Next Article in Journal
Diode Laser and Red-Laser Photodynamic Therapy with Toluidine Blue Gel for the Treatment of Onychomycosis: A Case Series
Previous Article in Journal
Hydroethanolic Extract of Punica granatum Inhibits Cryptococcus by Depolarising Mitochondrial Membranes
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microbiology Research
Volume 16
Issue 2
10.3390/microbiolres16020050
microbiolres-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Siderophore Production, Diversity of Siderophore Receptors and Associations with Virulence-Associated Genes, Phylogroups and Bacteriocin Production in Escherichia coli Strains Isolated from Humans, Animals and Organic Fertilizers

by
Marina V. Kuznetsova
1,2,
Veronika S. Mihailovskaya
1,
Polina A. Selivanova
1,
Darja A. Kochergina
1,
Natalia B. Remezovskaya
1 and
Marjanca Starčič Erjavec
3,4,*
1
Laboratory of Molecular Biotechnology, Institute of Ecology and Genetics of Microorganisms Ural Branch Russian Academy of Sciences, Perm Federal Research Centre of Ural Branch of RAS, 614081 Perm, Russia
2
Department of Microbiology and Virology, Perm State Medical University Named After Academician E. A. Wagner, 614000 Perm, Russia
3
Department of Microbiology, Biotechnical Faculty, University of Ljubljana, 1000 Ljubljana, Slovenia
4
Department of Biology, Faculty of Natural Sciences and Mathematics, University of Maribor, 2000 Maribor, Slovenia
*
Author to whom correspondence should be addressed.
Microbiol. Res. 2025, 16(2), 50; https://doi.org/10.3390/microbiolres16020050
Submission received: 30 December 2024 / Revised: 6 February 2025 / Accepted: 11 February 2025 / Published: 17 February 2025
Browse Figures
Versions Notes

Abstract

:
Iron uptake plays an important role in the persistence of Escherichia coli in the host and for its survival in the environment, and it is known that E. coli has a variety of siderophore systems for iron uptake. We investigated the ability to produce siderophores, the genetic diversity of the siderophores and their correlation with virulence-associated genes (VAGs), phylogroups and bacteriocin production in E. coli strains isolated from different sources: uropathogenic E. coli (UPEC) from urine of patients with urinary tract infections, avian pathogenic E. coli (APEC) from organs of birds with signs of colibacillosis, fecal E. coli (FEC) from feces of healthy cattle and E. coli from organic fertilizers based on poultry and cattle manure (OFEC). A high variability in siderophore production was found among the UPEC strains studied, while the OFEC strains showed the highest siderophore production among all groups. Genes for aerobactin and yersiniabactin receptors were most frequently found in the UPEC strain, followed by the APEC, FEC and OFEC strains. The greatest diversity of siderophore receptors was found in the APEC strain. We also found that iutA-positive E. coli isolated from animals contained more VAGs than iutA-negative strains. The profiles of the siderophore genes of APEC and OFEC from poultry manure were very similar, indicating that APEC can be transmitted via organic fertilizers, suggesting that poultry manure is an environmental risk. The data obtained complement the information on the prevalence of siderophore producers and contribute to our knowledge on the biodiversity of E. coli pathotypes.

