Multiple Infections, Recombination, and Hypermutation During a 12-Month Prospective Study of Five HIV-1 Infected Individuals
Abstract
1. Introduction
2. Materials and Methods
2.1. Patient Selection and Sampling
2.2. DNA Extraction, Quantification, and Amplification
- POL1 (HXB2 pos. 1839–1863): 5′–GGGAGTGGGGGGACCCGGCCATAA–3′
- INBO1R (HXB2 pos. 3791–3772): 5′–CATTTGGCCTTTGCCCCTGCTTCTGTT–3′
- K1 (HXB2 pos. 2147–2166): 5′–CAGAGCCAACAGCCCCACCA–3′
- K2 (HXB2 pos. 3309–3338): 5′–TTTCCCCACTAACTTCTGTATGTCCTTGACA–3′
2.3. Cloning and Plasmid Preparation
2.4. Sanger Sequencing
- RTInt (HXB2 pos. 3018–3042): 5′–CCAGCAATATTCCAAAGTAGCAGTA–3′
- DP10 (HXB2 pos. 2201–2223): 5′–CAACTCCCTCTCAGAAGCAGGAGCCG–3′
- F2 (HXB2 pos. 3301–3321): 5′–GTATGTCATTGACAGTCCAGC–3′
- K1 (HXB2 pos. 2147–2166): 5′–CAGAGCCAACAGCCCCACCA–3′
- K2 (HXB2 pos. 3309–3338): 5′–TTTCCCCACTAACTTCTGTATGTCCTTGACA–3′
2.5. Sequence Alignments
2.6. Phylogenetic Inference and Diversity Analysis
2.7. Recombination Detection
2.8. Detection of Hypermutation
3. Results
3.1. Demographic and Clinical Characteristics of the Study Cohort
3.2. Sequence Alignment, Phylogenetics, and Diversity Analysis
3.3. jpHMM Results
3.4. SimPlot++ Results
3.5. RDP5 Results
3.6. Hypermutation Analysis
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- McCutchan, F.E. Global epidemiology of HIV. J. Med. Virol. 2006, 78, S7–S12. [Google Scholar] [CrossRef] [Scilit]
- Suryavanshi, G.W.; Dixit, N.M. Emergence of recombinant forms of HIV: Dynamics and scaling. PLoS Comput. Biol. 2007, 3, e205. [Google Scholar]
- Ramirez, B.C.; Simon-Loriere, E.; Galetto, R.; Negroni, M. Implications of recombination for HIV diversity. Virus Res. 2008, 134, 64–73. [Google Scholar] [CrossRef] [Scilit]
- Vijay, N.; Vasantika; Ajmani, R.; Perelson, A.S.; Dixit, N.M. Recombination increases human immunodeficiency virus fitness, but not necessarily diversity. J. Gen. Virol. 2008, 89, 1467–1477. [Google Scholar] [CrossRef] [Scilit]
- Elena, S.F.; Sanjuán, R. Adaptive value of high mutation rates of RNA viruses: Separating causes from consequences. J. Virol. 2005, 79, 11555–11558. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elena, S.F.; Miralles, R.; Cuevas, J.M.; Turner, P.E.; Moya, A. The two faces of mutation: Extinction and adaptation in RNA viruses. Iubmb Life 2000, 49, 5–9. [Google Scholar]
- Dapp, M.J.; Heineman, R.H.; Mansky, L.M. Interrelationship between HIV-1 fitness and mutation rate. J. Mol. Biol. 2013, 425, 41–53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dimitrov, D.; Willey, R.; Sato, H.; Chang, L.J.; Blumenthal, R.; Martin, M. Quantitation of human immunodeficiency virus type 1 infection kinetics. J. Virol. 1993, 67, 2182–2190. [Google Scholar] [CrossRef] [Scilit]
- Perelson, A.S.; Neumann, A.U.; Markowitz, M.; Leonard, J.M.; Ho, D.D. HIV-1 dynamics in vivo: Virion clearance rate, infected cell life-span, and viral generation time. Science 1996, 271, 1582–1586. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Domingo, E.; Baranowski, E.; Ruiz-Jarabo, C.M.; Martín-Hernández, A.M.; Sáiz, J.C.; Escarmís, C. Quasispecies structure and persistence of RNA viruses. Emerg. Infect. Dis. 1998, 4, 521. [Google Scholar] [CrossRef] [Scilit]
- Moya, A.; Holmes, E.C.; González-Candelas, F. The population genetics and evolutionary epidemiology of RNA viruses. Nat. Rev. Microbiol. 2004, 2, 279–288. [Google Scholar] [CrossRef] [Scilit]
- Lee, H.Y.; Perelson, A.S.; Park, S.C.; Leitner, T. Dynamic correlation between intrahost HIV-1 quasispecies evolution and disease progression. PLoS Comput. Biol. 2008, 4, e1000240. [Google Scholar] [CrossRef] [Scilit]
- Galetto, R.; Negroni, M. Mechanistic features of recombination in HIV. Aids Rev. 2005, 7, 92–102. [Google Scholar] [PubMed]
