Previous Article in Journal
Characterization of Viral Communities and Two Novel Viruses in Symptomatic Tea Plants via Ribodepleted Transcriptome Sequencing
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJPB
Volume 16
Issue 4
10.3390/ijpb16040142
ijpb-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genomic and Phylogenetic Evidence for a Novel Emaravirus Infecting Cacao (Theobroma cacao L.) in Amazonas, Peru

by
Angel F. Huaman-Pilco
1,2,*,
Nicola Fiore
1,
Oscar P. Hurtado-Gonzales
3,
Larissa Carvalho Costa
3,
Xiaojun Hu
3,
Manuel Oliva-Cruz
2,4,
Jorge R. Díaz-Valderrama
2,4 and
Alan Zamorano
1,2,*
1
Departamento de Sanidad Vegetal, Facultad de Ciencias Agronómicas, Universidad de Chile, Santiago 8820808, Chile
2
Grupo de Investigación en Patología Intracelular de Plantas, Instituto de Investigación para el Desarrollo Sustentable de Ceja de Selva, Universidad Nacional Toribio Rodríguez de Mendoza de Amazonas (UNTRM), Chachapoyas 01001, Peru
3
Plant Germplasm Quarantine Program, Animal and Plant Health Inspection Service, United States Department of Agriculture, Beltsville, MD 20705, USA
4
Facultad de Ingeniería y Ciencias Agrarias, Universidad Nacional Toribio Rodríguez de Mendoza de Amazonas, Chachapoyas 01001, Peru
*
Authors to whom correspondence should be addressed.
Int. J. Plant Biol. 2025, 16(4), 142; https://doi.org/10.3390/ijpb16040142
Submission received: 11 November 2025 / Revised: 30 November 2025 / Accepted: 8 December 2025 / Published: 16 December 2025
(This article belongs to the Section Plant–Microorganisms Interactions)
Browse Figures
Versions Notes

Abstract

Preserving Peruvian cacao germplasm requires preventing the spread of pathogens such as viruses, yet cacao viral diseases in Peru remain poorly studied. In this study, we characterized the viral sequences associated with native cacao trees from the department of Amazonas, northwestern Peru. Leaf samples from two symptomatic plants (mosaic, yellowing, leaf deformation) and one asymptomatic plant were collected from the cacao germplasm bank of the Universidad Nacional Toribio Rodríguez de Mendoza de Amazonas. RNA high-throughput sequencing identified four RNA segments consistent with the genus Emaravirus: RNA1 (7142 nt; replicase P1), RNA2 (2225 nt; glycoprotein P2), RNA3 (1269 nt; nucleocapsid P3), and RNA4 (1286 nt; movement protein P4), sharing 32.6–45.9% amino acid identity with European mountain ash ringspot-associated emaravirus (EMARaV). Phylogenetic analysis of P1–P4 proteins placed this virus in a distinct lineage, confirming it as a novel species, Theobroma cacao emaravirus A (ThCEV-A). Specific RT-PCR detected ThCEV-A in 11 additional accessions, with symptoms including yellow mosaic and mottling. This study documents for the first time the presence of a novel Emaravirus in cacao, highlighting the need to assess its epidemiology, vector(s), and potential impact on cacao production in its center of origin.

1. Introduction

Cacao cultivation (Theobroma cacao L.) is the most economically important tropical crop, originating in rainforest regions of South America [1]. This tropical crop provides the raw material for the billionaire chocolate industry [2]. Peru is the second-largest organic cacao producer in the world [3], and production is mainly by smallholder farmers [4]. The most important diseases affecting cacao production in Peru are caused by fungi, such as frost rot (Moniliophthora roreri), witches’ broom (Moniliophthora perniciosa), and thread blight (Maramius species) [4,5,6]. To date, viral diseases have never been reported in cacao plants in Peru; however, more than six cacao viruses have been reported in other countries, including cacao necrosis virus (CNV), genus Nepovirus, family Secoviridae, in Nigeria [7]; cacao yellow mosaic virus (CYMV; Tymovirus, Tymoviridae) in Sierra Leone [8]; several viruses belonging to the genus Badnavirus (Caulimoviridae family), such as the cacao swollen shoot virus (CSSV) in Trinidad and Tobago [9], cacao yellow vein banding virus (CYVBV), cacao mild mosaic virus (CaMMV) in Cote d’ivoire and Ghana [10], in Brazil and Puerto Rico [11], in Indonesia [12], and Cacao bacilliform SriLanka virus (CBSLV) in Sri Lanka [13]. Some of these viruses, such as CSSV complex, can cause millions of dollars in losses every year [14]. In the present study, we have identified, for the first time, a new virus of the genus Emaravirus infecting the cacao crop in Peru. The Emaravirus genus belongs to the Fimoviridae family, order Bunyavirales, and it has been reported to infect many crops and forest plants worldwide [15].
Members of the genus Emaravirus have a segmented genome composed of four to ten linear, negative-sense, single-stranded RNA segments. The four main RNA molecules encode a viral RNA-dependent RNA polymerase (RdRp), a glycoprotein (GP), a nucleocapsid (NC) protein, and a movement protein (MP), respectively [16]. The function of the proteins encoded by the components RNA5 through RNA8 is still not elucidated, but some studies have suggested the involvement of P7 and P8 proteins of High Plains wheat mosaic virus (HPWMoV) in host RNA silencing suppressor [17].
According to the International Committee on Taxonomy of Viruses (ICTV), metadata released in November 2024 (https://ictv.global/taxonomy (accessed on 10 Janyary 2025)), the genus Emaravirus contains 33 recognized species. Since the discovery of the first emaravirus, the European mountain ash ringspot-associated emaravirus (EMARaV) [18], the number of recognized species within the genus Emaravirus has steadily increased, along with the diversity of host plants. These negative-sense, multipartite RNA viruses have been reported infecting a wide range of plant groups worldwide, including ornamentals [15,19,20,21,22], fruit crops [23,24,25,26,27,28,29], cereals [30], legumes [31], forest trees [32,33,34,35,36,37,38], medicinal plants [39,40], climbing plants or lianas [41], and even parasitic plants [42]. This expanding host range underscores the ecological relevance and phytosanitary importance of Emaravirus species in both cultivated and wild ecosystems.
In March 2022, virus-like symptoms, including chlorotic mottling and leaf deformation, were observed in cacao trees maintained in the native germplasm collection of the Universidad Toribio Rodríguez de Mendoza de Amazonas, Peru. To investigate the viral etiology of these symptoms, high-throughput RNA sequencing (HTS), also known as Next Generation Sequencing (NGS), was performed on symptomatic and asymptomatic samples. The resulting data enabled the de novo assembly and molecular characterization of four RNA genomic segments corresponding to a novel species of Emaravirus infecting cacao. Additionally, a regional survey was conducted across multiple cacao-producing zones in the Amazonas department of Peru to assess the distribution of this newly identified virus.

