Next Article in Journal
Microbial Steroids: Novel Frameworks and Bioactivity Profiles
Previous Article in Journal
Heat Tolerance of Wildtype Salmonella Tennessee and Its Knock-Off Mutants in Peanut Butter and Peanut Spread
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Exploring Arid Soils as a Source of Bacillus thuringiensis Biocontrol Agents Active Against Dipteran and Lepidopteran Larvae

1
Department of Biological and Environmental Sciences, College of Arts and Sciences, Qatar University, Doha P.O. Box 2713, Qatar
2
Department of Agricultural Sciences, University of Sassari, 07100 Sassari, Italy
3
Desertification Research Centre (NRD), University of Sassari, 07100 Sassari, Italy
*
Author to whom correspondence should be addressed.
Microbiol. Res. 2026, 17(1), 14; https://doi.org/10.3390/microbiolres17010014
Submission received: 8 December 2025 / Revised: 30 December 2025 / Accepted: 5 January 2026 / Published: 8 January 2026

Abstract

Microbial communities found in arid environments often exhibit unique genetic and metabolic adaptations that enable them to synthesize potent bioactive compounds. Bacillus thuringiensis (Bt) is widely recognized for its biocontrol potential against various insects. This study aims to investigate the insecticidal potential of Bt strains isolated from Qatar’s soil against dipteran and lepidopteran larvae. The microscopic analysis identified distinct crystal types, including bipyramidal, cuboidal, spherical smooth, and spherical rough forms, with distinct cry, cyt, and vip genes. Strains producing bipyramidal crystals carry cry1A, cry2A, and vip3A genes, while only two strains producing spherical crystals carry cry4B and cyt1A genes. Bipyramidal crystal-producing strains (QBT552 and QBT877) showed potent insecticidal activity, achieving 100% mortality against Corcyra cephalonica larvae, with LC50 values of 25 µg/g. Spherical smooth crystal-producing strain (QBT862) exhibited high toxicity against Culex pipiens insect larvae (LC50 = 2 µg/L). The quantification of bipyramidal crystal protein production of strains QBT877 and QBT552 exhibited the highest δ-endotoxin yield (1334.4 ± 6.7 and 1188.7 ± 5.0 µg/mL, respectively), while smooth spherical crystal strains QBT758 and QBT862 were 577.5 ± 8.4 and 567.6 ± 8.4 µg/mL, respectively. These findings highlighted the potential of Bt QBT strains for biocontrol applications, with strains showing promise for producing effective δ-endotoxins.

Graphical Abstract

1. Introduction

Chemical pesticides have been used for many years to control pests and harmful insects in agriculture. However, they often contaminate water sources, leave residues in soil and food and even affect normal and beneficial organisms [1]. They have been increasingly linked to human health concerns and the rapid development of pest resistance. These challenges are getting worse due to ongoing global changes in climate and agricultural land, which can reduce the long-term effectiveness of traditional chemical control. Recent studies indicate that such pest responses may disrupt ecosystems and cause agronomic instability, thereby limiting the sustainability of chemical-based approaches [2]. Consequently, integrated pest management frameworks highly reinforce the balanced integration of chemical control with environmentally sustainable alternatives to minimize adverse impacts in both organic and conventional agricultural systems [3].
In this context, the use of biological control agents, such as Bacillus thuringiensis (Bt), offers one of the most promising solutions for specific insect pests. Bt produces δ-endotoxin proteins which are highly specific insecticidal proteins affecting various insects like Lepidoptera and Diptera [4,5]. The variety of δ-endotoxins have recognized Bt as one of the important biological control agent and an eco-friendly alternative to chemical pesticides [6,7]. Bt activity can be used with other techniques, such as genetic pest control which can enhance overall pest management strategies [8,9,10]. The effectiveness of Bt depends on its ability to produce crystal (Cry) and cytolysin (Cyt) toxin proteins during the sporulation phase [11]. These proteins are encoded by different cry, and cyt genes that are classified into subgroups based on their functional, and structural characteristics [12]. Cry proteins are particularly recognized for their specificity and potency targeting receptors in the midgut epithelial cells of susceptible insect species [13]. The mode of action of Bt δ-endotoxins begins when susceptible insects ingest the toxins, either as a part of spore-crystal formulations of Bt or through consumption of genetically transformed plants expressing Bt endotoxins. Following ingestion, the crystal proteins are solubilized and activated in the alkaline environment of the insect midgut, where they bind to specific epithelial cell receptors, disrupt membrane integrity, and finally cause cell lysis and insect death [7,14].
Regarding the effects of Bt δ-endotoxins, regulatory assessments have concluded that Bt subspecies used for mosquito control do not exhibit meaningful risks to human health and other mammals when used according to label directions [15]. It also noted that Bti is not considered to pose a hazard to humans through drinking water in vector control contexts [16]. From an environmental perspective, Bt products are generally considered more environmentally compatible than broad-spectrum chemical insecticides because their insecticidal activity is particular to target insect groups. However, non-target risk can depend on strain, formulation, application pattern, and the receiving ecosystem [17]. Collectively, these considerations support Bt as a helpful component of integrated pest and vector management, while underscoring the importance of strain identification and product quality assurance in applied settings.
Globally, Dipteran and Lepidopteran pests present significant agricultural and public health challenges. Among Dipterans, Culex pipiens (family Culicidae), one of the most widespread mosquito species that can transmit pathogens such as the West Nile virus and filarial worms, affects public health in many areas [18,19]. Other Dipteran insect such as Anopheles and Aedes species can transmit diseases like malaria, dengue and chikungunya, which facilitate the lifecycle of different pathogens like arboviruses and Plasmodium [20,21]. Among Lepidopterans, Corcyra cephalonica (family Pyralidae), commonly known as the rice moth, is a major storage pest that affects a wide range of cereals and grains, causing significant post-harvest losses [22]. Additionally, other Lepidopteran pests such as caterpillars are well known for damaging crops like cotton and maize, leading to significant economic losses [23]. Despite the widespread application of Bt-based products, including transgenic crops that can express cry genes, many reports have reported resistance in target pest populations which become a critical challenge [24,25]. Therefore, continuous exploration of alternative strategies is needed such as identifying Bt strains with enhanced efficacy. Techniques such as CRISPR and RNA interference are being explored to manage resistance and enhance the efficacy of Bt strains [26]. Addressing this issue requires the identification of novel Bt strains having enhanced protein efficacy with broader activity spectra. Ongoing research aims to discover and characterize new Bt strains, that can target pests resistant to the existing strains, which can directly help in pest control strategies [27,28].
In arid and semi-arid regions such as Qatar, the unique environmental conditions are characterized by high temperatures, salinity and low organic matter, presenting a great opportunity for isolating microorganisms with novel genetic and functional traits [29,30]. These microorganisms, are adapted to harsh conditions and they may possess specific biosynthetic pathways that enable them to produce novel bioactive compounds [31]. Therefore, they could play an important role in pest management strategies especially in regions where agricultural productivity is threatened by climate change and invasive pests [32].
In this context, the current study focuses on the characterization of unexplored Bt strains isolated from Qatar that may possess potent insecticidal activities. The study highlights the screening process of these strains using insect toxicity bioassays, determining their LC50 values, and correlating the bioassay results with the presence and diversity of insecticidal proteins coding genes cry, cyt, and vip.