- Zhuang, J.; Jetzt, A.E.; Sun, G.; Yu, H.; Klarmann, G.; Ron, Y.; Preston, B.D.; Dougherty, J.P. Human immunodeficiency virus type 1 recombination: Rate, fidelity, and putative hot spots. J. Virol. 2002, 76, 11273–11282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bocharov, G.; Ford, N.J.; Edwards, J.; Breinig, T.; Wain-Hobson, S.; Meyerhans, A. A genetic-algorithm approach to simulating human immunodeficiency virus evolution reveals the strong impact of multiply infected cells and recombination. J. Gen. Virol. 2005, 86, 3109–3118. [Google Scholar] [CrossRef] [Scilit]
- Jetzt, A.E.; Yu, H.; Klarmann, G.J.; Ron, Y.; Preston, B.D.; Dougherty, J.P. High rate of recombination throughout the human immunodeficiency virus type 1 genome. J. Virol. 2000, 74, 1234–1240. [Google Scholar] [CrossRef] [Scilit]
- Neher, R.A.; Leitner, T. Recombination rate and selection strength in HIV intra-patient evolution. PLoS Comput. Biol. 2010, 6, e1000660. [Google Scholar]
- An, W.; Telesnitsky, A. HIV-1 genetic recombination: Experimental approaches and observations. AIDS Rev. 2002, 4, 195–212. [Google Scholar]
- Rhodes, T.D.; Nikolaitchik, O.; Chen, J.; Powell, D.; Hu, W.S. Genetic recombination of human immunodeficiency virus type 1 in one round of viral replication: Effects of genetic distance, target cells, accessory genes, and lack of high negative interference in crossover events. J. Virol. 2005, 79, 1666–1677. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burke, D.S. Recombination in HIV: An important viral evolutionary strategy. Emerg. Infect. Dis. 1997, 3, 253. [Google Scholar] [CrossRef] [Scilit]
- Promadej-Lanier, N.; Thielen, C.; Hu, D.J.; Chaowanachan, T.; Gvetadze, R.; Choopanya, K.; Vanichseni, S.; Mcnicholl, J.M. Cross-reactive T cell responses in HIV CRF01_AE and B’-infected intravenous drug users: Implications for superinfection and vaccines. AIDS Res. Hum. Retroviruses 2009, 25, 73–81. [Google Scholar] [CrossRef] [Scilit]
- Schlub, T.E.; Smyth, R.P.; Grimm, A.J.; Mak, J.; Davenport, M.P. Accurately measuring recombination between closely related HIV-1 genomes. PLoS Comput. Biol. 2010, 6, e1000766. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, M.; Foley, B.; Schultz, A.K.; Macke, J.P.; Bulla, I.; Stanke, M.; Morgenstern, B.; Korber, B.; Leitner, T. The role of recombination in the emergence of a complex and dynamic HIV epidemic. Retrovirology 2010, 7, 25. [Google Scholar] [CrossRef] [Scilit]
- Templeton, A.R.; Kramer, M.G.; Jarvis, J.; Kowalski, J.; Gange, S.; Schneider, M.F.; Shao, Q.; Zhang, G.W.; Yeh, M.F.; Tsai, H.L.; et al. Multiple-infection and recombination in HIV-1 within a longitudinal cohort of women. Retrovirology 2009, 6, 54. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Charpentier, C.; Nora, T.; Tenaillon, O.; Clavel, F.; Hance, A.J. Extensive recombination among human immunodeficiency virus type 1 quasispecies makes an important contribution to viral diversity in individual patients. J. Virol. 2006, 80, 2472–2482. [Google Scholar] [CrossRef] [Scilit]
- Los Alamos National Laboratory. HIV Sequence Database. HIV Circulating Recombinant Forms (CRFs). 2023. Available online: https://www.hiv.lanl.gov/components/sequence/HIV/crfdb/crfs.comp (accessed on 28 October 2024).
- Carr, J.K.; Wolfe, N.D.; Torimiro, J.N.; Tamoufe, U.; Mpoudi-Ngole, E.; Eyzaguirre, L.; Birx, D.L.; McCutchan, F.E.; Burke, D.S. HIV-1 recombinants with multiple parental strains in low-prevalence, remote regions of Cameroon: Evolutionary relics? Retrovirology 2010, 7, 39. [Google Scholar] [CrossRef] [Scilit]
- McCutchan, F.E.; Sankale, J.L.; M’Boup, S.; Kim, B.; Tovanabutra, S.; Hamel, D.J.; Brodine, S.K.; Kanki, P.J.; Birx, D.L. HIV type 1 circulating recombinant form CRF09_cpx from west Africa combines subtypes A, F, G, and may share ancestors with CRF02_AG and Z321. AIDS Res. Hum. Retroviruses 2004, 20, 819–826. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Konings, F.A.; Haman, G.R.; Xue, Y.; Urbanski, M.M.; Hertzmark, K.; Nanfack, A.; Achkar, J.M.; Burda, S.T.; Nyambi, P.N. Genetic analysis of HIV-1 strains in rural eastern Cameroon indicates the evolution of second-generation recombinants to circulating recombinant forms. JAIDS J. Acquir. Immune Defic. Syndr. 2006, 42, 331–341. [Google Scholar] [CrossRef] [Scilit]
