcbAB, pcbC and penDE were similar for catechol and hydroquinone.

Effect of salt, phenol and phenolic compounds on the expression level of penicillin biosynthetic cluster

To examine the expression level of peni- cillin biosynthetic cluster when P. chrysogenum var. halophenolicum is grown under osmotic stress, batch cultures of fungus in mineral medium with 5.9% NaCl and supplemented with glucose, phenol, catechol, hydroquinone and resorcinol as the sole carbon source were performed and the expression levels of pcbAB, pcbC and penDE were analyzed by qPCR. Figure 3 shows the results of pcbAB, pcbC and penDE gene expression after the normaliza- tion of quantities for each gene relative to the glucose sample. The mRNA levels from pcbAB, pcbC and penDE were reduced by the presence of 5.9% of sodium chloride. Expression of pcbAB and penDE was lower when fungus was grown with phenol and phenolic compounds than in a glucose batch. Approximately 2 times the pcbC expression was obtained in the phe-nol and phenolic compound batches compared to the glucose batch at 48 h. These results sug- gest that the salt had a negative effect on the expression of penicillin biosynthetic cluster.

Phenol and phenolic compounds are used with different efficiency by the P. chrysogenum var. halophenolicum strain

To determine the ability of P. chrysogenum var. halophenolicum to degrade phenol and phenolic compounds under optimal saline con- ditions (2% NaCl) and osmotic stress (5.9% NaCl), cultures with 2.67 mM of phenol, cate- chol, hydroquinone and resorcinol were per- formed at two saline concentrations. The degradation of phenol and phenolic com- pounds presented different rates depending on the salt concentration and aromatic compound tested (Figure 4). When the fungus was grown with phenol, catechol and hydroquinone with 2% NaCl after 45 h of cultivation none of these aromatic compounds were detected in the samples analyzed by HPLC. Meanwhile, for the same culture time (45 h), approximately 38.5%, 71.0% and 83.1% of phenol, hydro- quinone and catechol were degraded by fun- gus, respectively, in samples from culture per- formed with 5.9% of salt. Resorcinol was the aromatic compound that was less efficiently degraded by P. chrysogenum var. halopheno- licum. The percentage of catechol and hydro- quinone removal was higher than phenol and resorcinol at both times of cultivation.
These findings suggest that sodium chloride concentration regulated the phenol and pheno- lic compound degradation of P. chrysogenum var. halophenolicum. One explanation for the decrease of phenol and phenolic compound uptake was osmotic balance which would have resulted in a decreased of the biodegradation rate in high salt concentration cultures.

Effect of phenol and phenolic compounds on penicillin biosynthesis

Penicillin production by P. chrysogenum var. halophenolicum with phenol, catechol, hydro- quinone or resorcinol was quantified in batch cultures at 45 h and 68 h. Differences in β-lac- tam antibiotic production are clearly seen in mineral medium supplemented with 2% and 5.9% NaCl (Figure 5). Moreover, differences were observed in the penicillin pattern of phe- nolic compound cultures. Penicillin produc- tion was considerably higher in the cultures with 5.9% of salt at 45 h. Antibiotic production in the resorcinol batch was higher at both times in the cultures supplemented with 5.9% NaCl, whereas in the cultures with lower salt, penicillin production was higher in the phenol cultures. No difference was observed in peni- cillin production of catechol and hydroquinone cultures.
The onset of penicillin biosynthesis in the glucose cultures at 2% of salt took place after 36 h, although penicillin production was very small after 45 h. However, the penicillin pro- duction rate was considerably higher in the cultures with glucose as the sole carbon source supplemented with 5.9% of NaCl.
Penicillin yields of P. chrysogenum var. halophenolicum in the cultures containing resorcinol resulted in an antibiotic increase of about 300% with respect to the glucose at 68 h.