2. Materials and Methods

2.1. Strain Selection and Identification of Crystal Morphology

The current study included Bacillus thuringiensis strains that were isolated from soil samples collected in Qatar (QBT), including QBT542, QBT552, QBT550, QBT605, QBT758, QBT830, QBT862, and QBT877 [33], in addition to Bacillus thuringiensis kurstaki (HD1) and Bacillus thuringiensis subsp. israelensis (H14) as reference strains. However, all strains were initially screened based on parasporal crystal morphology; only those that showed amplification of at least one insecticidal gene (cry, cyt, or vip) were selected for insect bioassays. Strains QBT550 and QBT605 were excluded from bioassays due to the lack of insecticidal genes in this study. All strains were grown on T3 agar plates (Peptone 5 g/L, Yeast extract 1.5 g/L, Na2HPO4 1.4 g/L, NaH2PO4 1.2 g/L, MnSO4·7H2O 0.002 g/L, MgSO4·7H2O 0.02 g/L, Agar 15 g/L; Biolife Italiana, Monza, Italy) and incubated for 3 days at 30 °C, allowing the cells to sporulate and produce insecticidal crystals. The identification of crystal morphology was performed for each strain using light microscopy followed by SEM to explore the detailed shape of the crystals. Crystal proteins were extracted from all strains, following the extraction protocol established in our laboratory [34]. Briefly, Bt cultures were harvested after sporulation and crystal formation, then fixed in 2.5% glutaraldehyde in 0.1 M phosphate buffer (pH 7.2) for 4 h at 4 °C. The samples were washed three times with phosphate buffer, followed by dehydration using different concentrations of ethanol (30%, 50%, 70%, 90%, and 100%). The dehydrated samples were mounted on SEM stubs and coated with gold using a sputter coater. Observations were carried out using a Nova NanoSEM 450 system (FEI Company, Hillsboro, OR, USA). SEM operated at an acceleration voltage of 15 kV, and images were captured at magnifications ranging from 10,000× to 25,000×.

2.2. PCR Amplifications of Insecticidal Genes

Plasmid DNA was extracted from all strains using the protocol of Sambrook et al. [35] to assess the presence of cyt, cry, and vip genes using specific primers as mentioned in Table 1 [36]. The exploration of these genes allows a rapid screening of the biocontrol potential of the isolated strains that are associated with toxicity against lepidopteran and dipteran pests. Polymerase Chain Reactions (PCR) amplification was conducted with Emerald Amp Max PCR Master Mix (Takara Bio Inc., Kusatsu, Shiga, Japan). The PCR protocol commenced with an initial denaturation step at 94 °C for 5 min, followed by 35 cycles consisting of denaturation at 94 °C for 1 min, annealing (at a temperature optimized for each primer set) for 45 s, extension at 72 °C for 1 min, and a final extension step at 72 °C for 7 min. Visualization of PCR products was achieved through gel electrophoresis using a 1% agarose gel stained with ethidium bromide. The resulting gel electrophoresis patterns were analyzed to confirm the presence of amplicons of expected sizes, indicative of the targeted cyt, cry, and vip genes, in the Bt strains.

2.3. Identification of the Highest δ-Endotoxin-Producing Strains

All explored Bt strains were cultured in T3 medium to identify the highest δ-endotoxin production rate, which was determined by measuring crystal protein concentration (µg/mL) and spore-forming cell counts (CFU/mL). The strains were plated on LB plates, and an isolated colony was transferred to 3 mL of fresh Luria-Bertani (LB) broth (Peptone 10 g/L, Yeast extract 5 g/L, NaCl 5 g/L; Biolife Italiana, Monza, Italy) and incubated overnight at 30 °C. A certain volume of the pre-culture was transferred to the 50 mL of T3 culture medium at 0.05 OD600 nm. The cultures were then incubated for 3–4 days at 30 °C and 180 rpm. The δ-endotoxin proteins were extracted by harvesting the spore-crystal mixture, followed by repeated centrifugation and washing with 0.5 M NaCl and distilled water. The parasporal crystal proteins were then solubilized with 50 mM NaOH. Crystal protein concentration was estimated using the Bradford assay, and spore count was measured using the colony-forming units (CFU). For spore count, the culture was heated at 80 °C for 10 min before plating to ensure that CFU counts reflected only sporulated cells. This treatment eliminates vegetative cells and selectively quantifies only spores. Crystal protein concentration was divided by the CFU obtained to calculate the microgram production per Bt cell.

2.4. Standardized Rearing of Corcyra cephalonica and Culex Pipiens Insect Larvae

The rearing of Corcyra cephalonica was conducted using an optimized protocol that allowed them to utilize a grain-based diet containing rice and yeast (10:1 ratio) to promote healthy growth. The insects were kept in controlled conditions at 28 ± 2 °C, 70 ± 5% relative humidity (RH), with a light and dark cycle every 12 h to support optimal larval development and adult emergence within 35–40 days [42]. Culex pipiens insect larvae were reared in water containers and fed a diet of ground cat food to ensure larval nutrition and growth [43]. The rearing environment was maintained at 29 ± 3 °C and 80 ± 5% RH with a 12:12 light-dark cycle to align with the species’ natural developmental preferences. To ensure uniformity in experimental conditions and results, 3rd instar larvae of both insects were selectively collected for study. Corcyra cephalonica larvae were monitored post-hatching, and individuals in the 3rd instar stages were identified based on size and developmental markers, as mentioned by Abels et al. [44], who provide comprehensive criteria for early instar identification in Lepidopteran species. Culex pipiens larvae were observed daily for hatching, and those progressing to 3rd instar were selected based on morphological criteria focusing on larval size and the presence of specific setae as distinguishing features [45]. All these larvae were then segregated into separate rearing containers to maintain developmental consistency for further analysis.

2.5. Bioassay and Determining LC50 Analysis

To assess the insecticidal efficacy of Bt δ-endotoxin proteins against Corcyra cephalonica, and Culex pipiens larvae in the 3rd instar were exposed to varying concentrations of the proteins. For Corcyra cephalonica larvae, the δ-endotoxin solutions were incorporated into the grain-based diet at concentrations of 10, 25, 75, and 100 µg/g. Also, Culex pipiens larvae were exposed to 0.5, 1, 2, and 3.5 µg/L of the δ-endotoxin solutions in sterile water as a medium at the same rearing conditions. The concentration ranges selected for the bioassays were determined based on preliminary screening assays and previously reported LC50 values for Bacillus thuringiensis δ-endotoxins against Lepidopteran and Dipteran larvae [46,47]. Larvae remained untreated with any crystal substances used as a negative control. Three replicates for each concentration, including the control group, were established, with each replicate consisting of 10 larvae. Post-exposure larvae were monitored daily for mortality rates over three days, with dead larvae being counted and removed from the culture to prevent decomposition and potential secondary effects on surviving larvae. Probit analysis was used to calculate the LC50 values, in line with the statistical guidelines for biopesticide efficacy assessment [48].

2.6. Statistical Analysis

Probit analysis was applied using R statistical software (2024.12.1 Build 563) to estimate LC50 values and associated 95% confidence intervals (CI). Goodness-of-fit was assessed using Chi-square tests (χ2) with degrees of freedom (df) based on the number of dose groups minus the number of model parameters. This allowed the precise calculation of the lethal concentration (LC50) values where 50% of the test population died. The analysis is integral for determining the potency and effective concentration ranges of δ-endotoxins against Corcyra cephalonica and Culex pipiens larvae. The data were assessed for normality and homoscedasticity to validate the assumptions of Probit analysis. All replicates in the study were set up to enhance the reliability of the findings, and standard deviations were calculated to quantify the variability within each treatment group. Statistical significance was determined at a 95% confidence interval, and the analysis incorporated dose–response relationships with results expressed with associated confidence limits.

3. Result

3.1. Exploration of Bt Strains Parasporal Crystals

Hundreds of Bacillus thuringiensis strains have been previously isolated from different regions in Qatar, forming a strain bank repository housed in our laboratory (QBT strains). In this study, we focused on unexplored QBT strains. The parasporal crystals were examined by light microscopy (1000×) followed by scanning electron microscopy (SEM) (10,000× and 25,000×) to explore more details about the distinct morphological characteristics of the crystals. Two strains were used as reference strains: Bacillus thuringiensis kurstaki, which forms bipyramidal crystals, and Bacillus thuringiensis subsp. israelensis, which forms spherical smooth crystals. The microscopic examination combined with SEM showed that four strains (QBT542, QBT552, QBT830, QBT877) produced both bipyramidal and cuboidal-shaped crystals, two strains (QBT758, QBT862) produced smooth spherical crystals, and two strains (QBT550, QBT605) produced rough spherical crystals (Figure 1).