- Fernández, M.F.; Golemba, M.D.; Terrones, C.; Paradiso, P.; Nassif, J.C.; Bologna, R.; Mangano, A.; Sen, L.; Aulicino, P.C. Emergence of novel A/G recombinant HIV-1 strains in Argentina. AIDS Res. Hum. Retroviruses 2015, 31, 293–297. [Google Scholar] [CrossRef] [Scilit]
- Niculescu, I.; Paraschiv, S.; Paraskevis, D.; Abagiu, A.; Batan, I.; Banica, L.; Otelea, D. Recent HIV-1 outbreak among intravenous drug users in Romania: Evidence for cocirculation of CRF14_BG and subtype F1 strains. AIDS Res. Hum. Retroviruses 2015, 31, 488–495. [Google Scholar] [CrossRef] [Scilit]
- Aulicino, P.C.; Bello, G.; Guimaraes, M.L.; Ruchansky, D.; Rocco, C.; Mangano, A.; Morgado, M.G.; Sen, L. Longitudinal analysis of HIV-1 BF1 recombinant strains in vertically infected children from Argentina reveals a decrease in CRF12_BF pol gene mosaic patterns and high diversity of BF unique recombinant forms. Infect. Genet. Evol. 2011, 11, 349–357. [Google Scholar] [CrossRef] [Scilit]
- de Oliveira, C.M.; Almeida, F.J.; Rodrigues, R.; Crozatti, M.; Vazquez, C.M.P.; do Socorro Carneiro Ferrão, M.; Campeas, A.E.; Marques, S.R.; Berezin, E.N.; de Macedo Brígido, L.F. High frequency of BF mosaic genomes among HIV-1-infected children from Sao Paulo, Brazil. Arch. Virol. 2008, 153, 1799–1806. [Google Scholar] [CrossRef] [Scilit]
- Williams, A.; Menon, S.; Crowe, M.; Agarwal, N.; Biccler, J.; Bbosa, N.; Ssemwanga, D.; Adungo, F.; Moecklinghoff, C.; Macartney, M.; et al. Geographic and Population Distributions of Human Immunodeficiency Virus (HIV)–1 and HIV-2 Circulating Subtypes: A Systematic Literature Review and Meta-analysis (2010–2021). J. Infect. Dis. 2023, 228, 1583–1591. [Google Scholar] [CrossRef] [Scilit]
- Gräf, T.; Bello, G.; Andrade, P.; Arantes, I.; Pereira, J.M.; da Silva, A.B.P.; Veiga, R.V.; Mariani, D.; Boullosa, L.T.; Arruda, M.B.; et al. HIV-1 molecular diversity in Brazil unveiled by 10 years of sampling by the national genotyping network. Sci. Rep. 2021, 11, 15842. [Google Scholar] [CrossRef] [Scilit]
- Brigido, L.F.; Nunes, C.C.; Oliveira, C.M.; Knoll, R.K.; Ferreira, J.L.P.; Freitas, C.A.; Alves, M.A.; Dias, C.; Rodrigues, R.; Program, R.C. HIV type 1 subtype C and CB Pol recombinants prevail at the cities with the highest AIDS prevalence rate in Brazil. AIDS Res. Hum. Retroviruses 2007, 23, 1579–1586. [Google Scholar] [CrossRef] [Scilit]
- Kuwata, T.; Miyazaki, Y.; Igarashi, T.; Takehisa, J.; Hayami, M. The rapid spread of recombinants during a natural in vitro infection with two human immunodeficiency virus type 1 strains. J. Virol. 1997, 71, 7088–7091. [Google Scholar] [CrossRef] [Scilit]
- Muñoz-Nieto, M.; Perez-Alvarez, L.; Thomson, M.; García, V.; Ocampo, A.; Casado, G.; Delgado, E.; Miralles, C.; de Parga, E.V.; Sierra, M.; et al. HIV type 1 intersubtype recombinants during the evolution of a dual infection with subtypes B and G. AIDS Res. Hum. Retroviruses 2008, 24, 337–343. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Streeck, H.; Li, B.; Poon, A.F.; Schneidewind, A.; Gladden, A.D.; Power, K.A.; Daskalakis, D.; Bazner, S.; Zuniga, R.; Brander, C.; et al. Immune-driven recombination and loss of control after HIV superinfection. J. Exp. Med. 2008, 205, 1789–1796. [Google Scholar] [CrossRef] [Scilit]
- Fung, I.C.H.; Gambhir, M.; van Sighem, A.; de Wolf, F.; Garnett, G.P. Superinfection with a heterologous HIV strain per se does not lead to faster progression. Math. Biosci. 2010, 224, 1–9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alves, B.M.; Siqueira, J.D.; Prellwitz, I.M.; Botelho, O.M.; Da Hora, V.P.; Sanabani, S.; Recordon-Pinson, P.; Fleury, H.; Soares, E.A.; Soares, M.A. Estimating HIV-1 genetic diversity in Brazil through next-generation sequencing. Front. Microbiol. 2019, 10, 749. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van der Kuyl, A.C.; Cornelissen, M. Identifying HIV-1 dual infections. Retrovirology 2007, 4, 67. [Google Scholar] [CrossRef] [Scilit]