Discussion

The pcbAB, pcbC and penDE are the three penicillin biosynthesis genes that are present in a few evolutionarily related fungal species.[5,20] The conserved arrangement of the penicillin biosynthesis cluster in different species is one of the most important features that enable the coordinated regulation of the three genes in β-lactam antibiotic pathway.[21] P. chrysogenum var. halophenolicum (previously known as CLONA2) showed an overall high conservation degree between its penicillin gene cluster and the NRRL1951 (wild-type strain) or Wis54-1255 (an improved, moderate penicillin producer) strains.[15] Penicillin pro- duction is affected by some aspects of primary metabolism related to sugar catabolic path- ways and energy balance.[10,22] Several groups have described that transcription of the genes encoding for the enzymes in the penicillin biosynthesis pathway is repressed by glu- cose.[9,23,24,25] In P. chrysogenum, penicillin biosyn- thesis is repressed by glucose preventing expression of the pcbAB, pcbC and penDE genes.[25] According to published results, glu- cose induced not only higher rates of respira- tion but also greater energy production than lactose as carbon source in P. chrysogenum NRRL 1915 strain.[10] The presence of glucose caused a delay in penicillin production in the culture condition with 2% of salt. This result is in agreement with that reported about the effect of glucose on penicillin biosynthetic cluster. As shown in this article, lower levels of pcbAB and penDE gene expression were observed in phenol, catechol, hydroquinone and resorcinol containing medium with 5.9% NaCl compared to glucose condition, indicat- ing that these genes are repressed by phenol and phenolic compounds. Meanwhile, peni- cillin production increased when the fungus was cultivated in a high saline concentration with catechol, hydroquinone and resorcinol as the carbon source. In other words, the expres- sion level of pcbAB and penDE does not seem to be a relevant factor for antibiotic biosynthe- sis. Douma et al. [24] reported that the control of penicillin biosynthesis is exerted by a single rate-limiting enzyme: the isopenicillin N syn- thase encoded by the pcbCgene. Meanwhile, other groups report that the rate limiting step reside either at δ-(L-α-aminoadipyl)-L-cys- teinyl-D-valine synthetase or at isopenicillin N synthase.[26,27] In this present study, the pcbC gene was among those showing higher expres- sion levels. Indeed the expression of pcbC was at least 200 times higher in phenol and pheno- lic compounds containing medium than in cul- tures with glucose and 2% NaCl. The pcbC gene expressed differentially in catechol con- taining medium; expression levels 1,500 times higher than in glucose containing medium was observed at 45 h of cultivation, while an expression of 300 times was quantified at 68 h. The fermentation times for this study, 45 h and 68 h, were chosen in consideration of the fact that most secondary genes tend to show pat- terns of late expression and the phenol and phenolic compound removal rates. Low yields of penicillin were observed compared with the expression level of the antibiotic biosynthetic genes. This result is not surprising because in gene dosage studies it is frequently observed that a high increase in gene copy number does not correspond with a parallel increment in enzyme activity.[28] On the other hand, other phenomena besides genes expression could be responsible for the antibiotic production. Nasutation et al. [29] have shown from a peni- cillin producing strain in glucose-limited chemostat cultures that the penicillin produc- tion flux appears to be mostly influenced by cystein, one of the three precursor amino acids, and by energy and redox cofactors. The relation between the low penicillin production flux and the low ATP and NADPH levels could be a possible explanation for the present results. Furthermore, it was reported that peni- cillin biosynthesis was accompanied by the consumption of a surprising large amount of ATP.[30] Another hypothesis for the present results could be related to toxicity. As we know, very high amounts of hydrophilic penicillins could exert toxic effects on eukaryotic cells caused by the lipophilic interactions with intracellular membranes and plasma mem- brane.[2,31] Since it has been shown that P.chrysogenum var. halophenolicum strain pro- duced non-aromatic natural penicillins rather than benzylpenicillin, this hypothesis does not seem to be the principal reason for the low penicillin yields.[15] However, we cannot exclude the possibility that non-aromatic natural peni- cillins might not be actively pumped out of the cells in P. chrysogenum var. halophenolicum.
There was no evident relationship between the expression levels of penicillin biosynthetic genes and yields of penicillin. Meanwhile, the presence of phenol and phenolic compounds seems to influence antibiotic production. Moreover, in catechol and hydroquinone cul- tures, where the phenolic compounds were more efficiently removed by P. chrysogenum var. halophenolicum, the production of peni- cillin was lower than in fermentations contain- ing phenol and resorcinol. Despite the previ- ous observations that described the absence of the metabolic control in P. chrysogenum,[32] meaning that the carbon source had no effect on the penicillin production rate, we found a relationship between carbon metabolism and antibiotic biosynthesis. Interestingly, a posi- tive relationship was observed in media with phenol under 2% NaCl between the penicillin titers, expression levels of penicillin biosyn- thetic genes and carbon metabolism. In this case, a positive relationship was found between the efficiency of aromatic removal and antibiotic production. This fact could be explained by the mimicking effect between phenol and phenylacetic acid, a compound that is known to stimulate the penicillin biosyn- thetic pathway as a precursor of benzylpeni- cillin.[15] In the present study, we also observed that high concentrations of salt increased penicillin production yields. Since in a previ- ous work it was reported that 2% of NaCl is the optimum concentration of salt for P. chryso- genum var. halophenolicum, this result sug- gests that the antibiotic secretion could be a defence mechanism against osmotic stress.
In summary, today, biological treatment is still an interesting process to reduce the nega- tive impact of toxic compounds. The ability of P. chrysogenum var. halophenolicum to degrade catechol and hydroquinone was shown in conditions of 2% and 5.9% salt. The secretion of secondary metabolites with anti- bacterial activity is a useful natural tool for the microorganisms that produce them.[2,33] The present results have shown that P. chryso- genum var. halophenolicum produced β-lactam antibiotic in phenol and phenolic compounds containing medium with 2% and 5.9% of salt. These results support the hypothesis that phe-nol, phenolic compounds and high concentra- tions of salt could behave like stress factors triggering secondary metabolism in P. chryso- genum var. halophenolicum, and resulting in higher β-lactam antibiotic production. This could constitute an advantage for P. chryso- genum var. halophenolicum in wastewater treatment systems, since the production of a secondary metabolite such as penicillin could make it possible to establish the fungal strain, exerting a positive selection pressure over the endogenous native microbial population.