3.2. Investigation of the Genes Encoding δ-Endotoxins and Vegetative Insecticidal Proteins

The exploration for the gene encoding cry, cyt genes that are responsible for δ-endotoxin production, and vip genes encoding vegetative insecticidal proteins among Bt strains showed a significant finding for their potential insecticidal capabilities. All strains producing bipyramidal and cuboidal-shaped crystals (QBT542, QBT552, QBT830, and QBT877) confirmed the amplification of the cry1A (986 bp), cry2A (570 bp), and cry5A (726 bp) genes, in addition to the vip3A gene (419 bp and 2370 bp) (Figure 2). On the other hand, two strains producing spherical smooth crystals (QBT758 and QBT862) confirmed the presence of the cry4B gene (800 bp and 1293 bp) and the cyt1A (521 bp) (Figure 3). The different sizes for vip3A and cry4B genes correspond to amplification of distinct regions of the same gene using different primer sets, as listed in Table 1. Strains QBT550 and QBT605, which were found to produce spherical rough crystals, showed no amplification for cry4B and cyt1A genes. These findings highlight the gene content diversity within these strains and their potential efficacy against insect pests.

3.3. Estimation of δ-Endotoxin Synthesis of Bipyramidal Crystal-Producing Strains

Bt strains can generally produce crystals and spores during the sporulation phase. The results reported that the strain QBT877 produced the highest concentration of protein per ml (1334.4 ± 6.7 µg/mL), and QBT542 was the lowest concentration (605.0 ± 5.9 µg/mL). Both QBT552 and QBT830 produced 1188.7 ± 5.04 and 1149.1 ± 2.59 µg/mL, respectively, and the reference strain HD1 produced 1052.0 ± 11.8 µg/mL (Table 2). In parallel, strain QBT877 showed the highest spore count (6.47 ± 0.85 × 108 spores/mL), while the lowest spore count was of QBT542 (2.43 ± 0.29 × 108 spores/mL). The reference strain HD1 showed 5.6 ± 0.74 × 108 spores/mL, while strains QBT552 and QBT830 showed almost the same amount with 4.67 ± 0.46 × 108 and 4.80 ± 0.71 × 108 spores/mL, respectively (Table 2).

3.4. Estimation of δ-Endotoxin Synthesis of Spherical Crystal-Producing Strains

The protein concentration results of spherical crystal-producing strains showed that strains QBT550 produced more crystal proteins (889.7 ± 4.7 µg/mL) than all the strains examined (Table 2). The crystal protein concentration of QBT605 and H14 was almost the same (706.8 ± 11.5 and 695.1 ± 8.4 µg/mL, respectively), while both QBT758 and QBT862 showed the lowest protein concentration (577.5 ± 8.4 and 567.6 ± 8.4 µg/mL, respectively). The CFU results demonstrated that strain QBT758 showed the highest level in spore count per ml (12.0 ± 2.3 × 108), followed by H14 (10.2 ± 4.7 × 108), QBT862 (8.93 ± 0.9 × 108), and QBT550 (8.03 ± 0.9 × 108), while QBT605 showed the lowest spore count per mL (7.33 ± 0.5 × 108) (Table 2).

3.5. Investigation of the Insecticidal Activity of Bt δ-Endotoxins Against Corcyra cephalonica and Culex pipiens Larvae

3.5.1. Bioassay Analysis

Based on the gene content analysis of insecticidal activity-related genes, strains QBT550 and QBT605 were excluded from the insecticidal activity analysis because they did not show clear specific amplifications of cry4B and cyt1A genes. All other strains were used to study their potential effectiveness against Lepidopteran and Dipteran larvae. To determine the insecticidal activity of QBT strains, Corcyra cephalonica larvae were treated with 100 µg/mg of δ-endotoxins protein extracted from the bipyramidal strains (QBT542, QBT552, QBT830, QBT877). On the other hand, Culex pipiens larvae were treated with 3.5 µg/L of δ-endotoxins protein extracted from strains that produce smooth spherical crystals (H14, QBT758, QBT862). The ingestion of Bt crystal showed a significant mortality rate against Corcyra cephalonica larvae, reaching up to 100% for δ-endotoxins extracted from strains QBT552 and QBT877. Also, strains QBT758 and QBT862 exhibited mortality rates of 47% and 70.0%, respectively, against Culex pipiens larvae. Table 3 provides a summary of the insecticidal gene and insecticidal activity of each strain, highlighting the correlation between the presence of specific genes and the observed larval mortality.

3.5.2. Lethal Concentration (LC50) Determination of δ-Endotoxins:

To determine the concentration of δ-endotoxins, which can kill 50% of the larvae (LC50), Corcyra cephalonica larvae were treated with 10, 25, 75, and 100 µg/g from δ-endotoxins of QBT552 that produce bipyramidal crystals (Figure 4), and Culex pipiens larvae were treated with 0.5, 1, 2, 3.5 µg/L from δ-endotoxins of QBT862 that produce spherical crystals (Figure 4). The experiments were repeated three times for statistical accuracy. The results indicate a consistent increase in mortality correlating with the concentration of both δ-endotoxins treatment, affirming lethal effectiveness on Corcyra cephalonica and Culex pipiens larvae. The probit analysis estimated the LC50 of δ-endotoxins from QBT552 against Corcyra cephalonica as 25 µg/g (95% CI: 14.69–28.50 µg/g, χ2 = 21.40, df = 3, p = 0.00009) and for QBT862 against Culex pipiens as 2 µg/L (95% CI: 0.90–2.67 µg/L, χ2 = 18.93, df = 3, p = 0.00028), indicating good model fit and significant dose–response relationships.

3.5.3. Morphological Changes of Insect Larvae

The morphological examination of both larvae post-treatment showed a clear change in external appearance and internal structures, particularly in the midgut region, which serves as the primary target site for the crystal Bt δ-endotoxins. Changes in the external appearance of Corcyra cephalonica dead larvae were observed. Specifically, the color of the larvae that transitioned from the normal dark yellowish to a distinct black color is indicative of post-mortem changes. This alteration in color suggests underlying physiological changes within the larvae, potentially related to the toxic effects of Bt δ-endotoxin proteins (Figure 5). The effect of Bt δ-endotoxin proteins on Culex pipiens larvae induced notable alterations of the larvae midgut, as evidenced by microscopic examination. The midgut epithelium exhibited clear characteristic signs, including swelling, vacuolization, and disruption (Figure 6). These morphological effects are consistent with typical Bt intoxication mechanisms and confirm the functional activity of the δ-endotoxins produced by the newly isolated QBT strains.