1. Introduction

Iron is one of the most important elements for microorganisms and is a limiting factor for the colonization and persistence of bacteria [1]. Iron is involved in various redox reactions, is a cofactor for many enzymes and is required by bacteria for growth, division and energy production [2,3]. Since iron in the natural environment is present in a poorly accessible, bound form, several Gram-negative and Gram-positive bacteria synthesize low-molecular-weight, high-affinity chelating molecules called siderophores to uptake iron [4,5]. Siderophores deliver iron into cells via specific surface protein receptors and various membrane transport systems [6]. The affinity of siderophores for iron is very high, which enables them to take up iron from molecules such as ferritin, transferrin, and lactoferrin [7,8]. In addition, many pathogenic bacteria can directly utilize iron-containing compounds of the host via specific receptors [9,10] and take up aqueous ferrous iron (Fe2+) [11]. It is known that Escherichia coli can produce several types of siderophores [12]. Most commensal and pathogenic E. coli produce the catecholate siderophore—enterobactin—while a smaller proportion of isolates can synthesize other siderophores—aerobactin, salmochelin and yersiniabactin [13,14,15]. Enterobactin has the highest binding constant to Fe3+ (dissociation constant [Kd] = 10−52 M), and the binding affinity of yersiniabactin (Kd = 10−36 M) is higher than that of aerobactin (Kd = 10−23 M) [16]. The production of different types of siderophores may provide E. coli with advantages for survival in different biotopes.
On the other hand, siderophores are not only iron carriers but are an important element of interaction with the host in all stages of infection [15]. For example, bacteria possessing conjugates of siderophores containing polypeptide antibiotics attached to enterobactin via a glucose linker, i.e., siderophores–microcins [17,18], have a selective advantage in the colon. The production of reactive oxygen species by polymorphonuclear leukocytes, monocytes and macrophages is blocked by yersiniabactin, as it reduces the availability of iron to immune effector cells [19]. Strains that produce combinations of siderophores, as well as overproducing strains, are reported to be hypervirulent, while strains that are unable to secrete siderophores or have a low production are considered less virulent, as they have a lower adaptability during colonization [20,21]. The introduction of siderophore biosynthesis genes has been shown to make non-virulent strains virulent [15].
It is worth noting that the role of siderophores in the pathogenesis of uropathogenic E. coli (UPEC) in urinary tract infections (UTIs) has been extensively studied [15,22,23]. Siderophore production has been shown to be necessary for the manifestation of avian pathogenic E. coli (APEC) virulence in a chicken infection model [13]. The production of siderophores allows the bacteria to persist in the intestinal niche, adapt to a low-iron environment and evade the host’s defense system. Therefore, siderophores are recognized as important virulence factors. At the same time, siderophores are present in commensal E. coli, which enables the latter to achieve better fitness in the host. Moreover, the production of siderophores is associated with some probiotic E. coli (e.g., E. coli Nissle 1917 encodes three types of siderophores) [24]. These facts emphasize the need to re-evaluate the role of siderophores in the overall ecology of E. coli. The question remains as to the prevalence and extent of production of different types of siderophores among commensal and pathogenic, intestinal and extra-intestinal strains isolated from different sources: humans, animals and the environment. New data are needed on the associations of siderophores with virulence-associated genes that determine the emergence of hypervirulent strains in hospitals and agriculture.
In this study, we investigated the ability of E. coli strains of different sources to produce siderophores, the genetic diversity of the siderophores and their correlation with virulence-associated genes (VAGs), phylogroups and bacteriocins.

2. Materials and Methods

2.1. Bacterial Strains

In this study, we used previously collected non-clonal uropathogenic E. coli (UPEC) strains (n = 26) isolated from the urine of patients diagnosed with symptomatic urinary tract infections (UTIs) at the Urban Clinical Hospital in Perm (Russia) in 2015–2017 [25]; avian pathogenic E. coli (APEC) strains (n = 28) isolated from different organs of broiler chickens with colibacillosis at farm enterprises and private farms in Perm Krai (Russia) in 2016–2018 [26]; fecal E. coli (FEC) strains (n = 49) isolated from fecal samples of healthy dairy cattle in 2019–2021 [27] and recently isolated E. coli from organic fertilizers based on poultry and cattle manure (OFEC): n = 19 strains isolated from organic fertilizers based on poultry manure (avian OFEC) and n = 35 strains from organic fertilizers based on cattle manure (cattle OFEC) in 2022–2024 (this study). To verify that the strains belonged to the species E. coli, a specific fragment of the beta-glucuronidase gene was detected by PCR using the uidA-F/uidA-R primers according to [28].