Author Contributions

SFG, performed engineering experiments with phenol, catechol, hydroquinone and resorcinol, as well as antibiotic estimation. ALL, was responsible for this work, performed the quantification of phenol and phenolic compounds by HPLC and qPCR experiments, and elaborated the present paper.

References

  1. Elander, R.P. Industrial production of beta- lactam antibiotics. Appl Microbiol Biote- chnol 2003, 61, 385–392. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Garcia-Estrada, C.; Vaca, I.; Lamas-Maceiras, M.; Martin, J.F. In vivo transport of the inter- mediates of the penicillin biosynthetic pathway in tailored strains of Penicillium chrysogenum. Appl Microbiol Biotechnol 2007, 76, 169–182. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Martin, M.F.; Liras, P. Organization and expression of genes involved in the biosynthesis of antibiotics and other sec- ondary metabolites. Annu Rev Microbiol 1989, 43, 173–206. [Google Scholar] [CrossRef]
  4. Newbert, R.W.; Barton, B.; Greaves, P.; Harper, J.; Turner, G. Analysis of a commercially improved Penicillium chrysogenum strain series: involvement of recombinogenic regions in amplification and deletion of the penicillin biosynthesis gene cluster. J Ind Microbiol Biotechnol 1997, 19, 18–27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Martin, J.F. Molecular control of expression of penicillin biosynthesis genes in fungi: regulatory proteins interact with a bidirec- tional promoter region. J Bacteriol 2000, 182, 2355–2362. [Google Scholar] [CrossRef] [Scilit]
  6. Diez, B.; Gutierrez, S.; Barredo, J.L.; van Solingen, P.; van der Voort, L.H.; Martin, J.F. The cluster of penicillin biosynthetic genes. Identification and characterization of the pcbAB gene encoding the alpha- aminoadipyl-cysteinyl-valine synthetase and linkage to the pcbC and penDE genes. J Biol Chem 1990, 265, 16358–16365. [Google Scholar]
  7. Ramos, F.R.; Lopez-Nieto, M.J.; Martin, J.F. Isopenicillin N synthetase of Penicillium chrysogenum, an enzyme that converts delta-(L-alpha-aminoadipyl)-L-cysteinyl- D-valine to isopenicillin N. Antimicrob Agents Chemother 1985, 27, 380–387. [Google Scholar] [CrossRef] [Scilit]
  8. Muller, W.H.; van der Krift, T.P.; Krouwer, A.J.; Wosten, H.A.; van der Vort, L.H.; Smaal, E.B.; et al. Localization of the pathway of the peni- cillin biosynthesis in Penicillium chryso- genum. EMBO J 1991, 10, 489–495. [Google Scholar] [CrossRef] [Scilit]
  9. Revilla, G.; Lopez-Nieto, M.J.; Luengo, J.M.; Martin, J.F. Carbon catabolite repression of penicillin biosynthesis by Penicillium chrysogenum. J Antibiot 1984, 37, 781–789. [Google Scholar] [CrossRef] [Scilit]
  10. Castillo, N.I.; Fierro, F.; Gutierrez, S.; Martin, J.F. Genome-wide analysis of differentially expressed genes from Penicillium chryso- genum grown with a repressing or a non- repressing carbon source. Curr Genet 2006, 49, 85–96. [Google Scholar] [CrossRef] [Scilit]
  11. Alva, V.A.; Peyton, B.M. Phenol and catechol biodegradation by the haloalkaliphile Halomonas campisalis: influence of pH and salinity. Environ Sci Technol 2003, 37, 4397–402. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Bastos, A.E.; Moon, D.H.; Rossi, A.; Trevors, J.T.; Tsai, S.M. Salt-tolerant phenol-degrading microorganisms isolated from Amazonian soil samples. Arch Microbiol 2000, 174, 346–352. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Hinteregger, C.; Streichsbier, F. Halomonas sp. , a moderately halophilic strain, for biotreatment of saline phenolic waste- water. Biotechnol Lett 1997, 19, 1099–1102. [Google Scholar]