4. Discussion

This study highlights the ecological significance of Bacillus thuringiensis strains adapted to arid soils and their strong insecticidal potential. The environment of Qatar is characterized by extreme temperature fluctuations, high salinity, and low organic matter, representing a selective habitat that may encode unique genetic and physiological adaptations within local microbial populations. Such environments remain largely underexplored for Bt diversity, and the discovery of strains capable of maintaining high δ-endotoxin productivity and toxicity under these conditions highlights their potential ecological resilience and biotechnological relevance.
The present study demonstrated that the morphological characteristics of parasporal crystals which correlate with the presence of genes responsible for insecticidal activity, and assessed the insecticidal efficacy against insect larvae, highlighting the potential application of these Bt strains in biocontrol applications. The SEM analyses showed a distinct diversity in the crystal morphologies of the Bt strains. While the reference strains HD1, and H14 exhibited the expected bipyramidal and smooth spherical crystals, respectively, the QBT strains displayed a range of crystal forms including bipyramidal, cuboidal, smooth spherical and rough spherical crystals. This morphological diversity indicates the possible genetic variation among the strains which could enhance their insecticidal properties. In this study, the presence of both bipyramidal and cuboid crystals within a single strain may indicate co-expression of multiple cry genes. Such diversity among all tested strains highlights their potential for unique insecticidal profiles. For example, strain QBT877 showed high production of δ-endotoxins and spores among all strains that produce bipyramidal and cuboidal crystals, indicating strong potential for biocontrol applications. Previous studies have shown that crystal shapes can impact the solubility, and activation of δ-endotoxins in the insect gut thereby affecting the potency of the toxin [49,50]. The diversity observed in all tested strains suggests they may possess unique insecticidal activity that needs further exploration.
The results observed that strain QBT877 has significant production of both δ-endotoxin and spores among all strains that produce bipyramidal crystals. For strains that produce spherical crystals, QBT550 showed a high production of δ-endotoxin, while strain QBT758 showed the highest production of spores. Estimating spore counts increases our understanding of the lifecycle and productivity of Bt strains. Good sporulation can be linked to δ-endotoxin synthesis and therefore, crystal formation which is important for the long-term survival, and efficacy of Bt formulations in field applications. All Bt strains showed different spore count levels per ml, regardless of their crystal protein concentration. This diversity level between the protein concentration and the spore count within all strains leads to identifying which strain can produce a high crystal amount per cell. The findings showed that the δ-endotoxin yield per cell does not directly correlate with the total protein concentration or spore counts. For example, while strain QBT877 showed the highest total protein concentration, and spore count, its δ-endotoxin per cell was lower compared to QBT552, which demonstrated the highest per-cell toxin productivity. The observation that QBT552 exhibited a higher crystal protein yield per cell, despite a lower overall protein concentration, than QBT877 suggests biological differences, such as more efficient toxin expression, or differences in crystal composition or structure. This demonstrates that the productivity efficiency of distinct Bt strains cannot be adequately captured by protein yield and spore count alone.
The bioassay results demonstrated that several QBT strains exhibit potent insecticidal activity against Corcyra cephalonica, and Culex pipiens larvae. Strains QBT552 and QBT877 achieved 100% mortality in Corcyra cephalonica, while QBT862 showed 70% mortality rate in Culex pipiens. These results are consistent with the known effectiveness of Bt strains, against Lepidopteran and Dipteran pests [34,51,52,53]. The high mortality rates observed suggest that these strains could be highly effective in biocontrol applications, particularly in regions where these pests are prevalent. The determination of LC50 values further supported the efficacy of these strains, with QBT552 and QBT862 demonstrating significant toxicity at relatively low concentrations. The LC50 values of 25 µg/g for Corcyra cephalonica, and 2 µg/L for Culex pipiens are lower than the other reported values [54,55]. These findings suggest that the δ-endotoxins of QBT552 and QBT862 exhibit a significant toxic effect in a dose-dependent manner. Furthermore, the observed standard deviations across replicates showed a moderate variability in larval responses, indicating a consistent pattern of susceptibility to δ-endotoxin exposure in both species.
The LC50 of QBT552 against Corcyra cephalonica was found to be lower than the value reported for strain Bacillus thuringiensis var. kurstaki ABTS-351 (65.8 µg/mL) [47]. Similarly, the LC50 of QBT862 against Culex pipiens was lower than 192 µg/L reported for Bacillus thuringiensis subsp. Israelensis [46], indicating stronger insecticidal potency. The LC50 values observed in this study are within the range of variability reported for Bt-based insecticidal activity. However, LC50 estimates are strongly affected by many factors, such as toxin preparation and the bioassay format (dry or liquid diet). In addition, larval instar, exposure duration, and the manner in which the dose is expressed can also affect LC50 outcomes. For example, recent work screening native Bt isolates against Culex pipiens reported LC50 values reaching 28.5 µg/mL for spore–crystal mixtures after 24 h [55]. In parallel, our molecular profiles are consistent with widely recognized patterns linking dipteran activity to Bti-like toxin sets, in which Cyt proteins activate the Cry and support high larvicidal efficacy, and with lepidopteran activity to Cry1/Cry2-type profiles, often accompanied by Vip3A in some isolates [56].
Since both reference strains HD1, and H14, have been found to demonstrate bioinsecticidal activity [57,58], the similarity in the band size for all tested genes allows for the potential of investigating the capabilities of the tested strains to perform a similar or better activity. Therefore, further investigation was needed to predict the presence of different cry, and cyt encoding genes that are toxic to many different insect pests [59]. The correlation between the presence of specific cry, cyt, and vip genes and the observed insecticidal activity was conducted in this study. Strains containing multiple cry genes such as cry1A, cry2A, cry5A and vip3A, exhibited the highest toxicity levels against Corcyra cephalonica (Table 3). This supports the hypothesis that the presence of a diverse set of cry genes, can enhance the insecticidal spectrum of Bt strains, particularly when combined with Vip proteins, which are known to act synergistically with Cry proteins [53,60,61]. Also, these align with previous findings that some Bt pesticidal proteins exhibit cross-order activity, broadening their potential utility in pest control strategies [62]. The mortality rates observed in Culex pipiens could be attributed to the presence of cry4B and cyt1A genes. These results align with other studies that explored the insecticidal cry gene profiles of different Bt strains, such as cry4A/4B, cry11, cyt1A, and cyt2, which are known for their insecticidal activity against Dipteran larvae [33]. Furthermore, these genetic markers are important in determining the effectiveness of Bt strains against Aedes aegypti, as a Dipteran pest [34].
The extreme environment in which the QBT strains were isolated may provide important context for the observed variability in insecticidal activity. Bt is known to exhibit significant diversity in Cry and Cyt toxin composition and expression, which can also be affected by local environmental pressures [63]. The extreme environment of arid and semi-arid soils, such as those found in Qatar, may support the growth of microorganisms with distinct physiological traits and stress tolerance. These conditions could influence the regulation, expression levels, and stability of δ-endotoxins compared to strains originating from more temperate environments. Although molecular and biochemical characterization of the toxins was not performed in this study, the pronounced insecticidal activity observed in several QBT strains suggests that adaptation to extreme environments may contribute to functional differences in toxin efficacy.
The results highlight the potential of the QBT strains as effective biocontrol agents. The high levels of insecticidal activity observed, along with the diverse genetic profiles of the strains, suggest that these isolates could be used in pest management strategies. For instance, strains like QBT552 could be developed for targeting Lepidopteran pests in agricultural settings, while QBT862 could be optimized for mosquito control. The findings suggest that both strains, which demonstrated both high crystal protein concentrations and spore counts, are promising candidates for future large-scale production and formulation. However, optimizing the conditions of the isolated Bacillus thuringiensis strains, together with formulation stability studies, will be necessary to assess their industrial application. Additionally, the genetic basis of their insecticidal activity should be further explored, particularly in terms of gene expression and protein activity, to better understand the mechanisms underlying their potency. Further genomic investigation of the isolated strains, including whole-genome sequencing and proteomic analysis of the δ-endotoxins, is recommended to explore and identify the insecticidal proteins. The present study focused on the isolation, molecular characterization, and bioassay-based evaluation of Bacillus thuringiensis strains isolated from extreme environments. However, field validation was not included in this study, and environmental factors such as temperature fluctuations, UV exposure, and microbial competition may influence efficacy in natural settings. In addition, formulation stability, persistence, and delivery methods were not investigated. These limitations highlight essential next steps, including formulation development and field-scale trials, to fully assess the biocontrol potential of the most promising QBT strains.

5. Conclusions

The study has demonstrated that the isolated Bt strains from Qatar, possess significant insecticidal potential against Dipteran and Lepidopteran insect larvae. The results highlighted that strains QBT552 and QBT862 showed high insecticidal activity with LC50 25 µg/g, and 2 µg/L against Corcyra cephalonica and Culex pipiens larvae, respectively. The correlation between the presence of cry, cyt, and vip genes and the insecticidal activity potential confirms the importance of these genes in the isolated Bt strains for effective pest control. The δ-endotoxin synthesis of the spherical crystal-producing strain QBT862 was 567.6 ± 8.4 µg/mL, and the bipyramidal producing strain QBT552 was 1188.7 ± 5.0 µg/mL, demonstrating the great potential of this strain for large-scale production and promotion of integrated and biological pest control management in the region.