2.2. Iron Uptake Test

Siderophore production was tested in CAS-agar as previously described [29]. Bacterial colonies were grown on chrome azurol S (CAS) plates for 48 h at 37 °C with glucose as a carbon source. Colonies of siderophore-producing bacteria grown on this medium are surrounded by a yellow or orange halo. The semi-quantitative determination of iron uptake was carried out by calculating the coefficient (K), which was defined as the ratio of the diameter (in mm) of the yellow–orange zone on the agar plate to the diameter of the bacterial colony.

2.3. DNA Extraction

The boiling method was used for DNA extraction. A loop of bacterial biomass was resuspended into 100 μL of ultrapure water, heated for 15 min at 97 °C in a solid-state thermostat with a timer TT-2 “Termite” (Russia) and centrifuged for 5 min at 13,000 rpm. The supernatants were transferred to fresh Eppendorf tubes and stored at –20 °C until usage.

2.4. Detection of Genes Encoding Siderophore Receptors and Microcins

Polymerase chain reaction (PCR) with specific primer pairs (LLC. “Sintol”, Moscow, Russia) was used to detect the presence of 4 siderophore genes and 2 microcins genes: fepA—enterobactin receptor gene; fyuA—yersiniabactin receptor gene; iroN—salmochelin receptor gene; iutA—aerobactin receptor gene and mccH47 and mccM—genes of microcins H47 and M, respectively (Table 1). The PCR programs were used as reported in the literature [30,31,32,33]. Amplifications were carried out in 25 μL PCR mixtures containing 3 μL of DNA template, 0.4 μL of 5 U/mL Taq-polymerase, 2.5 μL of 10× PCR buffer, 2.5 μL of 25 μM MgCl2, 0.25 μL of 25 μM dNTPs and 2.5 μL of 10 µM forward and reverse primers (LLC “Sintol”, Russia) in a DNA Engine Dyad Thermal Cycler (“Bio-Rad”, Foster City, CA, USA). Band visualization and data documentation were performed with a Gel-DocXR gel documentation system (“Bio-Rad”, Foster City, CA, USA).

2.5. Detection of Virulence-Associated Genes and Phylogroups

PCR with specific primer pairs (LLC “Sintol”, Moscow, Russia) was used to detect the presence of toxin-encoding genes (cnf1, east1, ehxA, estI, estII, eltA, hlyA, hlyF, stx1 and stx2), adhesin-encoding genes (fimH, papC, sfaDE, afa/draBC and iha), protectin-encoding genes (ompT, kpsMTII and iss) and UPEC-specific protein gene (usp). Phylogroups were determined by quadruplex PCR, as reported by Clermont et al. (2013) [34]. The used primers and PCR programs [30,31,32,33,34,35,36,37,38,39,40,41,42,43] are listed in Supplementary Table S1.

2.6. Bacteriocin Production

Screening of strains for bacteriocin production was performed in triplicate using the “overlay test” method with the indicator strain E. coli DH5α [44]. In short, LB plates (LB agar; Amresco, Solon, OH, USA) were stab-inoculated with the tested strains and incubated overnight at 37 °C. The next day, the cells on the LB plates were lysed with chloroform vapor for 15 min and then exposed to air for 15 min to remove residual chloroform vapor. Finally, the plates were overlaid with soft agar containing the indicator strain and incubated overnight at 37 °C. Next day, the plates were then examined for lysis zones around the stab-inoculated colonies. For the strains in which the mccH47 and mccM microcin genes were detected by PCR, we repeated the test as described above but without chloroform.

2.7. Statistical Analysis

Statistical analysis was performed using Student’s t-test or Fisher’s exact test to compare qualitative characteristics. Spearman’s rank correlation test was used to evaluate the correlation between phenotypic and genotypic characteristics. A p-value of less than 0.05 was considered significant. Statistical analysis was performed using Excel. The GraphPad Prism 8 software package Version 8.0.1 (GraphPad Software, Boston, MA, USA) was used for plotting graphs.