2. Materials and Methods

2.1. Plant Samples

In March 2022, during a phytosanitary survey at the native cacao germplasm bank of the Universidad Nacional Toribio Rodríguez de Mendoza of Amazonas (UNTRM-A), Peru (5.74692388 S, 78.36115647 W), we identified samples CAC1, CAC5, and CAC10 exhibiting virus-like mosaic symptoms, and CAC10 was asymptomatic (Figure 1). Small segments, up to 100 mg, were taken from each of the 10 leaves for RNA extraction.

2.2. Next-Generation Sequencing, Sequence Assembly, and Annotation

Total RNA from leaves of each of the three cacao accessions was isolated using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, St. Louis, MO, USA) following the manufacturer’s instructions. The quality and concentration of the RNA extracts were evaluated using the BioSpectrometer (Eppendorf AG, Hamburg, Germany) and also on a 1.2% agarose gel. Libraries for each sample were prepared using the TruSeq Stranded Total RNA with Ribo-Zero Plant kit and later sequenced on the Illumina NovaSeq 6000 platform in 2 × 150 paired-end format by Psomagen Inc. (Rockville, MD, USA). The raw reads of metagenomic results from NGS were filtered by quality and size. Then, they were assembled using the de novo assembly tool in CLC Genomics Workbench V. 21.0.1 software (QIAGEN, Hilden, Germany) [43]. The contigs obtained were analyzed using the USDA-APHIS PGQP PhytoPipe workflow (https://github.com/healthyPlant/PhytoPipe (accessed on 5 December 2024)) [44]. Afterwards, local BlastX analysis was performed on CLC against full-length viral sequences of plant pathogenic viruses downloaded from GenBank. The viral sequences obtained from the local BlastX were validated using the online NCBI BlastX tool (https://blast.ncbi.nlm.nih.gov/ (accessed on 10 December 2024)). The Open Reading Frames (ORFs) were identified using NCBI ORFfinder (https://www.ncbi.nlm.nih.gov/orffinder/ (accessed on 10 December 2024)), and their putative functions were inferred from conserved domain searches in CDD, Pfam, and HHPred. Domain signatures consistent with emaravirus RdRp (P1), glycoprotein precursor (P2), nucleocapsid protein (P3), and movement protein (P4) enabled functional annotation.

2.3. Phylogenetic and Protein Structure Analysis

Phylogenetic analysis of amino acid sequences corresponding to each of the four RNA-encoded proteins from all described Emaravirus species, together with those of the newly identified virus, was initially performed using BioEdit [45]. The sequences were subsequently aligned with MUSCLE [46] as implemented in the MEGA X [47]. Phylogenetic relationships were inferred through the CIPRES Science Gateway v3.3 [48], employing the RAxML-HPC BlackBox algorithm with 1000 bootstrap replicates. The resulting trees were visualized and edited using the Interactive Tree of Life (iTOL: itol.embl.de) online platform [49]. In addition, the three-dimensional structures of the four viral proteins (P1–P4) were predicted in silico using AlphaFold Server (https://alphafoldserver.com/ (accessed on 10 August 2025)) with default parameters. Structural confidence was evaluated from pLDDT scores and predicted aligned error (PAE) plots, considering only regions with pLDDT > 70 for structural interpretation.

2.4. Occurrence of the Novel Virus in Native Cacao Accessions

A total of 60 cacao plants from the Instituto Nacional de Innovación Agraria (INIA) germplasm bank, the INDES-CES collection bank, and different producing areas in the Amazonas department, Peru (Table S1), were screened by RT-PCR using targeted primers for RNA1, RNA2, RNA3, and RNA4 of ThCEV-A. Primers were designed in the online platform tool Primer3 (https://primer3.ut.ee/ (accessed on 20 December 2024)) (Table 1). For RT-PCR, the first-strand cDNA was synthesized using the Reliance Select cDNA Synthesis Kit (Bio-Rad, CA, USA) with random hexamer primers, then 10 μL of total RNA was denatured at 95 °C for 5 min prior to reverse transcription. PCR reactions (30 μL total volume) contained 3 μL of 10× PCR buffer, 1.5 μL of 50 mM MgCl2, 1 μL of 10 mM dNTPs, 1 μL each of for/rev primers (0.8 μM final concentration), 20.8 μL of nuclease-free water, 0.2 μL of Taq DNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA), and 1.5 μL of cDNA template. Cycling conditions were: initial denaturation at 94 °C for 2 min; 40 cycles of 94 °C for 30 s, annealing at 57 °C for 15 s, and extension at 72 °C for 30 s; and a final extension at 72 °C for 10 min. PCR products were purified and sequenced in both directions using the same primers listed in Table 1. Sequencing was performed by Psomagen Inc. (Rockville, MD, USA).

3. Results

3.1. Virus Identification by High Throughput Sequencing

NGS analysis generated 54, 60, and 64 million reads for CAC1, CAC5, and CAC10, respectively. Reads were assembled de novo, producing 457,343 contigs with a minimum length of 100 nt (Table 2). Initial BLASTX searches against a local database sequence for CAC5 and CAC1 revealed four contigs showing homology to members of the genus Emaravirus. The contigs were extracted and analyzed using BLASTX (BLAST+ 2.13.0) against the NCBI database. The results showed that RNA1, RNA2, RNA3, and RNA4 sequences of the new virus had the highest amino acid identity with Actinidia chlorotic ringspot-associated virus (AcCRaV—Accession number: QJD14761) (46.35%), pigeonpea sterility mosaic virus 2 (PPSMV-2—Accession number: YP_009268865) (33.23%), pea-associated emaravirus (PaEV—Accession number: QJX15716) (34.54%), and aspen mosaic-associated virus (ASaV—Accession number: CAA0079685) (30.14%), respectively. These results indicated the presence of a putative new Emaravirus species, tentatively designated Theobroma cacao emaravirus A (ThCEV-A). Both CAC1 and CAC5 generated contigs corresponding to RNA1–RNA4 of this Emaravirus, with CAC5 showing the highest read coverage for all segments (Table 2). Apart from these emaraviral contigs, no additional viral sequences with significant similarity to known plant viruses were detected in the HTS datasets based on BLASTX searches and PhytoPipe analysis, indicating that ThCEV-A was the only virus identified in the sequenced cacao accessions