Author Contributions

Conceptualization, S.J., Q.M., and K.B.; methodology, S.J., K.B., F.A.-M., and A.A.; software, K.B.; validation, S.J., K.B., F.A.-M., and A.A.; formal analysis, S.J., K.B., F.A.-M., and A.A.; investigation, S.J., K.B., F.A.-M., and A.A.; resources, S.J.; data curation, S.J. and K.B.; writing—original draft preparation, S.J. and K.B.; writing—review and editing, S.J., Z.U.H., and Q.M.; supervision, S.J.; project administration, S.J.; funding acquisition, S.J. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Qatar National Research Fund, a member of the Qatar Foundation, under the grant codes MME03-1115-210017 and UREP31-155-2-053.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Acknowledgments

We would also like to thank Essam Shabaan Attia (Qatar University Central Laboratories Unit) for his technical support for SEM imaging.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
BtBacillus thuringiensis
CFUColony-Forming Units
CIConfidence Interval
CryCrystal (δ-endotoxin) protein
CytCytolysin (δ-endotoxin) protein
dfDegrees of Freedom
LC50Lethal Concentration required to kill 50% of the tested organisms
QBTBacillus thuringiensis strains isolated from Qatar
SEMScanning Electron Microscopy
VipVegetative insecticidal protein
χ2Chi-square statistical test