3. Results

3.1. Comparison of Siderophore Production and Diversity in E. coli Populations

3.1.1. Siderophore Production

In general, siderophore production was detected in 89.8% (141/157) of the E. coli strains studied. Among APEC and avian OFEC, all strains were able to form yellow or orange halos on CAS agar (Figure 1a). On CAS agar, 11 UPEC, 2 cattle FEC and 3 cattle OFEC strains did not grow. Among all the strains grown, the highest K value was 2.7 (UPEC strain R57), and the lowest was 1.2 (APEC strain 14/16). The strains isolated from different sources differed in the level of siderophore production. The UPEC strains were characterized by a high variability in siderophore production. The avian and cattle OFEC strains had higher K values than APEC or FEC strains (p < 0.05, t-test) (Figure 1b). Thus, in the avian OFEC group, 31.6% of the strains had a K value of 2.0 or more, while only 7.1% of the APEC strains had such a K value.

3.1.2. Distribution of Genes Encoding Siderophore Receptors

The fepA, iroN, fyuA and iutA genes were detected in 95.5% (150/157), 32.5% (51/157), 35.0% (55/157) and 31.8% (50/157) of all E. coli strains studied, respectively. In all groups, the fepA gene encoding the enterobactin receptor was found in most strains (Table 2). The iroN gene encoding the salmochelin receptor was more often found in the APEC and avian OFEC strains. The aerobactin receptor gene, iutA, and the yersiniabactin receptor gene, fyuA, were more common among the UPEC strains. The iutA gene was also common (about 40%) among the APEC and avian OFEC strains.
A total of 40.8% (64/157) of the strains harbored one siderophore receptor gene, 26.8% (42/157) harbored two, 19.1% (30/157) harbored three and 10.8% (17/157) harbored four siderophore receptor genes. In four E. coli strains, no siderophore receptor gene was found. The cattle FEC and cattle OFEC strains were more likely to have only one siderophore receptor gene (53.1% and 71.4%, respectively), while the UPEC, APEC and avian OFEC strains contained three or more receptor genes (57.7%, 39.3% and 47.4%, respectively) (Figure 2a). It should be noted that the greatest diversity of siderophore receptor genes was found among the APEC strains, while the cattle FEC strains had the lowest diversity of siderophore receptor genes (Figure 2b).

3.1.3. Correlations Between Siderophore Production and Siderophore Receptor Gene Presence

We did not find any significant correlation between the number of siderophore receptor genes and the level of siderophore production, as determined by the K coefficient (rs = 0.15). Strains harboring only one siderophore receptor gene and strains containing all four genes were found to have similar K coefficients. When evaluating the association between the number of siderophore receptor genes detected and the coefficient of production on CAS agar within the E. coli groups studied, we did not find a strong relationship: Pearson’s correlation coefficient was <0.2 (weak relationship) for UPEC, APEC and avian OFEC, and it reached 0.48 and 0.37 (medium-density relationship) for cattle FEC and cattle OFEC, respectively.

3.2. Association Between Siderophores and Virulence-Associated Genes

3.2.1. Association with VAGs

The Pearson correlation coefficient between the number of VAGs and the number of siderophore receptor genes was 0.56. fyuA-positive strains carried significantly more VAGs among UPEC (p < 0.01) and cattle FEC (p < 0.02) than fyuA-negative strains. Among E. coli from animals, iutA-positive strains contained more VAGs than iutA-negative strains (p < 0.05, t-test) (Figure 3a). The correlation analysis revealed a positive association between the presence of iutA and hlyF (rs = 0.58) and ompT (rs = 0.70) in the avian OFEC group and the gene encoding the increased serum survival factor (iss) within the cattle FEC (rs = 0.56) (Figure 3b). The fepA gene was found to be associated with iha (rs = 0.60), kpsMTII (rs = 0.74), and est2 (rs = 0.74) in the APEC group. Among the UPEC strains, iroN was found to be associated with ompT (rs = 0.70), cnf1 (rs = 0.66) and hlyA (rs = 0.53). Thus, several associations of siderophore receptor genes and virulence-associated genes were found.