- Powell, R.L.; Lezeau, L.; Kinge, T.; Nyambi, P.N. Longitudinal quasispecies analysis of viral variants in HIV type 1 dually infected individuals highlights the importance of sequence identity in viral recombination. AIDS Res. Hum. Retroviruses 2010, 26, 253–264. [Google Scholar] [CrossRef] [Scilit]
- Janini, M.; Rogers, M.; Birx, D.R.; McCutchan, F.E. Human immunodeficiency virus type 1 DNA sequences genetically damaged by hypermutation are often abundant in patient peripheral blood mononuclear cells and may be generated during near-simultaneous infection and activation of CD4+ T cells. J. Virol. 2001, 75, 7973–7986. [Google Scholar] [CrossRef] [Scilit]
- Köck, J.; Blum, H.E. Hypermutation of hepatitis B virus genomes by APOBEC3G, APOBEC3C and APOBEC3H. J. Gen. Virol. 2008, 89, 1184–1191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mangeat, B.; Turelli, P.; Caron, G.; Friedli, M.; Perrin, L.; Trono, D. Broad antiretroviral defence by human APOBEC3G through lethal editing of nascent reverse transcripts. Nature 2003, 424, 99–103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stopak, K.; de Noronha, C.; Yonemoto, W.; Greene, W.C. HIV-1 Vif blocks the antiviral activity of APOBEC3G by impairing both its translation and intracellular stability. Mol. Cell 2003, 12, 591–601. [Google Scholar] [CrossRef] [Scilit]
- Nunes, E.R.D.M.; Zukurov, J.P.; Maricato, J.T.; Sucupira, M.C.A.; Diaz, R.S.; Janini, L.M.R. Analysis of HIV-1 protease gene reveals frequent multiple infections followed by recombination among drug treated individuals living in São Paulo and Santos, Brazil. PLoS ONE 2014, 9, e84066. [Google Scholar] [CrossRef] [Scilit]
- Sanabani, S.S.; Pastena, É.R.d.S.; da Costa, A.C.; Martinez, V.P.; Kleine-Neto, W.; de Oliveira, A.C.S.; Sauer, M.M.; Bassichetto, K.C.; Oliveira, S.M.S.; Tomiyama, H.T.I.; et al. Characterization of partial and near full-length genomes of HIV-1 strains sampled from recently infected individuals in Sao Paulo, Brazil. PLoS ONE 2011, 6, e25869. [Google Scholar] [CrossRef] [Scilit]
- de Sa-Filho, D.J.; Soares, M.d.S.; Candido, V.; Gagliani, L.H.; Cavaliere, E.; Diaz, R.S.; Caseiro, M.M. HIV type 1 pol gene diversity and antiretroviral drug resistance mutations in Santos, Brazil. AIDS Res. Hum. Retroviruses 2008, 24, 347–353. [Google Scholar] [CrossRef] [Scilit]
- Samson, S.; Lord, É.; Makarenkov, V. SimPlot++: A Python application for representing sequence similarity and detecting recombination. Bioinformatics 2022, 38, 3118–3120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kallas, E.G.; Bassichetto, K.C.; Oliveira, S.M.; Goldenberg, I.; Bortoloto, R.; Moreno, D.M.F.C.; Kanashiro, C.; Chaves, M.M.S.; Sucupira, M.C.A.; Diniz, A.; et al. Establishment of the serologic testing algorithm for recent human immunodeficiency virus (HIV) seroconversion (STARHS) strategy in the city of Sao Paulo, Brazil. Braz. J. Infect. Dis. 2004, 8, 399–406. [Google Scholar] [CrossRef] [Scilit]
- BLAST: Basic Local Alignment Search Tool. 2024. Available online: https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 15 November 2024).
- Martin, D.P.; Varsani, A.; Roumagnac, P.; Botha, G.; Maslamoney, S.; Schwab, T.; Kelz, Z.; Kumar, V.; Murrell, B. RDP5: A computer program for analyzing recombination in, and removing signals of recombination from, nucleotide sequence datasets. Virus Evol. 2021, 7, veaa087. [Google Scholar] [CrossRef] [Scilit]
- Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Scilit]
- Keele, B.F.; Giorgi, E.E.; Salazar-Gonzalez, J.F.; Decker, J.M.; Pham, K.T.; Salazar, M.G.; Sun, C.; Grayson, T.; Wang, S.; Li, H.; et al. Identification and characterization of transmitted and early founder virus envelopes in primary HIV-1 infection. Proc. Natl. Acad. Sci. USA 2008, 105, 7552–7557. [Google Scholar] [CrossRef] [Scilit]