  14. Peyton, B.M.; Wilson, T.; Yonge, D.R. Kinetics of phenol biodegradation in high salt solu- tions. Water Res 2002, 36, 4811–4820. [Google Scholar] [CrossRef] [Scilit]
  15. Leitão, A.L.; Garcia-Estrada, C.; Ullan, R.V.; Guedes, S.F.; Martin-Jimenez, Mendes B.; et al. Penicillium chrysogenum var. halophe- nolicum, a new halotolerant strain with potential in the remediation of aromatic compounds in high salt environments. Microbiol Res 2012, 167, 79–89. [Google Scholar] [CrossRef] [Scilit]
  16. Guedes, S.F.; Mendes, B.; Leitao, A.L. Resorcinol degradation by a Penicillium chrysogenum strain under osmotic stress: mono and binary substrate matrices with phenol. Biodegradation 2011, 22, 409–419. [Google Scholar] [CrossRef] [Scilit]
  17. Leitão, A.L.; Duarte, M.P.; Oliveira, J.S. Degradation of phenol by a halotolerant strain Penicillium chrysogenum. Int Biodeter Biodeg 2007, 59, 220–225. [Google Scholar] [CrossRef] [Scilit]
  18. Untergasser, A.; Nijveen, H.; Rao, X.; Bisseling, T.; Geurts, R.; Leunissen, J.A. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res 2007, 35, W71–W74. [Google Scholar] [CrossRef] [Scilit]
  19. Garcia-Estrada, C.; Vaca, I.; Fierro, F.; Sjollema, K.; Veenhuis, M.; Martin, J.F. The unpro- cessed preprotein form IATC103S of the isopenicillin N acyltransferase is trans- ported inside peroxisomes and regulates its self-processing. Fungal Genet Biol 2008, 45, 1043–1052. [Google Scholar] [CrossRef] [Scilit]
  20. Aharonowitz, Y.; Cohen, G.; Martin, J.F. Penicillin and cephalosporin biosynthetic genes: structure, organization, regulation, and evolution. Annu Rev Microbiol 1992, 46, 461–95. [Google Scholar] [CrossRef]
  21. Martin, J.F.; Gutierrez, S. Genes for beta-lac- tam antibiotic biosynthesis. Antonie Van Leeuwenhoek 1995, 67, 181–200. [Google Scholar] [CrossRef] [Scilit]
  22. Thykaer, J.; Nielsen, J. Metabolic engineer- ing of beta-lactam production. Metab Eng 2003, 5, 56–69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Brakhage, A.A.; Browne, P.; Turner, G. Regulation of Aspergillus nidulans peni- cillin biosynthesis and penicillin biosyn- thesis genes acvA and ipnA by glucose. J Bacteriol 1992, 174, 3789–3799. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Douma, R.D.; Verheijen, P.J.; de Laat, W.T.; Heijnen, J.J.; van Gulik, W.M. Dynamic gene expression regulation model for growth and penicillin production in Penicillium chrysogenum. Biotechnol Bioeng 2010, 106, 608–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Gutierrez, S.; Marcos, A.T.; Casqueiro, J.; Kosalkova, K.; Fernandez, F.J.; Velasco, J.; et al. Transcription of the pcbAB, pcbC and penDE genes of Penicillium chrysogenum AS-P-78 is repressed by glucose and the repression is not reversed by alkaline pHs. Microbiology 1999, 145, 317–324. [Google Scholar] [CrossRef] [Scilit]
  26. Nielsen, J.; Jorgensen, H.S. Metabolic control analysis of the penicillin biosynthetic pathway in a high-yielding strain of Penicillium chrysogenum. Biotechnol Prog 1995, 11, 299–305. [Google Scholar] [CrossRef] [Scilit]