3.2.2. Association with Phylogroups

Strains belonging to the B2 phylogroup harbored more siderophore receptor genes than strains of other phylogroups (p < 0.01, t-test). The prevalence of strains containing the chuA heme receptor gene (characteristic for phylogroups B2, D, E and F) was 69.2% in the UPEC group, 53.6% in APEC, 55.1% in cattle FEC, 47.4% in avian OFEC and 45.7% in cattle OFEC. We found no significant correlations between the presence of chuA and the number of VAGs.

3.2.3. Association with Bacteriocin Production

Bacteriocin producers were more common among the APEC and avian OFEC strains (Table 3). In total, bacteriocin-producing strains more often contained three or more siderophore receptor genes than non-bacteriocin-producing strains (41.7 vs. 24.7%, p = 0.033, Fisher’s exact test). The prevalence of the microcin H47 and M genes was low in all E. coli groups. Among the strains isolated from organic fertilizers, these microcin genes were found in the avian OFEC group but not in cattle OFEC. Among the APEC strains, only one strain (3.6%) possessed the microcin H47 gene, while the microcin M gene was not detected in this group.

4. Discussion

The production of siderophores gives bacteria an advantage in surviving in iron-deficient biotopes and is also crucial in all stages of infection, and it is known that E. coli can produce more than one type of siderophores. Spurbeck et al. (2012) reported that human intestinal isolates encoding four siderophore iron uptake systems expressed them during exponential growth in human urine and colonized the bladder in greater numbers in a mouse model of ascending UTI than human commensal strains that did not encode four such systems [45]. It is also known that the frequency of production of different siderophores is higher among UPEC than among diarrheagenic E. coli isolates [46]. Interestingly, siderophores have also been found among non-pathogenic E. coli, indicating their role in the ecology of E. coli in the context of adaptation to symbiotic interactions with the host and also to the environment. However, the genes responsible for the production and receptors of aerobactin, yersiniabactin and salmochelin are more prevalent among pathogenic than non-pathogenic strains, so these three siderophores are considered virulence factors. The salmochelin siderophore receptor, IroN, may play a dual role in the development of UTIs as a receptor for iron uptake and as an internalization factor [47]. These facts emphasize the need to re-evaluate the role of siderophores in the overall ecology of E. coli. In this context, in our study, we investigated siderophore production in E. coli isolated from different sources, the prevalence of siderophore receptor genes and their association with VAGs, phylogroup and bacteriocins.
In our study, siderophore production on CAS agar was detected in 89.8% (141/157) of the E. coli strains. A total of 16 (10.2%) strains did not grow on CAS agar, possibly due to the high concentration of metal ions that could be toxic to these strains. The majority of the strains that did not grow on CAS agar were clinical UPEC strains—68.75% (11 out of 16). Further, the level of the strains’ siderophore production was estimated by the efficiency coefficient K. The highest value of coefficient K obtained was 2.7, and the lowest was 1.2. The avian OFEC strains and cattle OFEC had higher K values than the APEC or cattle FEC strains. The UPEC strains were characterized by a high variability in siderophore production. In the study by Kumar et al. (2021), conducted on 534 E. coli isolates (302 intestinal E. coli from human diarrhea and 232 extraintestinal E. coli from human urinary tract infections), siderophores were detected in 45.1% of all isolates when grown on CAS agar, while among the extraintestinal pathogenic E. coli in their study, 56.5% of the strains produced siderophores [46]. In the study by Khazaal (2022), the percentage of siderophore producers among clinical E. coli strains was high: 71.9% of the E. coli produced siderophores, while nine (28.1%) strains did not produce siderophores [48]. Searle et al. (2015) investigated plant-associated E. coli strains and fecal isolates from the feces of healthy mammals and reported that the coefficient K was between 3.1 and 1.2 and that the strains of both groups differed in siderophore production, as plant-associated strains produced significantly fewer siderophores than fecal isolates on CAS agar medium and had a significantly lower prevalence of genes associated with siderophore production [30].