- Goloboff, P.A.; Farris, J.S.; Nixon, K.C. TNT, a free program for phylogenetic analysis. Cladistics 2008, 24, 774–786. [Google Scholar] [CrossRef] [Scilit]
- Goloboff, P.A.; Morales, M.E. TNT version 1.6, with a graphical interface for MacOS and Linux, including new routines in parallel. Cladistics 2023, 39, 144–153. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jacob Machado, D.; de Bernadi Schneider, A.; Guirales, S.; Janies, D.A. FLAVi: An enhanced annotator for viral genomes of Flaviviridae. Viruses 2020, 12, 892. [Google Scholar] [CrossRef] [Scilit]
- Machado, D.J. YBYRÁ facilitates comparison of large phylogenetic trees. BMC Bioinform. 2015, 16, 204. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schultz, A.K.; Zhang, M.; Leitner, T.; Kuiken, C.; Korber, B.; Morgenstern, B.; Stanke, M. A jumping profile Hidden Markov Model and applications to recombination sites in HIV and HCV genomes. BMC Bioinform. 2006, 7, 265. [Google Scholar] [CrossRef] [Scilit]
- Martin, D.; Rybicki, E. RDP: Detection of recombination amongst aligned sequences. Bioinformatics 2000, 16, 562–563. [Google Scholar] [CrossRef] [Scilit]
- Padidam, M.; Sawyer, S.; Fauquet, C.M. Possible emergence of new geminiviruses by frequent recombination. Virology 1999, 265, 218–225. [Google Scholar] [CrossRef] [Scilit]
- Salminen, M.O.; Carr, J.K.; Burke, D.S.; McCUTCHAN, F.E. Identification of breakpoints in intergenotypic recombinants of HIV type 1 by bootscanning. AIDS Res. Hum. Retroviruses 1995, 11, 1423–1425. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Smith, J.M. Analyzing the mosaic structure of genes. J. Mol. Evol. 1992, 34, 126–129. [Google Scholar] [CrossRef] [Scilit]
- Posada, D.; Crandall, K.A. Evaluation of methods for detecting recombination from DNA sequences: Computer simulations. Proc. Natl. Acad. Sci. USA 2001, 98, 13757–13762. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gibbs, M.J.; Armstrong, J.S.; Gibbs, A.J. Sister-scanning: A Monte Carlo procedure for assessing signals in recombinant sequences. Bioinformatics 2000, 16, 573–582. [Google Scholar] [CrossRef] [Scilit]
- Boni, M.F.; Posada, D.; Feldman, M.W. An exact nonparametric method for inferring mosaic structure in sequence triplets. Genetics 2007, 176, 1035–1047. [Google Scholar] [CrossRef] [Scilit]
- Rose, P.P.; Korber, B.T. Detecting hypermutations in viral sequences with an emphasis on G→A hypermutation. Bioinformatics 2000, 16, 400–401. [Google Scholar] [CrossRef] [Scilit]
- Schultz, A.K.; Zhang, M.; Bulla, I.; Leitner, T.; Korber, B.; Morgenstern, B.; Stanke, M. jpHMM: Improving the reliability of recombination prediction in HIV-1. Nucleic Acids Res. 2009, 37, W647–W651. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, M.; Schultz, A.K.; Calef, C.; Kuiken, C.; Leitner, T.; Korber, B.; Morgenstern, B.; Stanke, M. jpHMM at GOBICS: A web server to detect genomic recombinations in HIV-1. Nucleic Acids Res. 2006, 34, W463–W465. [Google Scholar] [CrossRef] [Scilit]
- Kieffer, T.L.; Kwon, P.; Nettles, R.E.; Han, Y.; Ray, S.C.; Siliciano, R.F. G→A hypermutation in protease and reverse transcriptase regions of human immunodeficiency virus type 1 residing in resting CD4+ T cells in vivo. J. Virol. 2005, 79, 1975–1980. [Google Scholar] [CrossRef] [Scilit]
- de Lima-Stein, M.L.; Alkmim, W.T.; Bizinoto, M.C.d.S.; Lopez, L.F.; Burattini, M.N.; Maricato, J.T.; Giron, L.; Sucupira, M.C.A.; Diaz, R.S.; Janini, L.M. In vivo HIV-1 hypermutation and viral loads among antiretroviral-naive Brazilian patients. AIDS Res. Hum. Retroviruses 2014, 30, 867–880. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Patient ID | Sex | Age | CD4+ Count | Viral Load |
|---|---|---|---|---|
| BR1052 | M | 28 | 512 | 15,000 (4.18) |
| BR1114 | M | 32 | 485 | 28,000 (4.45) |
| BR1117 | M | 35 | 610 | 18,500 (4.27) |
| BR2028 | F | 29 | 498 | 25,000 (4.40) |
| BR2038 | M | 30 | 640 | 19,000 (4.28) |
| Mean ± SD | 30.8 ± 2.6 | 529 ± 65 | 21,100 ± 5200 (4.32 ± 0.11) | |