3.2. Genome Structure and Encoded Proteins

The genome of ThCEV-A comprises four RNA genomic segments, each encoding a unique open reading frame (ORF) (Figure 2), and all share a characteristic 13-nucleotide complementary sequence (AGTAGTGTTCTCC) at their 5′ and 3′ termini. To complete the genomic termini, 5′ and 3′ RACE-PCR was performed using the SMARTer RACE 5′/3′ kit (Takara Bio, San Jose, CA, USA). Gene-specific primers were designed from the de novo assembled contigs (Supplementary Table S3). RACE products were purified, cloned into pGEM-T Easy (Promega, Madison, WI, USA), and sequenced by Psomagen Inc. (Rockville, MD, USA), confirming the canonical terminal sequence of RNA genomic segments. RNA1 (Accession number: PX114415) is the largest segment, with 7142 nt. It encodes a putative polypeptide P1 (nt positions 7090-107) of 2327 aa with a predicted molecular mass of 272.18 kDa. The protein encoded by RNA1 was identified as RNA-dependent RNA polymerase (RdRp); RNA2 (Accession number: PX114416), with 2234 nt, encodes a putative P2 (nt positions 2173-116) of 685 aa with a predicted molecular mass of 79.96 kDa. The protein encoded by RNA2 was identified as the precursor glycoprotein (GP). RNA3 (Accession number: PX114417), 1270 nt in length, encodes a putative P3 (nt positions 1188-268) of 306 aa with a predicted molecular mass of 34.68 kDa. The protein encoded by RNA3 was identified as the nucleocapsid protein (NP). RNA4 (Accession number: OR820869), 1286 nt in length, encoded a putative P4 (nt positions 1186-47) of 379 aa with predicted molecular mass 43.5 kDa. The protein encoded by RNA4 was identified as the movement protein (MP). P1 to P4 share the highest amino acid identities of 45.90%, 33.65%, 35.21%, and 30.65%, respectively, with the closest Emaravirus sequences available in GenBank. According to the ICTV, the species demarcation threshold for Emaravirus is 75% amino acid identity for each genomic segment [16], which, together with our phylogenetic analyses, supports the classification of the virus identified in cacao as a novel Emaravirus species.

3.3. Phylogenetic Analysis of the New Emaravirus

We inferred evolutionary relationships based on complete amino acid sequences of RdRp (P1), GP (P2), NP (P3), and MP (P4) from 24 phylogenetically closest Emaravirus species available in NCBI (Table S2), along with the corresponding sequences of the newly identified virus. The resulting trees confirmed the relationships inferred from BLAST analyses. In all four protein-based trees, ThCEV-A clustered within the genus Emaravirus but consistently formed a distinct, well-supported clade, strongly supporting its classification as a novel species within the genus. Furthermore, the three-dimensional structures of the four proteins were predicted using AlphaFold [50], which revealed folding patterns in agreement with their putative functional roles (Figure 3).

3.4. Validation of the Presence of Novel Virus in Native Accessions of Cacao

We were unable to correlate the presence of the new Emaravirus with the observed symptoms. This might be due to its likely interaction with other viruses. However, we validated the primers designed to detect it. Among the 60 cacao accessions tested by RT-PCR with specific primers for ThCEV-A, eleven accessions tested positive for the four RNA genomes of this new virus (Figure 4), and their origin and symptoms are summarized in Table 3. The PCR products were Sanger sequenced and confirmed the presence of novel virus ThCV-A.
Some positive accessions exhibited yellow mosaic and yellow mottling symptoms (Supplementary Figure S1). However, the symptoms varied across different positive accessions, and further studies are required to characterize the symptoms associated with this viral infection in cacao. The negative samples were asymptomatic or showed other symptoms.

4. Discussion

NGS technologies are the most reliable techniques for viral metagenomic studies [51], enabling the identification of known and novel viruses. Peru is an important center of origin for cacao. Recent studies have revealed unique genetic groups of cacao in the region [52]. In the present study, the sequencing of leaves from cacao trees in the INDES-CES germplasm bank exhibiting virus-like symptoms allowed the identification of four genomic segments of a novel negative-stranded RNA virus belonging to the genus Emaravirus. To the best of our knowledge, this is the first report of an Emaravirus infecting cacao plants in the world. The genomes of all four segments of this new virus were fully characterized, and a survey for its presence in other accessions from different regions of Amazonas, Peru, was also conducted.
The Emaravirus identified in this study, tentatively named Theobroma cacao emaravirus A (ThCEV-A), has a multipartite genome comprising four single-stranded RNAs (RNA1–RNA4) encoding P1 (RdRp), P2 (GP), P3 (NP), and P4 (MP). All proteins share <75% amino acid identity with their closest homologs, below the ICTV species demarcation threshold for this genus. Phylogenetic analyses placed ThCEV-A in a distinct, well-supported clade within the genus. The genome also exhibits the conserved 13-nucleotide terminal sequence (AGTAGTGTTCTCC) characteristic of the genus, further supporting its classification as a novel taxon.
To date, Emaravirus species have been reported to infect a range of hosts, including fruit trees, forest plants, ornamentals, cereals, parasitic plants, and others. Different symptoms associated with this Emaravirus species have been observed in infected plants, including yellow-mottle in jujube Ziziphus jujuba Mill [27], chlorotic mottling in grapevine [53], yellow mottling and yellowing in Camellia japonica [54], and mottle, mosaic in Populus tremula [33]. In this study, mottled yellow leaves or mosaics were also observed in infected cacao samples. However, we could not correlate the presence of the new Emaravirus with the symptoms across the different positive samples. The interaction with other unknown viruses and the diverse genetic backgrounds of the cacao accessions evaluated may contribute to the different responses to this viral infection. Additionally, the presence of this Emaravirus in only 11 out of 60 samples (approximately 18%) suggests a relatively low prevalence and may not currently pose a major concern. However, future studies and continued monitoring are recommended to assess potential changes in its distribution or impact over time.
Members of the genus Emaravirus are transmitted horizontally by mites of the Eriophyidae family [55]. Some Aceria mite species have been reported to cause serious problems in cacao production in Venezuela, Costa Rica, Ecuador, and Brazil [56]. Aceria spp. is a known vector of Emaraviruses [40]; however, entomological studies on mite populations and virus transmission in the cacao crop in Peru are poorly documented.
The results obtained in this study provide valuable information for cacao producers and extend the knowledge of molecular diversity and host range of Emaraviruses. Future research should aim to elucidate the impact of ThCEV-A infection on cacao production, map its geographic distribution across major cultivation areas, identify potential insect vectors responsible for its dissemination, and investigate alternative host species that may participate in its epidemiological cycle. Since Peru holds more than 60% of the world’s native cacao germplasm, the export of cacao genotypes is common. Therefore, this study underscores the importance of accurately diagnosing the phytosanitary status of cacao planting material to prevent the spread of pathogens that could trigger outbreaks in other cacao-producing countries.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijpb16040142/s1, Table S1: Samples tested with specific primers of new, Table S2: Accession number of Emaravirus species used for phylogeny un this study, Table S3: List of gene-specific primers and conserved terminal primers (3C and 5H) used for 5′/3′ RACE-PCR to obtain full terminal sequences of ThCEV-A RNA1–RNA4, Figure S1: Symptoms in cacao native accessions positive to ThCEVA.