Khasheii et al. (2016) reported that in UPEC, the genes iucA (aerobactin), iroN (salmochelin) and irp2 (yersiniabactin) were found among 17.1%, 30.8% and 68.2% of isolates, respectively [49], while Karimian A. (2012) reported that iucA, iroN and irp2 were found in 10.6%, 42.3% and 11.4% of UPEC isolates studied, respectively [50]. Al-Zerfi et al. reported that among E. coli strains isolated from outpatients with cystitis, the irp2 gene was detected among 57.7% of isolates, while iucA was not detected at all [51]. In their study on UPEC, Nateghi et al. (2010) reported a prevalence of the irp2 gene of 33%, while iucN was not detected [52]. A recent Russian study examined 194 E. coli strains isolated from the urine of patients with uncomplicated UTIs, and it found the aerobactin receptor gene iutA in 83.0% of strains and the yersiniabactin receptor gene fyuA in 85.6% of strains [53]. In our study, aerobactin (iutA), salmochelin (iroN) and yersiniabactin (fyuA) receptor genes were detected in 61.5%, 21.3% and 69.2% of the UPEC strains, respectively. In our study, the iutA gene was more prevalent among strains with high levels of siderophore production (p < 0.01, Fisher’s exact test). When assessing the association between the number of siderophores detected and the coefficient of CAS agar production within the groups, we found a weak correlation: the Pearson correlation coefficient ranged from 0.2 to 0.48. The differences in the observed prevalences of these genes among UPEC were probably due to the genetic diversity of the isolates associated with different geographical regions.
It should be also noted that the aerobactin and salmochelin receptor genes were present with a high prevalence in APEC and that a quarter of the strains in this group had both the aerobactin and salmochelin receptor genes. This is not surprising, as these genes are known to be associated with the APEC pathotype [38]. In addition to aerobactin and enterobactin, the APEC strains also contained the fyuA (yersiniabactin) gene [54]. Ons et al. (2007) reported that the prevalence of fepA (enterobactin receptor gene), iroN, iutA and fyuA in APEC was 100%, 92.5%, 87.4% and 53.1%, respectively, which is significantly higher than the results obtained by us [55]. Dozois et al. (2003) and Caza et al. (2008) indicated that the aerobactin and salmochelin iron uptake systems are pathogen-associated iron-binding systems [13,56]. The iroN and iutA genes play an important role in the persistence and occurrence of lesions in chickens, and they function together, increasing the supply of iron by bacteria persistent in internal organs. Accordingly, the greatest diversity of siderophore receptor gene combinations was found among the UPEC and APEC strains in our study, although the prevalence of some siderophore receptors was lower than in a number of other studies. It should be noted that the siderophore profiles of APEC and avian OFEC were very similar in our study, which may indicate that APEC can be transmitted via organic fertilizers, which, in turn, implies that poultry manure poses an environmental risk.
In addition to the siderophore genes, all the strains tested in our study possessed at least one VAG. Apostolakos et al. (2021) reported that the siderophore receptor genes iutA and iroN were associated with VAGs of extraintestinal pathogenic E. coli (ExPEC), APEC and UPEC [57]. We also found that among the animal E. coli strains, the iutA-positive strains contained more VAGs than the iutA-negative strains. The association of iutA with ompT, hlyF and cnf1 was detected in UPEC, which could be due to the presence of different pathogenicity islands (PAIs) [58,59]. In the iroN-positive cattle FEC, avian OFEC and cattle OFEC strains, more VAGs were present. In addition, in APEC, a positive association was found between the presence of iutA and the VAGs hlyF and ompT, whereas fepA was often found in association with iha and kpsMTII. The associations found are expected, as in APEC, iron uptake genes are usually found on virulence plasmids (e.g., ColV, ColBM) carrying VAGs [54]. In addition, APEC, similar to UPEC, might have ExPEC pathogenicity islands (PAIs). In cattle FEC, the iutA-, iroN- and fyuA-positive strains had more VAGs than strains lacking siderophore genes. It is expected that strains possessing siderophore genes and other VAGs may be more virulent.