| Patient | Visit | Clone | Subtype | Parent 1 | Parent 2 | Parent 3 | Start–End |
|---|---|---|---|---|---|---|---|
| 1052 | 1 | BF1 | F1 | B | 115-1187, 1590-2392, 8528-8607 | ||
| 1052 | 2 | 1 | BF1 | B | F1 | 865-1084 | |
| 1052 | 2 | 2 | BF1H | B | F1 | H | 1-42 (H), 867-1086 (F1) |
| 1052 | 2 | 3 | BF1 | B | F1 | 866-1085 | |
| 1052 | 2 | 5 | BF1 | B | F1 | 846-1086 | |
| 1052 | 2 | 6 | BF1 | B | F1 | 867-1086 | |
| 1052 | 2 | 7 | BF1 | B | F1 | 866-1085 | |
| 1052 | 2 | 8 | BF1 | B | F1 | 846-1086 | |
| 1052 | 2 | 9 | BF1 | B | F1 | 866-1085 | |
| 1052 | 2 | 10 | BF1H | B | F1 | H | 1-42 (H), 867-1086 (F1) |
| 1052 | 3 | 1 | DF1K | K | D | F1 | 453-857 (D), 858-1077 (F1) |
| 1052 | 3 | 2 | BF1 | B | F1 | 859_1077 | |
| 1052 | 3 | 3 | BF1 | B | F1 | 866-1085 | |
| 1052 | 3 | 4 | BF1 | B | F1 | 866-1085 | |
| 1052 | 3 | 5 | BF1 | B | F1 | 866-1085 | |
| 1052 | 3 | 6 | BF1K | B | K | F1 | 1-251 (K), 864-1003 (F1) |
| 1052 | 3 | 7 | BF1 | B | F1 | 866-1085 | |
| 1052 | 3 | 8 | BF1 | B | F1 | 866-1085 | |
| 1052 | 3 | 9 | BF1H | B | F1 | H | 1-42 (H), 867-1086 (F1) |
| 1052 | 3 | 10 | BF1 | B | F1 | 866-1085 | |
| 1052 | 4 | 1 | BF1 | B | F1 | 866-1085 | |
| 1052 | 4 | 2 | BF1 | B | F1 | 836-1055 | |
| 1052 | 4 | 3 | BF1 | B | F1 | 836-1055 | |
| 1052 | 4 | 4 | BF1 | B | F1 | 866-1085 | |
| 1052 | 4 | 5 | BF1 | B | F1 | 867-1086 | |
| 1052 | 4 | 6 | BF1 | B | F1 | 866-1085 | |
| 1052 | 4 | 7 | BF1 | B | F1 | 866-1085 | |
| 1052 | 4 | 8 | BF1 | B | F1 | 836-1055 | |
| 1052 | 4 | 9 | BF1 | B | F1 | 866-1085 | |
| 1052 | 4 | 10 | BF1 | B | F1 | 867-1086 | |
| 1052 | 5 | 1 | BF1 | B | F1 | 846-1086 | |
| 1052 | 5 | 2 | BF1 | B | F1 | 867-1086 | |
| 1052 | 5 | 4 | BF1 | B | F1 | 866-1085 | |
| 1052 | 5 | 5 | BF1 | B | F1 | 865-1084 | |
| 1052 | 5 | 6 | BF1 | B | F1 | 865-1084 | |
| 1052 | 5 | 7 | BF1 | B | F1 | 865-1084 | |
| 1052 | 5 | 8 | BF1 | B | F1 | 867-1086 | |
| 1052 | 5 | 9 | BF1 | B | F1 | 865-1084 | |
| 1052 | 5 | 10 | BF1 | B | F1 | 865-1084 | |
| 1114 | 1 | BC | C | B | 1622-1082, 6104-6973 | ||
| 1114 | 2 | 1 | BC | C | B | 1-381 | |
| 1114 | 2 | 2 | BC | C | B | 1-394 | |
| 1114 | 2 | 3 | BCJ | C | B | J | 1-41 (J), 42-394 (B) |
| 1114 | 2 | 4 | BC | C | B | 1-393 | |
| 1114 | 2 | 5 | BC | C | B | 1-381 | |
| 1114 | 2 | 8 | BC | C | B | 1-379 | |
| 1114 | 3 | 1 | BC | C | B | 1-394 | |
| 1114 | 3 | 2 | BC | C | B | 1-383 | |
| 1114 | 3 | 3 | BC | C | B | 1-394 | |
| 1114 | 3 | 4 | BC | C | B | 1-394 | |
| 1114 | 3 | 5 | BC | C | B | 1-393 | |
| 1114 | 3 | 6 | BC | C | B | 1-394 | |
| 1114 | 3 | 7 | BC | C | B | 1-394 | |
| 1114 | 3 | 8 | BC | C | B | 1-394 | |
| 1114 | 3 | 9 | BC | C | B | 1-394 | |
| 1114 | 3 | 10 | BC | C | B | 1-381 | |
| 1114 | 4 | 1 | BC | C | B | 1-391 | |
| 1114 | 4 | 2 | CDJ | C | D | J | 1-102 (J), 103-385 (D) |
| 1114 | 4 | 4 | BC | C | B | 1-394 | |
| 1114 | 4 | 5 | BC | C | B | 1-394 | |
| 1114 | 4 | 6 | BC | C | B | 1-394 | |
| 1114 | 4 | 7 | BC | C | B | 1-394 | |
| 1114 | 4 | 8 | BC | C | B | 1-394 | |
| 1114 | 4 | 9 | BC | C | B | 1-394 | |
| 1114 | 4 | 10 | BC | C | B | 1-394 | |
| 1114 | 5 | 1 | BC | C | B | 1-392 | |
| 1114 | 5 | 2 | BC | C | B | 1-394 | |
| 1114 | 5 | 4 | BC | C | B | 1-393 | |
| 1114 | 5 | 5 | BC | C | B | 1-394 | |
| 1114 | 5 | 6 | BC | C | B | 1-394 | |
| 1114 | 5 | 7 | BC | C | B | 1-394 | |
| 1114 | 5 | 9 | BC | C | B | 1-394 | |
| 1114 | 5 | 10 | BC | C | B | 1-394 | |
| 1117 | 1 | BF1 | B | F1 | 1695-1820, 3150-3796, 4189-4631, 8029-8829 | ||
| 1117 | 2 | 4 | BF1 | B | F1 | 794-1036 | |
| 1117 | 3 | 2 | BF1 | F1 | B | 973-1086 | |
| 1117 | 3 | 5 | DF1 | F1 | D | 973-1085 | |
| 1117 | 4 | 1 | BF1 | F1 | B | 973-1086 | |
| 1117 | 4 | 2 | DF1 | F1 | D | 973-1086 | |
| 1117 | 4 | 10 | BDF1 | F1 | B | D | 1-396 (B), 970-1082 (D) |
| 1117 | 5 | 1 | DF1 | F1 | D | 973-1086 | |
| 1117 | 5 | 2 | BF1 | B | F1 | 633-1084 | |
| 1117 | 5 | 3 | DF1 | F1 | D | 973-1085 | |
| 1117 | 5 | 4 | DF1 | F1 | D | 973-1086 | |
| 1117 | 5 | 8 | BF1 | B | F1 | 633-1084 | |