  27. Revilla, G.; Ramos, F.R.; Lopez-Nieto, M.J.; Alvarez, E.; Martin, J.F. Glucose represses for- mation of delta-(L-alpha-aminoadipyl)-L- cysteinyl-D-valine and isopenicillin N syn- thase but not penicillin acyltransferase in Penicillium chrysogenum. J Bacteriol 1986, 168, 947–952. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Chary, V.K.; de la Fuente, J.L.; Leitão, A.L.; Liras, P.; Martin, J.F. Overexpression of the lat gene in Nocardia lactamdurans from strong heterologous promoters results in very high levels of lysine-6-aminotrans- ferase and up to two-fold increase in cephamycin C production. Appl Microbiol Biotechnol 2000, 53, 282–288. [Google Scholar] [CrossRef] [Scilit]
  29. Nasution, U.; van Gulik, W.M.; Ras, C.; Proell, A.; Heijnen, J.J. A metabolome study of the steady-state relation between central metabolism, amino acid biosynthesis and penicillin production in Penicillium chrysogenum. Metab Eng 2008, 10, 10–23. [Google Scholar] [CrossRef] [Scilit]
  30. van Gulik, W.M.; Antoniewicz, M.R.; deLaat, W.T.; Vinke, J.L.; Heijnen, J.J. Energetics of growth and penicillin production in a high- producing strain of Penicillium chryso- genum. Biotechnol Bioeng 2001, 72, 185–193. [Google Scholar] [CrossRef] [Scilit]
  31. Sikkema, J.; de Bont, J.A.; Poolman, B. Mechanisms of membrane toxicity of hydrocarbons. Microbiol Rev 1995, 59, 201–222. [Google Scholar] [CrossRef] [PubMed]
  32. van Gulik, W.M.; de Laat, W.T.; Vinke, J.L.; Heijnen, J.J. Application of metabolic flux analysis for the identification of metabolic bottlenecks in the biosynthesis of peni- cillin-G. Biotechnol Bioeng 2000, 68, 602–618. [Google Scholar] [CrossRef] [Scilit]
  33. Martin, J.F.; Casqueiro, J.; Liras, P. Secretion systems for secondary metabolites: how producer cells send out messages of inter- cellular communication. Curr Opin Micro- biol 2005, 8, 282–293. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Biosynthesis of the β-lactam penicillin G. (A) Penicillin gene cluster in the P. chrysogenum. The pcbAB, pcbC and penE enconde ACV synthetase, IPN synthase, and IPN acyltransferase, respectively. The black arrows indicate the orientation of the genes. The bidirectional pcbAB-pcbC promoter region and penE promoter are indicated with boxes. (B) Penicillin biosynthetic pathway from the three amino acids precursors. The schematic representation shows the genes and proteins involved in different steps of the biosynthesis of penicillin G. LLD-ACV, α-L-aminoadipyl-L-cysteinyl-D-valine; IPN, isopenicillin N.
Figure 1. Biosynthesis of the β-lactam penicillin G. (A) Penicillin gene cluster in the P. chrysogenum. The pcbAB, pcbC and penE enconde ACV synthetase, IPN synthase, and IPN acyltransferase, respectively. The black arrows indicate the orientation of the genes. The bidirectional pcbAB-pcbC promoter region and penE promoter are indicated with boxes. (B) Penicillin biosynthetic pathway from the three amino acids precursors. The schematic representation shows the genes and proteins involved in different steps of the biosynthesis of penicillin G. LLD-ACV, α-L-aminoadipyl-L-cysteinyl-D-valine; IPN, isopenicillin N.
Jox 02 e2 g001
Figure 2. Relative expression values for pcbAB, pcbC and penDE messenger RNAs quantified by qPCR in the presence of phenol (PHE), resorcinol (RES), catechol (CAT) and hydroquinone (HYD) in culture with 2% NaCl at two different culture times (45 and 68 h). Results were normalized against the expression values obtained in the same conditions using glucose (GLU) as the sole carbon source. (A) pcbAB, (B) pcbCand (C) penDE. Data correspond to three biological replicates performed in triplicate.