Previous epidemiologic studies have shown that the siderophore receptor genes iutA, iroN and fyuA may be associated with strains belonging to specific phylogroups. For example, Rezatofighi et al. (2021) reported that the siderophore genes fyuA and iutA are more frequently found in phylogroup B2 than in other phylogroups [60]. The aerobactin gene iutD has been reported to be highly distributed among multidrug-resistant UPEC and extensively drug-resistant UPEC of phylogroups B2 and D [61]. Moreover, in our study, phylogroup B2 strains carried more siderophore receptor genes than strains of other phylogroups. The heme receptor chuA gene is one of the determinants used to define the phylogroups of E. coli, as it is present in phylogroups B2, D, E and F [34]. In the study by Ons et al. (2007), the outer membrane heme receptor protein chuA was found among APEC at 41.8%, whereas in our study, the value was 53.6%, which correlates well with the prevalence of chuA-positive (E, D, B2, F) phylogroups [55]. In our study, the prevalence of strains containing the chuA heme receptor gene was the highest among the UPEC strains at 69.2%, but a high prevalence (over 45%) was also found in other E. coli groups studied. Thus, the mechanism of heme scavenging involving outer-membrane proteins appears to be widespread among E. coli from various sources.
The ability to produce bacteriocins (bacteriocinogenicity) is a common feature, and more than half of the E. coli strains isolated from fecal microbiota of humans and animals produce at least one bacteriocin [33,62,63]. Bacteriocin-producing strains possessing multiple siderophore systems may also have an advantage in the densely colonized environment of the gut, where these antimicrobial peptides are key factors for bacterial competition and provide a strong selection advantage in the colonic niche [64]. The proportion of bacteriocin-producing strains was high in the APEC and avian OFEC strains—71.4% and 89.5%, respectively. Similarly, 87.3% of APEC strains isolated during colibacillosis outbreaks in Brazilian industrial plants were bacteriocinogenic [65]. In relation to APEC, the presence of different siderophores could be the reason why these strains are able to colonize the gut, survive in the bloodstream and persist in different organs of the bird. Since APEC strains from birds with colibacillosis can end up in organic fertilizers, this poses an environmental risk. Surprisingly, the percentage of bacteriocin-producing strains in the other groups, especially among cattle FEC and cattle OFEC, did not exceed 30%. Bacteriocin producers often encode two or more types of siderophores. Interestingly, in addition to classical siderophores, E. coli has been described to possess siderophore–microcin compounds that are post-translationally modified by the linkage of a siderophore moiety. Consequently, they can invade and kill phylogenetically related bacteria by a “Trojan Horse” strategy by mimicking the iron–siderophore complexes [64]. The prevalence of the mccH47 and mccM genes in our strains studied was low, with the highest prevalence found in avian OFEC (21.0% possessed mccM and 10.5% possessed mccH47), followed by cattle FEC, UPEC and APEC. No strain possessing either mccM or mccH47 was detected among cattle OFEC. Massip and Oswald (2020) emphasized that siderophore–microcins might be particularly important in human UPEC strains [64], while our study revealed that they might also be important in other E. coli groups. Therefore, further studies are needed to evaluate the role of such microcins in the ecology of E. coli, especially among E. coli from animal hosts.
The study of siderophore production in bacterial populations is very important from both a medical and environmental point of view. In medicine, siderophores can be used as targets for new classes of antibiotics [66]. By using siderophores as chelating agents for heavy metals, polluted environments can be ameliorated in the bioremediation of soil and water [67,68].