Author Contributions

Conceptualization, A.F.H.-P., N.F. and A.Z.; methodology, O.P.H.-G. and X.H.; software, X.H.; validation, L.C.C.; formal analysis, J.R.D.-V.; investigation, A.F.H.-P., L.C.C. and M.O.-C.; resources, A.Z.; data curation, O.P.H.-G. and M.O.-C.; writing—original draft preparation, A.F.H.-P., N.F., O.P.H.-G., L.C.C. and X.H.; writing—review and editing, M.O.-C., J.R.D.-V. and A.Z.; visualization, J.R.D.-V.; supervision, N.F. and A.Z.; funding acquisition, A.F.H.-P. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Consejo Nacional de Ciencia, Tecnología e Innovación (CONCYTEC) of Peru, through the PROCIENCIA program (contract PE501086829-2024-PROCIENCIA, Project: VIRSEQ.

Data Availability Statement

The datasets generated in this study are available in the NCBI repository (https://www.ncbi.nlm.nih.gov/), with accession numbers provided in the article.

Acknowledgments

We gratefully acknowledge the support of the Peruvian public financial projects CEINCACAO (CUI N°2315081) and BIODIVERSIDAD (CUI N°2261386), the Plant Health Laboratory of UNTRM-A, and the INIA for facilitating access to the germplasm bank at the Huarangopampa Agrarian Experimental Station in Amazonas. We also thank Danilo Bustamante for his assistance during the early stages of this study, including the provision of certain reagents used in the laboratory work.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. De Souza, P.A.; Moreira, L.F.; Sarmento, D.H.A.; Da Costa, F.B. Cacao—Theobroma cacao. Exot. Fruits 2018, 3, 69–76. [Google Scholar] [CrossRef]
  2. Campos-Vega, R.; Nieto-Figueroa, K.H.; Oomah, B.D. Cocoa (Theobroma cacao L.) pod husk: Renewable source of bioactive compounds. Trends Food Sci. Technol. 2018, 81, 172–184. [Google Scholar] [CrossRef]
  3. Sánchez, V.H.; Zambrano, J.L.; Iglesias, C.; Rodríguez, E.; Villalobos, V.; Díaz, F.J.; Carrillo, N.; Gutiérrez, A.; Camacho, A.; Rodríguez, O. La Cadena de Valor del Cacao en América Latina y el Caribe. 2019. Available online: https://repositorio.iniap.gob.ec/bitstream/41000/5382/1/Informe%20CACAO.pdf (accessed on 11 November 2025).
  4. Díaz-Valderrama, J.R.; Leiva-Espinoza, S.T.; Aime, M.C. The history of cacao and its diseases in the Americas. Phytopathology 2020, 110, 1604–1619. [Google Scholar] [CrossRef] [PubMed]
  5. Huaman-Pilco, A.F.; Torres-De la Cruz, M.; Aime, M.C.; Leiva-Espinoza, S.T.; Oliva-Cruz, S.M.; Díaz-Valderrama, J.R. First report of thread blight caused by Marasmius tenuissimus on cacao (Theobroma cacao) in Peru. Plant Dis. 2023, 107, 219. [Google Scholar] [CrossRef]
  6. Huaman-Pilco, A.F.; Ramos-Carrasco, T.A.; Franco, M.E.E.; Tineo-Flores, D.; Estrada-Cañari, R.; Romero, P.E.; Aguilar-Rafael, V.; Ramírez-Orrego, L.A.; Tincopa-Marca, R.; Márquez, F.R.; et al. Morphological, phylogenetic, and genomic evidence reveals the causal agent of thread blight disease of cacao in Peru is a new species of Marasmius in the section Neosessiles, Marasmius infestans sp. nov. F1000Research 2024, 12, 1327. [Google Scholar] [CrossRef]
  7. Owusu, G.K. Cocoa necrosis virus in Ghana. Trop. Agric. 1971, 48, 133–139. [Google Scholar]
  8. Brunt, A.A.; Kenten, R.H.; Gibbs, A.J.; Nixon, H.L. Further studies on cocoa yellow mosaic virus. Microbiology 1965, 38, 81–90. [Google Scholar] [CrossRef]
  9. Posnette, A.F. Virus diseases of cacao in Trinidad. Trop. Agric. 1947, 24, 127–130. Available online: https://www.cabidigitallibrary.org/doi/pdf/10.5555/20063049488 (accessed on 11 November 2025).
  10. Chingandu, N.; Kouakou, K.; Aka, R.; Ameyaw, G.; Gutierrez, O.A.; Herrmann, H.W.; Brown, J.K. The proposed new species, cacao red vein virus, and three previously recognized badnavirus species are associated with cacao swollen shoot disease. Virol. J. 2017, 14, 199. [Google Scholar] [CrossRef]
  11. Ramos-Sobrinho, R.; Ferro, M.M.M.; Nagata, T.; Puig, A.S.; Von Keith, C.; Britto, D.S.; Gutierrez, O.A.; Marelli, J.P.; Brown, J.K. Complete genome sequences of three newly discovered cacao mild mosaic virus isolates from Theobroma cacao L. in Brazil and Puerto Rico, and evidence for recombination. Arch. Virol. 2021, 166, 2027–2031. [Google Scholar] [CrossRef]
  12. Kandito, A.; Hartono, S.; Trisyono, Y.A.; Somowiyarjo, S. First report of cacao mild mosaic virus associated with cacao mosaic disease in Indonesia. New Dis. Rep. 2022, 45, e12071. [Google Scholar] [CrossRef]
  13. Muller, E.; Ravel, S.; Agret, C.; Abrokwah, F.; Dzahini-Obiatey, H.; Galyuon, I.; Kouakou, K.; Jeyaseelan, E.C.; Allainguillaumen, J.; Wetten, A. Next-generation sequencing elucidates cacao badnavirus diversity and reveals the existence of more than ten viral species. Virus Res. 2018, 244, 235–251. [Google Scholar] [CrossRef]
  14. Marelli, J.P.; Guest, D.I.; Bailey, B.A.; Evans, H.C.; Brown, J.K.; Junaid, M.; Barreto, R.W.; Lisboa, D.O.; Puig, A.S. Chocolate under threat from old and new cacao diseases. Phytopathology 2019, 109, 1331–1343. [Google Scholar] [CrossRef] [PubMed]
  15. Olmedo-Velarde, A.; Park, A.C.; Sugano, J.; Uchida, J.Y.; Kawate, M.; Borth, W.B.; Hu, J.S.; Melzer, M.J. Characterization of Ti ringspot-associated virus, a novel emaravirus associated with an emerging ringspot disease of Cordyline fruticosa. Plant Dis. 2019, 103, 2345–2352. [Google Scholar] [CrossRef] [PubMed]
  16. Digiaro, M.; Elbeaino, T.; Kubota, K.; Ochoa-Corona, F.M.; von Bargen, S. ICTV Virus Taxonomy Profile: Fimoviridae. J. Gen. Virol. 2024, 105, e001943. [Google Scholar] [CrossRef] [PubMed]
  17. Gupta, A.K.; Hein, G.L.; Graybosch, R.A.; Tatineni, S. Octapartite negative-sense RNA genome of High Plains wheat mosaic virus encodes two suppressors of RNA silencing. Virology 2018, 518, 152–162. [Google Scholar] [CrossRef]