| 2028 | 1 | BF1 | B | F1 | 952-1685 | ||
| 2028 | 5 | 5 | BJ | B | J | 1-39 | |
| 2028 | 5 | 7 | BJ | B | J | 1-63 | |
| 2038 | 1 | BF1 | F1 | B | 245-4381 | ||
| 2038 | 2 | 4 | BK | B | K | 1-274 | |
| 2038 | 3 | 3 | A2B | B | A2 | 1-34 | |
| 2038 | 3 | 6 | A2B | B | A2 | 1-34 | |
| 2038 | 5 | 1 | A2B | B | A2 | 1-36 |
| Patient | Visit | Clone | PHI | Subtype | Parent 1 | Parent 2 |
|---|---|---|---|---|---|---|
| 1052 | 1 | 0.00 | BF1 | F1 | B | |
| 1114 | 2 | 2 | 8.00 | BC | C | B |
| 1114 | 2 | 3 | 1.20 | BC | C | B |
| 1114 | 2 | 4 | 1.70 | BC | C | B |
| 1114 | 2 | 5 | 1.20 | BC | C | B |
| 1114 | 2 | 6 | 1.30 | B | ||
| 1114 | 2 | 7 | 9.00 | B | ||
| 1114 | 2 | 8 | 1.00 | B | ||
| 1114 | 2 | 9 | 1.10 | B | ||
| 1114 | 2 | 10 | 8.00 | B | ||
| 1114 | 3 | 1 | 1.60 | BC | C | B |
| 1114 | 3 | 2 | 1.60 | BC | C | B |
| 1114 | 3 | 3 | 8.00 | BC | C | B |
| 1114 | 3 | 4 | 1.60 | BC | C | B |
| 1114 | 3 | 5 | 1.00 | BC | C | B |
| 1114 | 3 | 6 | 1.40 | BC | C | B |
| 1114 | 3 | 7 | 1.20 | BC | C | B |
| 1114 | 3 | 8 | 9.00 | BC | C | B |
| 1114 | 3 | 9 | 7.00 | BC | C | B |
| 1114 | 3 | 10 | 1.60 | BC | C | B |
| 1114 | 4 | 1 | 4.00 | BC | C | B |
| 1114 | 4 | 2 | 4.80 | BC | C | B |
| 1114 | 4 | 3 | 3.40 | B | ||
| 1114 | 4 | 4 | 2.50 | BC | C | B |
| 1114 | 4 | 5 | 3.50 | BC | C | B |
| 1114 | 4 | 6 | 4.20 | BC | C | B |
| 1114 | 4 | 7 | 3.30 | BC | C | B |
| 1114 | 4 | 8 | 4.20 | BC | C | B |
| 1114 | 4 | 9 | 3.40 | BC | C | B |
| 1114 | 4 | 10 | 4.00 | BC | C | B |
| 1114 | 5 | 1 | 2.00 | BC | C | B |
| 1114 | 5 | 2 | 0.00 | BC | C | B |
| 1114 | 5 | 3 | 2.00 | B | ||
| 1114 | 5 | 4 | 2.00 | BC | C | B |
| 1114 | 5 | 5 | 1.00 | BC | C | B |
| 1114 | 5 | 6 | 2.00 | BC | C | B |
| 1114 | 5 | 7 | 0.00 | BC | C | B |
| 1114 | 5 | 9 | 3.00 | BC | C | B |
| 1114 | 5 | 10 | 3.00 | BC | C | B |
| 1117 | 1 | 0.00 | BF1 | B | F1 | |
| 2028 | 1 | 0.00 | BF1 | B | F1 | |
| 2028 | 3 | 1 | 4.10 | B | ||
| 2038 | 1 | 0.00 | BF1 | F1 | B |
| Detection Methods | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Recombinants | Minor | Major | Start-End | R | G | B | M | C | S | T |
| !1052_V5_5, 1052_V2_3, 1052_V2_9, 1052_V3_10, 1052_V3_3-5, 1052_V3_8, 1052_V4_1, 1052_V4_4, 1052_V4_6-7, 1052_V4_9, 1052_V5_10 | 1052_V5_1, 1052_V2_10, 1052_V2_2, 1052_V2_5-6, 1052_V2_8, 1052_V3_2, 1052_V3_9, 1052_V4_10, 1052_V4_5, 1052_V5_2, 1052_V5_8 | ?(1052_V5_3), ?(1052_V2_4) | 4-410 | X | X | X | X | X | X | X |
| !1114_V4_2 | 1114_V3_6, 1114_V1, 1114_V2_1-2, 1114_V2_4, 1114_V2_5, 1114_V3_1, 1114_V3_3-4, 1114_V3_7-10, 1114_V4_10, 1114_V4_4-9, 1114_V5_10, 1114_V5_2, 1114_V5_5-7, 1114_V5_9 | ?(1114_V4_3), ?(1114_V2_10), ?(1114_V2_6-7), ?(1114_V2_9), ?(1114_V5_3) | 403-1102 | X | X | X | X | X | X | X |
| !1114_V5_3, 1114_V2_6-7, 1114_V4_3 | ?(1114_V4_1), ?(1114_V3_1), ?(1114_V3_3) | 1114_V3_3, 1114_V4_1, 1114_V5_1 | 1076-80 | X | X | X | X | X | X | X |
| !1114_V2_9 | ?(1114_V3_6), ?(1114_V4_1), ?(1114_V5_1), ?(1114_V5_4) | 1114_V4_1, 1114_V1, 1114_V2_1-2, 1114_V2_4-5, 1114_V2_8, 1114_V3_1-10, 1114_V4_4-10, 1114_V5_10, 1114_V5_2, 1114_V5_5-7, 1114_V5_9 | 1061-81 | X | X | X | X | X | X | X |
| !1114_V4_1, 1114_V5_4 | 1114_V2_5 | ?(1114_V3_6) | 324-1078 | X | X | X | X | X | X | |
| 1114_V5_1 | 1114_V2_4-5, 1114_V3_6 | 315-854 | X | X | X | X | X | X | X | |
| !1114_V2_5 | 1114_V2_8 | ?(1114_V2_4) | 869-398 | - | - | X | X | - | X | X |
| !1114_V2_5 | ?(1114_V2_10) | 1114_V2_3, 1114_V2_1-2, 1114_V2_4, 1114_V2_8, 1114_V3_1-9, 1114_V4_4-10, 1114_V5_2, 1114_V5_5-7, 1114_V5_9-10 | 409*-450 | X | - | - | X | - | X | X |
| !1117_V4_10 | 1117_V4_1, 1117_V3_4 | 1117_V3_3 | 360-1052 | X | X | X | X | X | X | X |
| !1117_V3_4 | 1117_V2_8, 1117_V1, 1117_V2_1-2, 1117_V2_5-7, 1117_V2_9-10, 1117_V3_1, 1117_V3_10, 1117_V3_2, 1117_V3_5, 1117_V3_7, 1117_V4_1-9, 1117_V5_1-8 | ?(1117_V3_3), ?(1117_V3_6), ?(1117_V5_10) | 422-1141 | X | X | X | X | X | X | X |