References

  1. Nath, A.; Bhuyan, P.; Gogoi, N.; Deka, P. Pesticides and chemical fertilizers: Role in soil degradation, groundwater contamination, and human health. In Xenobiotics in Urban Ecosystems: Sources, Distribution and Health Impacts; Springer: Berlin/Heidelberg, Germany, 2023; pp. 131–160. [Google Scholar]
  2. Ma, C.-S.; Wang, B.-X.; Wang, X.-J.; Lin, Q.-C.; Zhang, W.; Yang, X.-F.; van Baaren, J.; Bebber, D.P.; Eigenbrode, S.D.; Zalucki, M.P.; et al. Crop pest responses to global changes in climate and land management. Nat. Rev. Earth Environ. 2025, 6, 264–283. [Google Scholar] [CrossRef] [Scilit]
  3. Baker, B.P.; Green, T.A.; Loker, A.J. Biological control and integrated pest management in organic and conventional systems. Biol. Control 2020, 140, 104095. [Google Scholar] [CrossRef] [Scilit]
  4. Aswathi, N.; Balakrishnan, N.; Srinivasan, T.; Kokiladevi, E.; Raghu, R. Diversity of Bt toxins and their utility in pest management. Egypt. J. Biol. Pest Control 2024, 34, 40. [Google Scholar] [CrossRef] [Scilit]
  5. Palma, L.; Sauka, D.H.; Ibarra, J.E. Bacillus thuringiensis: A Broader View of Its Biocidal Activity. Toxins 2024, 16, 162. [Google Scholar] [CrossRef] [Scilit]
  6. Ma, C. Bt in Organic Farming: Benefits and Limitations. Bt Res. 2024, 15, 174–182. [Google Scholar] [CrossRef] [Scilit]
  7. Tetreau, G.; Andreeva, E.A.; Banneville, A.-S.; De Zitter, E.; Colletier, J.-P. How does Bacillus thuringiensis crystallize such a large diversity of toxins? Toxins 2021, 13, 443. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Awad Fahad, A. Modern techniques in integrated pest management to achieve sustainable agricultural development. Int. J. Fam. Stud. Food Sci. Nutr. Health 2023, 4, 1–14. [Google Scholar] [CrossRef] [Scilit]
  9. Hmida-Sayari, A.; Costa, A.; Leone, A.; Jaoua, S.; Gargouri-Bouzid, R. Identification of salt stress-induced transcripts in potato leaves by cDNA-AFLP. Mol. Biotechnol. 2005, 30, 31–39. [Google Scholar] [CrossRef] [Scilit]
  10. Ragasruthi, M.; Balakrishnan, N.; Murugan, M.; Swarnakumari, N.; Harish, S.; Sharmila, D.J.S. Bacillus thuringiensis (Bt)-based biopesticide: Navigating success, challenges, and future horizons in sustainable pest control. Sci. Total Environ. 2024, 954, 176594. [Google Scholar] [CrossRef] [Scilit]
  11. Saadaoui, I.; Rouis, S.; Jaoua, S. A new Tunisian strain of Bacillus thuringiensis kurstaki having high insecticidal activity and δ-endotoxin yield. Arch. Microbiol. 2009, 191, 341–348. [Google Scholar] [CrossRef] [Scilit]
  12. Das, S.K.; Pradhan, S.K.; Samal, K.C.; Singh, N.R. Structural, functional, and evolutionary analysis of Cry toxins of Bacillus thuringiensis: An in silico study. Egypt. J. Biol. Pest Control 2021, 31, 44. [Google Scholar]
  13. Pardo-López, L.; Soberón, M.; Bravo, A. Bacillus thuringiensis insecticidal three-domain Cry toxins: Mode of action, insect resistance and consequences for crop protection. FEMS Microbiol. Rev. 2013, 37, 3–22. [Google Scholar]
  14. Jisha, V.N.; Smitha, R.B.; Benjamin, S. An overview on the crystal toxins from Bacillus thuringiensis. Adv. Microbiol. 2013, 3, 462. [Google Scholar] [CrossRef]
  15. Otvos, I.S.; Armstrong, H.; Conder, N. Safety of Bacillus thuringiensis var. kurstaki applications for insect control to humans and large mammals. In Proceedings of the 6th Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, Victoria, BC, Canada, 30 October–3 November 2005. [Google Scholar]
  16. Land, M.; Bundschuh, M.; Hopkins, R.J.; Poulin, B.; McKie, B.G. What are the effects of control of mosquitoes and other nematoceran Diptera using the microbial agent Bacillus thuringiensis israelensis (Bti) on aquatic and terrestrial ecosystems? A systematic review protocol. Environ. Evid. 2019, 8, 32. [Google Scholar] [CrossRef] [Scilit]
  17. Koch, M.S.; Ward, J.M.; Levine, S.L.; Baum, J.A.; Vicini, J.L.; Hammond, B.G. The food and environmental safety of Bt crops. Front. Plant Sci. 2015, 6, 283. [Google Scholar] [CrossRef] [Scilit]
  18. Andreadis, T.G. The contribution of Culex pipiens complex mosquitoes to transmission and persistence of West Nile virus in North America. J. Am. Mosq. Control Assoc. 2012, 28, 137–151. [Google Scholar]
  19. Michalski, M.L.; Erickson, S.M.; Bartholomay, L.C.; Christensen, B.M. Midgut barrier imparts selective resistance to filarial worm infection in Culex pipiens pipiens. PLoS Neglected Trop. Dis. 2010, 4, e875. [Google Scholar] [CrossRef] [Scilit]
  20. Cottis, S.; Blisnick, A.A.; Failloux, A.-B.; Vernick, K.D. Determinants of chikungunya and O’nyong-Nyong virus specificity for infection of Aedes and Anopheles mosquito vectors. Viruses 2023, 15, 589. [Google Scholar]
  21. Gonzales-Wartz, K.K.; Sá, J.M.; Lee, K.; Gebremicale, Y.; Deng, B.; Long, C.A.; Pascini, T.V.; Laughinghouse, A.; Moretz, S.E.; Ortega-Villa, A.M. Infectivity of Plasmodium parasites to Aedes aegypti and Anopheles stephensi mosquitoes maintained on blood-free meals of SkitoSnack. Parasites Vectors 2024, 17, 290. [Google Scholar] [CrossRef] [Scilit]
  22. Vincent, A.; Singh, D.; Mathew, I.L. Corcyra cephalonica: A serious pest of stored products or a factitious host of biocontrol agents? J. Stored Prod. Res. 2021, 94, 101876. [Google Scholar] [CrossRef] [Scilit]
  23. Jones, R.W.; Bernal, J.S.; del Val de Gortari, E.; Sánchez-Reyes, U.J. Origins and coadaptation of insect pests from wild to domesticated host plants: Examples from maize, cotton, and prickly pear cactus. In Mexican Fauna in the Anthropocene; Springer: Berlin/Heidelberg, Germany, 2023; pp. 549–567. [Google Scholar]
  24. Schlum, K.; Lamour, K.; Tandy, P.; Emrich, S.J.; de Bortoli, C.P.; Rao, T.; Viteri Dillon, D.M.; Linares-Ramirez, A.M.; Jurat-Fuentes, J.L. Genetic screening to identify candidate resistance alleles to Cry1F corn in fall armyworm using targeted sequencing. Insects 2021, 12, 618. [Google Scholar] [CrossRef] [Scilit]
  25. Wang, J.; Xu, D.; Wang, L.; Cong, S.; Wan, P.; Lei, C.; Fabrick, J.A.; Li, X.; Tabashnik, B.E.; Wu, K. Bt resistance alleles in field populations of pink bollworm from China: Similarities with the United States and decreased frequency from 2012 to 2015. Pest Manag. Sci. 2020, 76, 527–533. [Google Scholar]
  26. Nagaraj, S.; Rajasekaran, R.; Palaniappan, J.; Rangasamy, S.; Narayanasamy, C.; Narayanan, M.B. Emerging technological developments to address pest resistance in Bt cotton. J. Cotton Res. 2024, 7, 30. [Google Scholar] [CrossRef] [Scilit]
  27. Pinheiro, D.H.; Valicente, F.H. Identification of Bacillus thuringiensis strains for the management of lepidopteran pests. Neotrop. Entomol. 2021, 50, 804–811. [Google Scholar]
  28. Unzue, A.; Caballero, C.J.; Villanueva, M.; Fernández, A.B.; Caballero, P. Multifunctional properties of a Bacillus thuringiensis strain (BST-122): Beyond the parasporal crystal. Toxins 2022, 14, 768. [Google Scholar] [CrossRef] [Scilit]
  29. Ejaz, M.R.; Badr, K.; Hassan, Z.U.; Al-Thani, R.; Jaoua, S. Metagenomic approaches and opportunities in arid soil research. Sci. Total Environ. 2024, 953, 176173. [Google Scholar]
  30. Mawar, R.; Ranawat, M.; Sharma, S.K.; Sayyed, R. Exploring microbial diversity of arid regions of globe for agricultural sustainability: A revisit. In Plant Growth Promoting Microorganisms of Arid Region; Springer: Berlin/Heidelberg, Germany, 2023; pp. 1–25. [Google Scholar]
  31. Sayed, A.M.; Hassan, M.H.; Alhadrami, H.A.; Hassan, H.M.; Goodfellow, M.; Rateb, M.E. Extreme environments: Microbiology leading to specialized metabolites. J. Appl. Microbiol. 2020, 128, 630–657. [Google Scholar] [PubMed]
  32. Zhao, X.; Bai, S.; Lyu, L.; Zhang, X. Research progress in isolation strategies and bioactive substances of microorganisms in extreme environments. Sheng Wu Gong Cheng Xue Bao = Chin. J. Biotechnol. 2024, 40, 3407–3426. [Google Scholar]
  33. Nair, K.; Al-Thani, R.; Al-Thani, D.; Al-Yafei, F.; Ahmed, T.; Jaoua, S. Diversity of Bacillus thuringiensis strains from Qatar as shown by crystal morphology, δ-endotoxins and cry gene content. Front. Microbiol. 2018, 9, 708. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Nair, K.; Al-Thani, R.; Ginibre, C.; Chandre, F.; Alsafran, M.; Jaoua, S. Bacillus thuringiensis strains isolated from Qatari soil, synthesizing δ-endotoxins highly active against the disease vector insect Aedes aegypti Bora Bora. Heliyon 2020, 6, e05003. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Sambrook, J. Molecular Cloning: A Laboratory Manual; Cold Spring Habor Laboratory: Cold Spring Habor, NY, USA, 1989. [Google Scholar]