Figure 2. Relative expression values for pcbAB, pcbC and penDE messenger RNAs quantified by qPCR in the presence of phenol (PHE), resorcinol (RES), catechol (CAT) and hydroquinone (HYD) in culture with 2% NaCl at two different culture times (45 and 68 h). Results were normalized against the expression values obtained in the same conditions using glucose (GLU) as the sole carbon source. (A) pcbAB, (B) pcbCand (C) penDE. Data correspond to three biological replicates performed in triplicate.
Jox 02 e2 g002
Figure 3. Relative expression values for pcbAB, pcbC and penDE messenger RNAs quantified by qPCR in high saline condition (5.9% NaCl) and in the presence of phenol (PHE), resorcinol (RES), catechol (CAT) and hydroquinone (HYQ) at two different culture times (45 and 68 h). Results were normalized against the expression values obtained in the same conditions using glucose (GLU) as the sole carbon source. (A) pcbAB, (B) pcbC and (C) penDE. Data correspond to three biological replicates performed in triplicate.
Figure 3. Relative expression values for pcbAB, pcbC and penDE messenger RNAs quantified by qPCR in high saline condition (5.9% NaCl) and in the presence of phenol (PHE), resorcinol (RES), catechol (CAT) and hydroquinone (HYQ) at two different culture times (45 and 68 h). Results were normalized against the expression values obtained in the same conditions using glucose (GLU) as the sole carbon source. (A) pcbAB, (B) pcbC and (C) penDE. Data correspond to three biological replicates performed in triplicate.
Jox 02 e2 g003
Figure 4. Degradation of 2.67 mM of phenol and phenolic compound as the sole carbon source by P. chrysogenum var. halophenolicum in two different saline conditions. (A) 2% NaCl and (B) 5.9% NaCl. PHE, phenol; RES, resorcinol; CAT, catechol; HYD, hydro- quinone. Error bars represent the standard deviation of three replicates.
Figure 4. Degradation of 2.67 mM of phenol and phenolic compound as the sole carbon source by P. chrysogenum var. halophenolicum in two different saline conditions. (A) 2% NaCl and (B) 5.9% NaCl. PHE, phenol; RES, resorcinol; CAT, catechol; HYD, hydro- quinone. Error bars represent the standard deviation of three replicates.
Jox 02 e2 g004
Figure 5. Antibiotic production by P. chrysogenum var. halophenolicum in mineral medi- um supplemented with glucose (GLU), phenol (PHE), resorcinol (RES), catechol (CAT) and hydroquinone (HYD) at two saline concentrations (2% and 5.9% NaCl). (A) Penicillin production at two culture times (45 h and 68 h). (B) Bioassay using diluted cul- ture filtrates (dilution 1:2) obtained at 68 h in cultures with phenol and 5.9% NaCl (1), catechol and 5.9% NaCl (2), hydroquinone and 5.9% NaCl (3), resorcinol and 5.9% NaCl (4), phenol and 2% NaCl (5), catechol and 2% NaCl (6), hydroquinone and 2% NaCl (7), resorcinol and 2% NaCl (8).
Figure 5. Antibiotic production by P. chrysogenum var. halophenolicum in mineral medi- um supplemented with glucose (GLU), phenol (PHE), resorcinol (RES), catechol (CAT) and hydroquinone (HYD) at two saline concentrations (2% and 5.9% NaCl). (A) Penicillin production at two culture times (45 h and 68 h). (B) Bioassay using diluted cul- ture filtrates (dilution 1:2) obtained at 68 h in cultures with phenol and 5.9% NaCl (1), catechol and 5.9% NaCl (2), hydroquinone and 5.9% NaCl (3), resorcinol and 5.9% NaCl (4), phenol and 2% NaCl (5), catechol and 2% NaCl (6), hydroquinone and 2% NaCl (7), resorcinol and 2% NaCl (8).
Jox 02 e2 g005