  18. Mielke, N.; Muehlbach, H.P. A novel, multipartite, negative-strand RNA virus is associated with the ringspot disease of European mountain ash (Sorbus aucuparia L.). J. Gen. Virol. 2007, 88, 1337–1346. [Google Scholar] [CrossRef]
  19. Laney, A.G.; Keller, K.E.; Martin, R.R.; Tzanetakis, I.E. A discovery 70 years in the making: Characterization of the rose rosette virus. J. Gen. Virol. 2011, 92, 1727–1732. [Google Scholar] [CrossRef]
  20. Wang, Y.Q.; Song, Y.; Cao, M.J.; Cheng, Q.; Wu, J.X.; Hu, T. Identification of a novel emaravirus infecting lilac through next-generation sequencing. J. Integr. Agric. 2020, 19, 2064–2071. [Google Scholar] [CrossRef]
  21. Peracchio, C.; Forgia, M.; Chiapello, M.; Vallino, M.; Turina, M.; Ciuffo, M. A complex virome including two distinct emaraviruses associated with virus-like symptoms in Camellia japonica. Virus Res. 2020, 286, 197964. [Google Scholar] [CrossRef]
  22. Kubota, K.; Yanagisawa, H.; Chiaki, Y.; Yamasaki, J.; Horikawa, H.; Tsunekawa, K.; Morita, Y.; Kadono, F. Complete nucleotide sequence of chrysanthemum mosaic-associated virus, a novel emaravirus infecting chrysanthemum. Arch. Virol. 2021, 166, 1241–1245. [Google Scholar] [CrossRef]
  23. McGavin, W.J.; Mitchell, C.; Cock, P.J.A.; Wright, K.M.; MacFarlane, S.A. Raspberry leaf blotch virus, a putative new member of the genus Emaravirus, encodes a novel genomic RNA. J. Gen. Virol. 2012, 93, 430–437. [Google Scholar] [CrossRef] [PubMed]
  24. Zheng, Y.; Navarro, B.; Wang, G.; Wang, Y.; Yang, Z.; Xu, W.; Zhu, C.; Wang, L.; Di Serio, F.; Hong, N. Actinidia chlorotic ringspot-associated virus: A novel emaravirus infecting kiwifruit plants. Mol. Plant Pathol. 2017, 18, 569–581. [Google Scholar] [CrossRef]
  25. Hassan, M.; Di Bello, P.L.; Keller, K.E.; Martin, R.R.; Sabanadzovic, S.; Tzanetakis, I.E. A new, widespread emaravirus discovered in blackberry. Virus Res. 2017, 235, 1–5. [Google Scholar] [CrossRef] [PubMed]
  26. Buzkan, N.; Chiumenti, M.; Massart, S.; Sarpkaya, K.; Karadağ, S.; Minafra, A. A new emaravirus discovered in Pistacia from Turkey. Virus Res. 2019, 263, 159–163. [Google Scholar] [CrossRef] [PubMed]
  27. Yang, C.; Zhang, S.; Han, T.; Fu, J.; Di Serio, F.; Cao, M. Identification and characterization of a novel emaravirus associated with jujube (Ziziphus jujuba Mill.) yellow mottle disease. Front. Microbiol. 2019, 10, 1417. [Google Scholar] [CrossRef]
  28. Liu, H.; Wang, G.; Yang, Z.; Wang, Y.; Zhang, Z.; Li, L.; Waqas, M.; Hong, N.; Zhang, J.; Xu, L.; et al. Identification and characterization of a pear chlorotic leaf spot-associated virus, a novel emaravirus causing severe disease in pear trees in China. Plant Dis. 2020, 104, 2786–2798. [Google Scholar] [CrossRef]
  29. Elbeaino, T.; Digiaro, M.; Martelli, G.P. Complete nucleotide sequence of four RNA segments of fig mosaic virus. Arch. Virol. 2009, 154, 1719–1727. [Google Scholar] [CrossRef]
  30. Tatineni, S.; Hein, G.L. High Plains wheat mosaic virus: An enigmatic disease of wheat and corn causing the High Plains disease. Mol. Plant Pathol. 2021, 22, 1167–1179. [Google Scholar] [CrossRef]
  31. Elbeaino, T.; Digiaro, M.; Uppala, M.; Sudini, H. Deep sequencing of pigeonpea sterility mosaic virus discloses five RNA segments related to emaraviruses. Virus Res. 2014, 188, 27–31. [Google Scholar] [CrossRef]
  32. Ilyas, M.; Avelar, S.; Schuch, U.K.; Brown, J.K. First report of an emaravirus associated with witches’ broom disease and eriophyid mite infestations of the blue palo verde tree in Arizona. Plant Dis. 2018, 102, 1863. [Google Scholar] [CrossRef] [PubMed]
  33. Von Bargen, S.; Al Kubrusli, R.; Gaskin, T.; Fürl, S.; Hüttner, F.; Blystad, D.R.; Karlin, D.G.; Jalkanen, R.; Büttner, C. Characterisation of a novel emaravirus identified in mosaic-diseased Eurasian aspen (Populus tremula). Ann. Appl. Biol. 2020, 176, 210–222. [Google Scholar] [CrossRef]
  34. Rumbou, A.; Candresse, T.; Von Bargen, S.; Büttner, C. Next-generation sequencing reveals a novel emaravirus in diseased maple trees from a German urban forest. Front. Microbiol. 2021, 11, 621179. [Google Scholar] [CrossRef]
  35. Rehanek, M.; Von Bargen, S.; Bandte, M.; Karlin, D.G.; Büttner, C. A novel emaravirus comprising five RNA segments is associated with ringspot disease in oak. Arch. Virol. 2021, 166, 987–990. [Google Scholar] [CrossRef] [PubMed]
  36. An, W.; Li, C.; Zhang, S.; Yu, M.C.; Cao, M.; Yang, C. A putative new emaravirus isolated from Ailanthus altissima (Mill.) Swingle with severe crinkle symptoms in China. Arch. Virol. 2022, 167, 2403–2405. [Google Scholar] [CrossRef]
  37. Gaskin, T.R.; Tischendorf, M.; Günther, I.; Rehanek, M.; Büttner, C.; von Bargen, S. Characterization of a novel emaravirus affecting ash species (Fraxinus spp.) in Europe. Forests 2021, 12, 1574. [Google Scholar] [CrossRef]
  38. Di Bello, P.L.; Laney, A.G.; Druciarek, T.; Ho, T.; Gergerich, R.C.; Keller, K.E.; Martin, R.R.; Tzanetakis, I.E. A novel emaravirus is associated with redbud yellow ringspot disease. Virus Res. 2016, 222, 41–47. [Google Scholar] [CrossRef] [PubMed]
  39. Kubota, K.; Usugi, T.; Tomitaka, Y.; Shimomoto, Y.; Takeuchi, S.; Kadono, F.; Yanagisawa, H.; Chiaki, Y.; Tsuda, S. Perilla mosaic virus is a highly divergent emaravirus transmitted by Shevtchenkella sp. (Acari: Eriophyidae). Phytopathology 2020, 110, 1352–1361. [Google Scholar] [CrossRef]