| !1117_V2_4, 1117_V2_3 | 1117_V3_6, 1117_V3_3, 1117_V5_9-10 | 1117_V1, 1117_V2_10, 1117_V2_8, 1117_V3_1, 1117_V3_10, 1117_V3_7-8, 1117_V4_1, 1117_V4_4, 1117_V4_6, 1117_V5_1, 1117_V5_3-7, | 42-628 | X | X | X | X | X | X | X |
| 1117_V5_8, 1117_V5_2 | 1117_V3_1 | 1117_V3_3, 1117_V3_6, 1117_V5_9-10 | 489-999 | X | X | X | X | X | X | X |
| 1117_V3_7 | ?(1117_V5_7) | 1117_V3_8-10, | 4*-52 | X | X | X | X | X | X | X |
| !1117_V4_1, 1117_V3_1[P], 1117_V3_5 | 1117_V5_9 | 1117_V4_3, 1117_V4_5-9 | 1025-1088 | - | X | X | X | - | X | X |
| !1117_V5_9 | 1117_V5_10 | ?(1117_V5_4) | 100-628* | - | - | X | X | X | X | X |
| !1117_V3_3 | ?(1117_V3_1), ?(1117_V2_6-9), ?(1117_V3_5), ?(1117_V4_1), ?(1117_V4_3), ?(1117_V4_5-9), ?(1117_V5_7) | 1117_V5_10 | 108-628* | - | - | - | X | X | X | X |
| !2028_V4_1 | ?(2028_V2_10) | 2028_V5_8 | 517*-605 | X | X | - | X | X | X | X |
| 2028_V4_6 | 2028_V5_1, 2028_V5_8 | 2028_V5_8, 2028_V2_1, 2028_V2_10, 2028_V2_4-7, 2028_V3_1-3, 2028_V3_7-10, 2028_V4_2, 2028_V4_7, 2028_V4_9, 2028_V5_7, 2028_V5_9 | 997-359 | X | X | X | X | X | X | X |
| !2028_V5_6 | ?(2028_V5_8) | 2028_V2_1, 2028_V2_4-6, 2028_V3_2-3, 2028_V3_8-9, 2028_V4_4, 2028_V4_7, 2028_V5_5, 2028_V5_9 | 27-308 | X | X | X | X | X | X | X |
| !2028_V5_1 | 2028_V2_1 | ?(2028_V2_10) | 181-924 | - | X | X | X | X | X | X |
| !2028_V5_8 | 2028_V3_3, 2028_V1, 2028_V2_1, 2028_V2_5-7, 2028_V2_9, 2028_V3_10, 2028_V3_2, 2028_V3_4-5, 2028_V3_7, 2028_V3_9, 2028_V4_10, 2028_V4_3, 2028_V4_5, 2028_V4_7, 2028_V4_9 | ?(2028_V4_8) | 1069-359 | X | X | X | X | X | X | X |
| !2028_V5_5 | 2028_V2_5 | 2028_V2_4, 2028_V3_10 | 121-871 | - | X | X | X | X | X | X |
| !2028_V4_4 | 2028_V3_10, 2028_V1, 2028_V3_3-4, | ?(2028_V3_3), ?(2028_V3_10) | 1053-75 | - | - | X | X | - | X | X |
| !2038_V4_1 | ?(2038_V2_4) | 2038_V3_4 | 837-261 | - | - | X | X | X | X | X |
| !2038_V2_2 | 2038_V5_2, 2038_V4_8 | ?(2038_V2_1), ?(2038_V2_3) | 272-888 | - | X | X | X | - | X | X |
| Sequences | p-Value (%) | G → A | GG | GA | GC | GT |
|---|---|---|---|---|---|---|
| 1052_V3_1 | 4.24 | 19 | 7 | 9 | 2 | 1 |
| 1114_V5_5 | 2.5 | 7 | 4 | 3 | 0 | 0 |
| 1114_V5_10 | 4.28 | 6 | 3 | 3 | 0 | 0 |
| 1114_V5_7 | 4.28 | 6 | 3 | 3 | 0 | 0 |
| 1114_V5_9 | 4.47 | 6 | 3 | 3 | 0 | 0 |
| 2028_V2_10 | 1.14 | 16 | 0 | 15 | 0 | 1 |
| 2028_V3_10 | 0.21 | 12 | 8 | 3 | 0 | 0 |
| 2028_V4_9 | 0.23 | 12 | 8 | 3 | 0 | 0 |
| 2028_V5_7 | 2.34 | 7 | 1 | 6 | 0 | 0 |
| 2038_V2_4 | 0.23 | 39 | 5 | 16 | 6 | 12 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Rodrigues, F.M.; Prieto-Oliveira, P.; Zukurov, J.P.; Alkmim, W.T.; Soane, M.M.; Camargo, M.; Sanabani, S.S.; Kallas, E.G.; Sucupira, M.C.; Diaz, R.S.; et al. Multiple Infections, Recombination, and Hypermutation During a 12-Month Prospective Study of Five HIV-1 Infected Individuals. Microbiol. Res. 2026, 17, 30. https://doi.org/10.3390/microbiolres17020030
Rodrigues FM, Prieto-Oliveira P, Zukurov JP, Alkmim WT, Soane MM, Camargo M, Sanabani SS, Kallas EG, Sucupira MC, Diaz RS, et al. Multiple Infections, Recombination, and Hypermutation During a 12-Month Prospective Study of Five HIV-1 Infected Individuals. Microbiology Research. 2026; 17(2):30. https://doi.org/10.3390/microbiolres17020030
Chicago/Turabian StyleRodrigues, Fernando M., Paula Prieto-Oliveira, Jean P. Zukurov, Wagner T. Alkmim, Michel M. Soane, Michelle Camargo, Sabri S. Sanabani, Esper G. Kallas, Maria Cecília Sucupira, Ricardo Sobhie Diaz, and et al. 2026. "Multiple Infections, Recombination, and Hypermutation During a 12-Month Prospective Study of Five HIV-1 Infected Individuals" Microbiology Research 17, no. 2: 30. https://doi.org/10.3390/microbiolres17020030
APA StyleRodrigues, F. M., Prieto-Oliveira, P., Zukurov, J. P., Alkmim, W. T., Soane, M. M., Camargo, M., Sanabani, S. S., Kallas, E. G., Sucupira, M. C., Diaz, R. S., Jacob Machado, D., & Janini, L. M. (2026). Multiple Infections, Recombination, and Hypermutation During a 12-Month Prospective Study of Five HIV-1 Infected Individuals. Microbiology Research, 17(2), 30. https://doi.org/10.3390/microbiolres17020030