  36. Jaoua, S.; Zouari, N.; Tounsi, S.; Ellouz, R. Study of the δ-endotoxins produced by three recently isolated strains of Bacillus thuringiensis. FEMS Microbiol. Lett. 1996, 145, 349–354. [Google Scholar] [CrossRef] [Scilit]
  37. Carozzi, N.B.; Kramer, V.C.; Warren, G.W.; Evola, S.; Koziel, M.G. Prediction of insecticidal activity of Bacillus thuringiensis strains by polymerase chain reaction product profiles. Appl. Environ. Microbiol. 1991, 57, 3057–3061. [Google Scholar] [CrossRef] [Scilit]
  38. Jain, D.; Sunda, S.D.; Sanadhya, S.; Nath, D.J.; Khandelwal, S.K. Molecular characterization and PCR-based screening of cry genes from Bacillus thuringiensis strains. 3 Biotech 2017, 7, 4. [Google Scholar] [CrossRef] [Scilit]
  39. Kalman, S.; Kiehne, K.L.; Cooper, N.; Reynoso, M.S.; Yamamoto, T. Enhanced production of insecticidal proteins in Bacillus thuringiensis strains carrying an additional crystal protein gene in their chromosomes. Appl. Environ. Microbiol. 1995, 61, 3063–3068. [Google Scholar] [CrossRef] [Scilit]
  40. Shin, B.-S.; Park, S.-H.; Choi, S.-K.; Koo, B.-T.; Lee, S.-T.; Kim, J.-i. Distribution of cryV-type insecticidal protein genes in Bacillus thuringiensis and cloning of cryV-type genes from Bacillus thuringiensis subsp. kurstaki and Bacillus thuringiensis subsp. entomocidus. Appl. Environ. Microbiol. 1995, 61, 2402–2407. [Google Scholar] [CrossRef] [Scilit]
  41. Mesrati, L.A.; Tounsi, S.; Jaoua, S. Characterization of a novel vip3-type gene from Bacillus thuringiensis and evidence of its presence on a large plasmid. FEMS Microbiol. Lett. 2005, 244, 353–358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Amadou, L.; Baoua, I.; Ba, M.N.; Muniappan, R. Development of an optimum diet for mass rearing of the rice moth, Corcyra cephalonica (Lepidoptera: Pyralidae), and production of the parasitoid, Habrobracon hebetor (Hymenoptera: Braconidae), for the control of pearl millet head miner. J. Insect Sci. 2019, 19, 1. [Google Scholar] [CrossRef] [Scilit]
  43. Dey, P.; Goyary, D.; Chattopadhyay, P.; Kishor, S.; Karmakar, S.; Verma, A. Evaluation of larvicidal activity of Piper longum leaf against the dengue vector, Aedes aegypti, malarial vector, Anopheles stephensi and filariasis vector, Culex quinquefasciatus. S. Afr. J. Bot. 2020, 132, 482–490. [Google Scholar]
  44. Abels, J.P.; Ludescher, R.D. Native fluorescence from juvenile stages of common food storage insects. J. Agric. Food Chem. 2003, 51, 544–549. [Google Scholar]
  45. Kauffman, E.; Payne, A.; Franke, M.A.; Schmid, M.A.; Harris, E.; Kramer, L.D. Rearing of Culex spp. and Aedes spp. mosquitoes. Bio-Protoc. 2017, 7, e2542. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Li JuLin, L.J.; Zhu GuoDing, Z.G.; Zhou HuaYun, Z.H.; Tang JianXia, T.J.; Cao Jun, C.J. Experimental observation of toxic effect of Bacillus thuringiensis var. israelensis against Aedes, Culex and Anopheles larvae. Chin. J. Schistosomiasis Control 2014, 26, 67–68. [Google Scholar]
  47. Singh, D.; Mathew, I. Evaluation of acute lethal response of Corcyra cephalonica to Bacillus thuringiensis Berliner var kurstaki, strain ABTS-351 an isolate of strain HD-1. WJARR 2019, 3, 58–61. [Google Scholar]
  48. Saad, A.M.; El-Saadony, M.T.; El-Tahan, A.M.; Sayed, S.; Moustafa, M.A.; Taha, A.E.; Taha, T.F.; Ramadan, M.M. Polyphenolic extracts from pomegranate and watermelon wastes as substrate to fabricate sustainable silver nanoparticles with larvicidal effect against Spodoptera littoralis. Saudi J. Biol. Sci. 2021, 28, 5674–5683. [Google Scholar] [CrossRef] [Scilit]
  49. Caballero, J.; Jiménez-Moreno, N.; Orera, I.; Williams, T.; Fernández, A.B.; Villanueva, M.; Ferré, J.; Caballero, P.; Ancín-Azpilicueta, C. Unraveling the composition of insecticidal crystal proteins in Bacillus thuringiensis: A proteomics approach. Appl. Environ. Microbiol. 2020, 86, e00476-20. [Google Scholar] [CrossRef] [Scilit]
  50. López-Molina, S.; do Nascimento, N.A.; Silva-Filha, M.H.N.L.; Guerrero, A.; Sánchez, J.; Pacheco, S.; Gill, S.S.; Soberón, M.; Bravo, A. In vivo nanoscale analysis of the dynamic synergistic interaction of Bacillus thuringiensis Cry11Aa and Cyt1Aa toxins in Aedes aegypti. PLoS Pathog. 2021, 17, e1009199. [Google Scholar] [CrossRef] [Scilit]
  51. Elleuch, J.; Tounsi, S.; Hassen, N.B.B.; Lacoix, M.N.; Chandre, F.; Jaoua, S.; Zghal, R.Z. Characterisation of novel Bacillus thuringiensis isolates against Aedes aegypti (Diptera: Culicidae) and Ceratitis capitata (Diptera: Tephridae). J. Invertebr. Pathol. 2015, 124, 90–97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Gothandaraman, R.; Venkatasamy, B.; Thangavel, T.; Eswaran, K.; Subbarayalu, M. Molecular characterization and toxicity evaluation of indigenous Bacillus thuringiensis isolates against key lepidopteran insect pests. Egypt. J. Biol. Pest Control 2022, 32, 143. [Google Scholar]
  53. Rashki, M.; Maleki, M.; Torkzadeh-Mahani, M.; Shakeri, S.; Nezhad, P.S. Isolation of Iranian Bacillus thuringiensis strains and characterization of lepidopteran-active cry genes. Egypt. J. Biol. Pest Control 2021, 31, 87. [Google Scholar] [CrossRef] [Scilit]
  54. Castro, B.M.d.C.e.; Martinez, L.C.; Barbosa, S.G.; Serrão, J.E.; Wilcken, C.F.; Soares, M.A.; da Silva, A.A.; de Carvalho, A.G.; Zanuncio, J.C. Toxicity and cytopathology mediated by Bacillus thuringiensis in the midgut of Anticarsia gemmatalis (Lepidoptera: Noctuidae). Sci. Rep. 2019, 9, 6667. [Google Scholar] [CrossRef] [Scilit]
  55. Ma, X.; Hu, J.; Ding, C.; Portieles, R.; Xu, H.; Gao, J.; Du, L.; Gao, X.; Yue, Q.; Zhao, L. New native Bacillus thuringiensis strains induce high insecticidal action against Culex pipiens pallens larvae and adults. BMC Microbiol. 2023, 23, 100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Lai, L.; Villanueva, M.; Muruzabal-Galarza, A.; Fernández, A.B.; Unzue, A.; Toledo-Arana, A.; Caballero, P.; Caballero, C.J. Bacillus thuringiensis Cyt proteins as enablers of activity of Cry and Tpp toxins against Aedes albopictus. Toxins 2023, 15, 211. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  57. Azzouz, H.; Kebaili-Ghribi, J.; ben Farhat-Touzri, D.; Daoud, F.; Fakhfakh, I.; Tounsi, S.; Jaoua, S. Selection and characterisation of an HD1-like Bacillus thuringiensis isolate with a high insecticidal activity against Spodoptera littoralis (Lepidoptera: Noctuidae). Pest Manag. Sci. 2014, 70, 1192–1201. [Google Scholar] [CrossRef] [Scilit]
  58. Temeyer, K.B. Larvicidal activity of Bacillus thuringiensis subsp. israelensis in the dipteran Haematobia irritans. Appl. Environ. Microbiol. 1984, 47, 952–955. [Google Scholar] [CrossRef] [Scilit]
  59. Bravo, A.; Gill, S.S.; Soberón, M. Mode of action of Bacillus thuringiensis Cry and Cyt toxins and their potential for insect control. Toxicon 2007, 49, 423–435. [Google Scholar] [CrossRef] [Scilit]
  60. Arsov, A.; Gerginova, M.; Paunova-Krasteva, T.; Petrov, K.; Petrova, P. Multiple cry genes in Bacillus thuringiensis strain BTG suggest a broad-spectrum insecticidal activity. Int. J. Mol. Sci. 2023, 24, 11137. [Google Scholar] [CrossRef] [Scilit]
  61. Rangeshwaran, R.; Velavan, V.; Kumar, S.; Apoorva, V.; Venugopala, K.; Shylesha, A.; Sivakumar, G. Diversity of cry genes occurring in the North East. J. Biol. Control. 2019, 33, 242–252. [Google Scholar] [CrossRef] [Scilit]
  62. van Frankenhuyzen, K. Specificity and cross-order activity of Bacillus thuringiensis pesticidal proteins. In Bacillus thuringiensis and Lysinibacillus sphaericus: Characterization and Use in the Field of Biocontrol; Springer: Berlin/Heidelberg, Germany, 2017; pp. 127–172. [Google Scholar]
  63. Mahadeva Swamy, H.; Asokan, R.; Mahmood, R.; Nagesha, S. Molecular characterization and genetic diversity of insecticidal crystal protein genes in native Bacillus thuringiensis isolates. Curr. Microbiol. 2013, 66, 323–330. [Google Scholar] [PubMed]
Figure 1. Crystal morphology of QBT strains (QBT552, QBT862, and QBT605) under SEM at 10,000× and 25,000× magnification. The red arrow shows the bipyramidal and cuboid-shaped crystal (A), spherical smooth crystal (B), and spherical rough crystal (C), while the yellow arrows refer to the spores.
Figure 1. Crystal morphology of QBT strains (QBT552, QBT862, and QBT605) under SEM at 10,000× and 25,000× magnification. The red arrow shows the bipyramidal and cuboid-shaped crystal (A), spherical smooth crystal (B), and spherical rough crystal (C), while the yellow arrows refer to the spores.
Microbiolres 17 00014 g001
Figure 2. Exploration of cry1A, cry2A, cry5A, and vip genes by PCR using different primers as mentioned in Table 1. (A), cry1A; (B), cry2A; (C), cry5A; (D), vip3A; (E), vip3A full Open reading frame. Lane markers and expected amplicon sizes are provided in the figure: L, Ladder 1kb-plus (20,000, 10,000, 7000, 5000, 4000, 3000, 2000, 1500, 1000, 700, 500, 400, 300, 200, 75 bp); 1, Negative control; 2, HD1; 3, QBT542; 4, QBT552; 5, QBT830; 6, QBT877.