  40. Shimomoto, Y.; Okada, T.; Ikeda, K.; Tatara, A.; Hasegawa, Y.; Yanagisawa, H.; Takeyama, S.; Hayashi, K.; Yano, K.; Morita, Y.; et al. Japanese star anise ringspot-associated virus is a distinct emaravirus transmitted by the eriophyid mite (family Diptilomiopidae). J. Gen. Plant Pathol. 2022, 88, 69–80. [Google Scholar] [CrossRef]
  41. Yang, C.; An, W.; Li, C.; Zhang, S.; Cao, M. Detection and characterization of a putative emaravirus infecting Clematis brevicaudata DC. in China. Arch. Virol. 2024, 169, 10. [Google Scholar] [CrossRef]
  42. Sidharthan, V.K.; Chaturvedi, K.K.; Baranwal, V.K. Diverse RNA viruses in a parasitic flowering plant (spruce dwarf mistletoe) revealed through RNA-seq data mining. J. Gen. Plant Pathol. 2022, 88, 138–144. [Google Scholar] [CrossRef]
  43. Huaman-Pilco, A.F.; Tineo, D.; Guelac-Santillan, M.; Zamorano, A.; Bustamante, D.E. First report of babaco virus Q infecting babaco (Vasconcellea heilbornii) in Amazonas, Peru. New Dis. Rep. 2025, 52, e70046. [Google Scholar] [CrossRef]
  44. Hu, X.; Hurtado-Gonzales, O.P.; Adhikari, B.N.; French-Monar, R.D.; Malapi, M.; Foster, J.A.; McFarland, C.D. PhytoPipe: A phytosanitary pipeline for plant pathogen detection and diagnosis using RNA-seq data. BMC Bioinform. 2023, 24, 470. [Google Scholar] [CrossRef]
  45. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  46. Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef]
  47. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  48. Miller, M.A.; Schwartz, T.; Pickett, B.E.; He, S.; Klem, E.B.; Scheuermann, R.H.; Passarotti, M.; Kaufman, S.; O’Leary, M.A. A RESTful API for access to phylogenetic tools via the CIPRES science gateway. Evol. Bioinform. 2015, 11, 43–48. [Google Scholar] [CrossRef]
  49. Letunic, I.; Bork, P. Interactive Tree of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef]
  50. Jumper, J.; Evans, R.; Pritzel, A.; Green, T.; Figurnov, M.; Ronneberger, O.; Tunyasuvunakool, K.; Bates, R.; Žídek, A.; Potapenko, A.; et al. Highly accurate protein structure prediction with AlphaFold. Nature 2021, 596, 583–589. [Google Scholar] [CrossRef] [PubMed]
  51. Datta, S. Next-generation sequencing in clinical virology: Discovery of new viruses. World J. Virol. 2015, 4, 265–273. [Google Scholar] [CrossRef]
  52. Bustamante, D.E.; Motilal, L.A.; Calderon, M.S.; Mahabir, A.; Oliva, M. Genetic diversity and population structure of fine aroma cacao (Theobroma cacao L.) from north Peru revealed by single nucleotide polymorphism (SNP) markers. Front. Ecol. Evol. 2022, 10, 895056. [Google Scholar] [CrossRef]
  53. Fan, X.; Li, C.; Zhang, Z.; Ren, F.; Hu, G.; Shen, H.; Zhang, B.; Dong, Y. Identification and characterization of a novel emaravirus from grapevine showing chlorotic mottling symptoms. Front. Microbiol. 2021, 12, 694601. [Google Scholar] [CrossRef] [PubMed]
  54. Zhang, S.; Yang, L.; Ma, L.; Tian, X.; Li, R.; Zhou, C.; Cao, M. Virome of Camellia japonica: Discovery and molecular characterization of new viruses of different taxa in camellias. Front. Microbiol. 2020, 11, 945. [Google Scholar] [CrossRef] [PubMed]
  55. Mielke-Ehret, N.; Mühlbach, H.P. Emaravirus: A novel genus of multipartite, negative strand RNA plant viruses. Viruses 2012, 4, 1515–1536. [Google Scholar] [CrossRef] [PubMed]
  56. De Carvalho, A.N.; Navia, D.; De Lillo, E.; Ferragut, F.; Oliveira, A.R. The cacao bud mite, Aceria reyesi (Nuzzaci 1973)—Supplementary description, distribution and comparison with Gymnaceria cupuassu Oliveira, Rodrigues & Flechtmann 2012 (Acari: Eriophyidae). Syst. Appl. Acarol. 2018, 23, 501–520. [Google Scholar] [CrossRef]
Ijpb 16 00142 g001
Figure 1. Native accession from T. cacao. (A) CAC 10: Asymptomatic leaf; (B) CAC 5: Leaf displaying symptoms of mosaic, (C) CAC1: Leaf showing yellow mottling.
Figure 1. Native accession from T. cacao. (A) CAC 10: Asymptomatic leaf; (B) CAC 5: Leaf displaying symptoms of mosaic, (C) CAC1: Leaf showing yellow mottling.
Ijpb 16 00142 g001
Ijpb 16 00142 g002
Figure 2. Genomic organization of Theobroma cacao emaravirus A (ThCEV-A). Each RNA segment (RNA1–RNA4) contains a single open reading frame encoding, respectively, the RNA-dependent RNA polymerase RdRp (2327 aa, 7142 nt), the glycoprotein GP (685 aa, 2234 nt), the nucleocapsid protein NP (306 aa, 1270 nt), and the movement protein MP (379 aa, 1286 nt). Arrows indicate the negative-sense orientation (3′→5′) of each genomic RNA.
Figure 2. Genomic organization of Theobroma cacao emaravirus A (ThCEV-A). Each RNA segment (RNA1–RNA4) contains a single open reading frame encoding, respectively, the RNA-dependent RNA polymerase RdRp (2327 aa, 7142 nt), the glycoprotein GP (685 aa, 2234 nt), the nucleocapsid protein NP (306 aa, 1270 nt), and the movement protein MP (379 aa, 1286 nt). Arrows indicate the negative-sense orientation (3′→5′) of each genomic RNA.
Ijpb 16 00142 g002
Ijpb 16 00142 g003aIjpb 16 00142 g003b
Figure 3. Midpoint phylogenetic tree based on maximum likelihood analysis of amino acid sequences, (A) RdRP (P1), (B) GPP (P2), (C) NP (P3), and (D) MP (P4) of Emaravirus genus members. The new ThCEVA is highlighted in red; the other species are indicated by their accession numbers. Rose rosette virus (RRV), aspen mosaic-associated virus (AsMaV), Actinia emaravirus 2 (AcEV-2), Pistacia emaravirus (PiVB), fig mosaic emaravirus (FMV), pigeon pea sterility mosaic emaravirus 1 (PPSMV-1), pigeon pea sterility mosaic emaravirus 2 (PPSMV-2), blackberry leaf mottle-associated virus (BLMaV), European mountain ash ringspot-associated emaravirus (EMARaV), Actinidia chlorotic ringspot-associated virus (AcCRaV), lilac chlorotic ringspot-associated virus (LiCRaV), redbud yellow ringspot-associated emaravirus (RYRV), ti ringspot-associated emaravirus (TiRSaV), Raspberry leaf blotch emaravirus (RLBV), palo verde broom virus (PVBV), jujube yellow mottle-associated virus (JuMaV), High Plains wheat mosaic emaravirus (HPWMoV), Camellia japonica-associated emaravirus 1 (CjaEV-1), Camellia japonica-associated emaravirus 2 (CjaEV-2), Perilla mosaic virus (PerMV), common oak ringspot-associated emaravirus (CORaV), pea-associated emaravirus (PaEV), grapevine emaravirus A (GEVA), Maple mottle-associated virus (MaMaV) and chrysanthemum mosaic-associated virus (ChMaV). Predicted 3D structures of ThCEV-A proteins (P1–P4) generated with AlphaFold Server are shown beside each tree. Colors indicate pLDDT confidence (blue = high, yellow/red = low), and α-helices/β-sheets correspond to functional domains of RdRp, GP, NP, and MP.