Share and Cite

MDPI and ACS Style

Ferreira Guedes, S.; Leitão, A.L. Effect of Phenolic Compounds and Osmotic Stress on the Expression of Penicillin Biosynthetic Genes from Penicillium chrysogenum var. halophenolicum Strain. J. Xenobiotics 2012, 2, e2. https://doi.org/10.4081/xeno.2012.e2

AMA Style

Ferreira Guedes S, Leitão AL. Effect of Phenolic Compounds and Osmotic Stress on the Expression of Penicillin Biosynthetic Genes from Penicillium chrysogenum var. halophenolicum Strain. Journal of Xenobiotics. 2012; 2(1):e2. https://doi.org/10.4081/xeno.2012.e2

Chicago/Turabian Style

Ferreira Guedes, Sumaya, and Ana Lúcia Leitão. 2012. "Effect of Phenolic Compounds and Osmotic Stress on the Expression of Penicillin Biosynthetic Genes from Penicillium chrysogenum var. halophenolicum Strain" Journal of Xenobiotics 2, no. 1: e2. https://doi.org/10.4081/xeno.2012.e2

APA Style

Ferreira Guedes, S., & Leitão, A. L. (2012). Effect of Phenolic Compounds and Osmotic Stress on the Expression of Penicillin Biosynthetic Genes from Penicillium chrysogenum var. halophenolicum Strain. Journal of Xenobiotics, 2(1), e2. https://doi.org/10.4081/xeno.2012.e2

Article Metrics

Back to TopTop