Figure 2. Exploration of cry1A, cry2A, cry5A, and vip genes by PCR using different primers as mentioned in Table 1. (A), cry1A; (B), cry2A; (C), cry5A; (D), vip3A; (E), vip3A full Open reading frame. Lane markers and expected amplicon sizes are provided in the figure: L, Ladder 1kb-plus (20,000, 10,000, 7000, 5000, 4000, 3000, 2000, 1500, 1000, 700, 500, 400, 300, 200, 75 bp); 1, Negative control; 2, HD1; 3, QBT542; 4, QBT552; 5, QBT830; 6, QBT877.
Microbiolres 17 00014 g002
Figure 3. Exploration of cry4B and cyt1A genes by PCR using different primers as mentioned in Table 1. (A), cyt1A; (B), cry4B; (C), cry4A/4B. Lane markers and expected amplicon sizes are provided in the figure: L, Ladder 1 kb-plus (20,000, 10,000, 7000, 5000, 4000, 3000, 2000, 1500, 1000, 700, 500, 400, 300, 200, 75 bp); 1, Negative control; 2, H14; 3, QBT550; 4, QBT605; 5, QBT758; 6, QBT862.
Figure 3. Exploration of cry4B and cyt1A genes by PCR using different primers as mentioned in Table 1. (A), cyt1A; (B), cry4B; (C), cry4A/4B. Lane markers and expected amplicon sizes are provided in the figure: L, Ladder 1 kb-plus (20,000, 10,000, 7000, 5000, 4000, 3000, 2000, 1500, 1000, 700, 500, 400, 300, 200, 75 bp); 1, Negative control; 2, H14; 3, QBT550; 4, QBT605; 5, QBT758; 6, QBT862.
Microbiolres 17 00014 g003
Figure 4. LC50 determination of δ-endotoxins of QBT552 for Corcyra cephalonica (A) and QBT862 for Culex pipiens (B). The blue dots represent the actual mortality percentages at each concentration with variability (±error) in the observed mortality data. The red dashed line represents the dose–response relationship represented by the Probit regression. The green dotted horizontal line shows the 50% mortality threshold. The orange dot highlights the estimated LC50 value for each strain: (A) QBT552 = 25 µg/g (95% CI: 14.69–28.50 µg/g, χ2 = 21.40, df = 3, p = 0.00009) and (B) QBT862 = 2 µg/L (95% CI: 0.90–2.67 µg/L, χ2 = 18.93, df = 3, p = 0.00028).
Figure 4. LC50 determination of δ-endotoxins of QBT552 for Corcyra cephalonica (A) and QBT862 for Culex pipiens (B). The blue dots represent the actual mortality percentages at each concentration with variability (±error) in the observed mortality data. The red dashed line represents the dose–response relationship represented by the Probit regression. The green dotted horizontal line shows the 50% mortality threshold. The orange dot highlights the estimated LC50 value for each strain: (A) QBT552 = 25 µg/g (95% CI: 14.69–28.50 µg/g, χ2 = 21.40, df = 3, p = 0.00009) and (B) QBT862 = 2 µg/L (95% CI: 0.90–2.67 µg/L, χ2 = 18.93, df = 3, p = 0.00028).
Microbiolres 17 00014 g004
Figure 5. Morphological changes of Corcyra cephalonica 3rd instar larvae following exposure to δ-endotoxin of QBT strains. (A) Positive control: larva exposed to the reference strain HD1, showing a distinct blackened appearance. (B) Negative control: untreated larva with typical dark yellowish coloration. (C,D) Treated larvae showed similar blackened discoloration post-exposure, indicating toxin-induced mortality and characteristic post-mortem changes compared to the healthy appearance of the negative control.
Figure 5. Morphological changes of Corcyra cephalonica 3rd instar larvae following exposure to δ-endotoxin of QBT strains. (A) Positive control: larva exposed to the reference strain HD1, showing a distinct blackened appearance. (B) Negative control: untreated larva with typical dark yellowish coloration. (C,D) Treated larvae showed similar blackened discoloration post-exposure, indicating toxin-induced mortality and characteristic post-mortem changes compared to the healthy appearance of the negative control.
Microbiolres 17 00014 g005
Figure 6. Morphological changes in Culex pipiens 3rd instar larvae midgut following exposure to δ-endotoxins QBT strains. (A) Positive control: larva treated with the reference strain H14, showing clear midgut damage. (B) Negative control: untreated larva with healthy, intact midgut epithelium. (C,D) Larvae treated with δ-endotoxins from QBT strains, exhibiting notable midgut epithelial alterations, including swelling, vacuolization, and tissue disruption, in contrast to the structure observed in the negative control.
Figure 6. Morphological changes in Culex pipiens 3rd instar larvae midgut following exposure to δ-endotoxins QBT strains. (A) Positive control: larva treated with the reference strain H14, showing clear midgut damage. (B) Negative control: untreated larva with healthy, intact midgut epithelium. (C,D) Larvae treated with δ-endotoxins from QBT strains, exhibiting notable midgut epithelial alterations, including swelling, vacuolization, and tissue disruption, in contrast to the structure observed in the negative control.
Microbiolres 17 00014 g006
Table 1. Primer pairs and sequences for PCR amplification of target genes in Bt strains.
Table 1. Primer pairs and sequences for PCR amplification of target genes in Bt strains.
GenePrimerSequencesbpReferences
cry4BDip1ACAAGCCGCAAATCTTGTGGA800[37]
Dip1BATGGCTTGTTTCGCTACATC
cry4A/4BDip2AGGTGCTTCCTATTCTTTGG1293[37]
Dip2BTGACCAGGTCCCTTGATTAC
cyt1ACyt1A1AACCCCTCAATCAACAGCAAGG521[38]
Cyt1A2GGTACACAATACATAACGCCACC
cry2ACry2AACTATTTGTGATGCGTATAATGTA570[39]
Cry2BAATTCCCCATTCATCTGC
cry5ACry5AATGAAACTAAAGAATCAAGA726[40]
Cry5BACCTGTGCTATACCATTTCA
cry1ALep2ACCGAGAAAGTCAAACATGCG986[37]
Lep2BTACATGCCCTTTCACGTTCC
vip3AVip1ATGAACAAGAATAATACTA419[41]
Vip2TCTATTTGCAGACTTAGCGC
vip3AVip1ATGAACAAGAATAATACTA2370[41]
Vip3TTACTTAATAGAGACATCGT
Table 2. Quantitative analysis of δ-endotoxin production for the QBT strains.
Table 2. Quantitative analysis of δ-endotoxin production for the QBT strains.
Crystal TypeStrainProtein Concentration (µg/mL)CFU
(cell/mL) 108
δ-Endotoxins per Cell (µg/cell) 10−6
BipyramidalHD11052.0 ± 11.85.60 ± 0.741.88 ± 0.27
QBT542605.1 ± 5.92.43 ± 0.292.49 ± 0.32
QBT5521188.7 ± 5.04.67 ± 0.462.55 ± 0.26
QBT8301149.1 ± 2.64.80 ± 0.712.39 ± 0.36
QBT8771334.4 ± 6.76.47 ± 0.852.06 ± 0.28
SphericalH14695.1 ± 8.410.2 ± 4.76.79 ± 3.2
QBT550889.7 ± 4.78.03 ± 0.911.1 ± 1.3
QBT605706.8 ± 11.57.33 ± 0.59.64 ± 0.8
QBT758577.5 ± 8.412.0 ± 2.34.81 ± 1.0
QBT862567.6 ± 8.48.93 ± 0.96.35 ± 0.7
The table presents data including crystal protein concentration (µg/mL), viable spore-forming cell count (CFU/mL × 108), and estimated δ-endotoxin yield per cell (µg/cell × 10−6) after sporulation.
Table 3. Insecticidal activity and insecticidal gene profiles of the QBT strains against Corcyra cephalonica and Culex pipiens larvae.
Table 3. Insecticidal activity and insecticidal gene profiles of the QBT strains against Corcyra cephalonica and Culex pipiens larvae.
StrainTarget InsectMortality (%)cry1Acry2Acry5Avip3Acry4Bcyt1A
HD1C. cephalonica90* ++++
QBT542C. cephalonica90++++
QBT552C. cephalonica100++++
QBT830C. cephalonica90++++
QBT877C. cephalonica100++++
H14C. pipiens50++
QBT758C. pipiens47++
QBT862C. pipiens70++
QBT550C. pipiensNA
QBT605C. pipiensNA
The table summarizes larval mortality rates from bioassays and PCR-based detection of major insecticidal genes (cry1A, cry2A, cry5A, vip3A, cry4B, and cyt1A). * Gene presence is indicated by “+”, absence by “–”, while “NA” indicates that no bioassay was performed for the respective strain.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Badr, K.; Al-Maadeed, F.; Azouz, A.; Hassan, Z.U.; Migheli, Q.; Jaoua, S. Exploring Arid Soils as a Source of Bacillus thuringiensis Biocontrol Agents Active Against Dipteran and Lepidopteran Larvae. Microbiol. Res. 2026, 17, 14. https://doi.org/10.3390/microbiolres17010014

AMA Style

Badr K, Al-Maadeed F, Azouz A, Hassan ZU, Migheli Q, Jaoua S. Exploring Arid Soils as a Source of Bacillus thuringiensis Biocontrol Agents Active Against Dipteran and Lepidopteran Larvae. Microbiology Research. 2026; 17(1):14. https://doi.org/10.3390/microbiolres17010014

Chicago/Turabian Style

Badr, Kareem, Fatima Al-Maadeed, Alaa Azouz, Zahoor Ul Hassan, Quirico Migheli, and Samir Jaoua. 2026. "Exploring Arid Soils as a Source of Bacillus thuringiensis Biocontrol Agents Active Against Dipteran and Lepidopteran Larvae" Microbiology Research 17, no. 1: 14. https://doi.org/10.3390/microbiolres17010014

APA Style

Badr, K., Al-Maadeed, F., Azouz, A., Hassan, Z. U., Migheli, Q., & Jaoua, S. (2026). Exploring Arid Soils as a Source of Bacillus thuringiensis Biocontrol Agents Active Against Dipteran and Lepidopteran Larvae. Microbiology Research, 17(1), 14. https://doi.org/10.3390/microbiolres17010014

Article Metrics

Back to TopTop