Figure 3. Midpoint phylogenetic tree based on maximum likelihood analysis of amino acid sequences, (A) RdRP (P1), (B) GPP (P2), (C) NP (P3), and (D) MP (P4) of Emaravirus genus members. The new ThCEVA is highlighted in red; the other species are indicated by their accession numbers. Rose rosette virus (RRV), aspen mosaic-associated virus (AsMaV), Actinia emaravirus 2 (AcEV-2), Pistacia emaravirus (PiVB), fig mosaic emaravirus (FMV), pigeon pea sterility mosaic emaravirus 1 (PPSMV-1), pigeon pea sterility mosaic emaravirus 2 (PPSMV-2), blackberry leaf mottle-associated virus (BLMaV), European mountain ash ringspot-associated emaravirus (EMARaV), Actinidia chlorotic ringspot-associated virus (AcCRaV), lilac chlorotic ringspot-associated virus (LiCRaV), redbud yellow ringspot-associated emaravirus (RYRV), ti ringspot-associated emaravirus (TiRSaV), Raspberry leaf blotch emaravirus (RLBV), palo verde broom virus (PVBV), jujube yellow mottle-associated virus (JuMaV), High Plains wheat mosaic emaravirus (HPWMoV), Camellia japonica-associated emaravirus 1 (CjaEV-1), Camellia japonica-associated emaravirus 2 (CjaEV-2), Perilla mosaic virus (PerMV), common oak ringspot-associated emaravirus (CORaV), pea-associated emaravirus (PaEV), grapevine emaravirus A (GEVA), Maple mottle-associated virus (MaMaV) and chrysanthemum mosaic-associated virus (ChMaV). Predicted 3D structures of ThCEV-A proteins (P1–P4) generated with AlphaFold Server are shown beside each tree. Colors indicate pLDDT confidence (blue = high, yellow/red = low), and α-helices/β-sheets correspond to functional domains of RdRp, GP, NP, and MP.
Ijpb 16 00142 g003aIjpb 16 00142 g003b
Ijpb 16 00142 g004
Figure 4. Electrophoresis gel showing PCR product of positive samples for all RNA genomic segments of Theobroma cacao emaravirus A, three samples (M1 = INDES-24, M2 = INIA-20, and M3 = INIA-13), and a control (B) were tested. Expected amplicon sizes: RNA1 = 456 bp, RNA2 = 390 bp, RNA3 = 310 bp and RNA4 = 390 bp.
Figure 4. Electrophoresis gel showing PCR product of positive samples for all RNA genomic segments of Theobroma cacao emaravirus A, three samples (M1 = INDES-24, M2 = INIA-20, and M3 = INIA-13), and a control (B) were tested. Expected amplicon sizes: RNA1 = 456 bp, RNA2 = 390 bp, RNA3 = 310 bp and RNA4 = 390 bp.
Ijpb 16 00142 g004
Table 1. Specific primers were designed in this study from the four genomic RNA molecules of the new Emaravirus species.
Table 1. Specific primers were designed in this study from the four genomic RNA molecules of the new Emaravirus species.
Genomic SegmentPrimerSequence 5′ to 3′Target GeneProduct Size (bp)
RNA1ThC-EmRep-F
ThC-EmRep-R		TCCAAACTGCTGATCCTGGA
CAAGGGATCTGGGTCGTGAG		RNA polymerase456
RNA2ThC-EmGly-F
ThC-EmGly-R		ACATGGAGTTGCGAAGGTATT
TGGTCCCCAACATCCATAAGC		Glycoprotein390
RNA3ThC-EmNuc-F
ThC-EmNuc-R		GGCTGAACAAATGGGATGCC
AACACTCCTTCCACCAGCTG		Nucleocapsid310
RNA4ThC-EmMP-F
ThC-EmMP-R		TGTTGGTGGTATGGACTTCGA
CCCACCATCCTGTAGCTGTT		Movement protein390
Table 2. Coverage of ThCEV-A RNA sequences in the Illumina dataset from sample CAC5.
Table 2. Coverage of ThCEV-A RNA sequences in the Illumina dataset from sample CAC5.
RNA Genomic SegmentConsensus Length (nt)Total Read CountAverage
Coverage		BlastX% IdentityAccession GenBank
RNA1714227,993534.27AcCRaV46.35QJD14761
RNA2222516,074979.44PPSMV233.23YP_009268865
RNA3126955,0765755.23PaEV34.54QJX15716
RNA412861578201.82ASaV30.14CAA0079685
Note: Coverage values correspond exclusively to reads from sample CAC5, which generated the highest number of viral reads among the sequenced accessions. Although CAC1 also contained contigs for RNA1–RNA4, its read depth was insufficient for reliable coverage estimation. No emaravirus-related contigs were recovered from CAC10.
Table 3. Origin of the native accessions of T. cacao that were positive for ThCV-A.
Table 3. Origin of the native accessions of T. cacao that were positive for ThCV-A.
Accession/CloneDistrictLocalitySymptoms
INDES-24CajaruroLa Concordiayellow-mosaic
INDES-53CajaruroDiamante bajoasymptomatic
INDES-65CajaruroNaranjos altoyellow-mosaic
INDES-67CajaruroNaranjos altoyellow-mottling
INIA-13La PecaSan Franciscoasymptomatic
INIA-20BaguaEl Tomaqueyellow-mottling, deformation
INIA-23BaguaEl Tomaqueyellow-mottling
INIA-35CopallinLluahuanaasymptomatic
INIA-107ImazaShushungayellow-mottling
TSH-565 (R1) asymptomatic
TSH-565 (R2) yellow-mosaic
INIA accessions: (INIA germplasm bank); INDES accessions: (INDES collection bank); TSH-565: (hybrid precedent to Ecuador).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Huaman-Pilco, A.F.; Fiore, N.; Hurtado-Gonzales, O.P.; Carvalho Costa, L.; Hu, X.; Oliva-Cruz, M.; Díaz-Valderrama, J.R.; Zamorano, A. Genomic and Phylogenetic Evidence for a Novel Emaravirus Infecting Cacao (Theobroma cacao L.) in Amazonas, Peru. Int. J. Plant Biol. 2025, 16, 142. https://doi.org/10.3390/ijpb16040142

AMA Style

Huaman-Pilco AF, Fiore N, Hurtado-Gonzales OP, Carvalho Costa L, Hu X, Oliva-Cruz M, Díaz-Valderrama JR, Zamorano A. Genomic and Phylogenetic Evidence for a Novel Emaravirus Infecting Cacao (Theobroma cacao L.) in Amazonas, Peru. International Journal of Plant Biology. 2025; 16(4):142. https://doi.org/10.3390/ijpb16040142

Chicago/Turabian Style

Huaman-Pilco, Angel F., Nicola Fiore, Oscar P. Hurtado-Gonzales, Larissa Carvalho Costa, Xiaojun Hu, Manuel Oliva-Cruz, Jorge R. Díaz-Valderrama, and Alan Zamorano. 2025. "Genomic and Phylogenetic Evidence for a Novel Emaravirus Infecting Cacao (Theobroma cacao L.) in Amazonas, Peru" International Journal of Plant Biology 16, no. 4: 142. https://doi.org/10.3390/ijpb16040142

APA Style

Huaman-Pilco, A. F., Fiore, N., Hurtado-Gonzales, O. P., Carvalho Costa, L., Hu, X., Oliva-Cruz, M., Díaz-Valderrama, J. R., & Zamorano, A. (2025). Genomic and Phylogenetic Evidence for a Novel Emaravirus Infecting Cacao (Theobroma cacao L.) in Amazonas, Peru. International Journal of Plant Biology, 16(4), 142. https://doi.org/10.3390/ijpb16040142

Article Metrics

Back to TopTop