5. Conclusions

The uptake of iron may play an important role in the persistence of E. coli in the host and in the environment. The expanded repertoire of siderophores allows strains to be more competitive in iron acquisition when colonizing the intestine and other iron-deficient extra-intestinal biotopes. In the present study, the production of siderophores, the prevalence of siderophore receptor genes and their association with the virulence profile of E. coli from different sources were analyzed. Our study has some limitations, particularly its small sample size, especially in the avian OFEC group. The UPEC strains were characterized by a high variability in siderophore production. The avian OFEC and cattle OFEC strains showed the highest siderophore production among all groups. Genes for aerobactin (iutA) and yersiniabactin (fyuA) receptors were more frequently found among the UPEC strains than among the APEC, FEC and OFEC strains. The greatest diversity of siderophore receptors was found among the APEC strains. We also found that iutA-positive E. coli isolated from animals contained more VAGs than iutA-negative E. coli. The data obtained add to the information on the prevalence of siderophore producers and contribute to our knowledge of the biodiversity of some E. coli pathotypes.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microbiolres16020050/s1, Table S1: The primer sequence, PCR program and expected amplicon sizes in PCR reactions for VAGs.

Author Contributions

Conceptualization, M.V.K. and M.S.E.; methodology, P.A.S., D.A.K. and N.B.R.; software, V.S.M.; validation, V.S.M., M.V.K. and M.S.E.; formal analysis, V.S.M.; investigation, P.A.S., D.A.K. and N.B.R.; resources, M.V.K.; data curation, V.S.M., M.V.K. and M.S.E.; writing—original draft preparation, V.S.M. and M.V.K.; writing—review and editing, M.S.E.; visualization, V.S.M.; supervision, M.V.K. and M.S.E.; project administration, M.V.K.; funding acquisition, M.V.K. All authors have read and agreed to the published version of the manuscript.

Funding

The research of M.V.K., V.S.M., P.A.S., D.A.K. and N.B.R. was carried out within the framework of state assignment No. 124020500028-4 and a grant from the Russian Science Foundation and Perm Krai No. 24-24-20048, https://rscf.ru/en/project/24-24-20048/ (accessed on 12 February 2025).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article or in the Supplementary Materials.

Acknowledgments

The authors thank the senior researcher of Perm Research Institute of Agriculture Zhdanova I.N. for assistance in collecting biological material.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
APECavian pathogenic Escherichia coli
CASchrome azurol S
ExPECextraintestinal pathogenic E. coli
FECfecal Escherichia coli
OFECorganic fertilizers Escherichia coli
PAIspathogenicity islands
PCRpolymerase chain reaction
UPECuropathogenic Escherichia coli
UTIurinary tract infection
UTIsurinary tract infections
VAGvirulence-associated gene
VAGsvirulence-associated genes

References

  1. Frawley, E.R.; Fang, F.C. The ins and outs of bacterial iron metabolism. Mol. Microbiol. 2014, 93, 609–616. [Google Scholar] [CrossRef]
  2. Andreini, C.; Bertini, I.; Cavallaro, G.; Holliday, G.L.; Thornton, J.M. Metal ions in biological catalysis: From enzyme databases to general principles. J. Biol. Inorg. Chem. 2008, 13, 1205–1218. [Google Scholar] [CrossRef]
  3. Fardeau, S.; Mullie, C.; Dassonville-Klimpt, A.; Audic, N.; Sonnet, P. Bacterial iron uptake: A promising solution against multidrug resistant bacteria. In Science Against Microbial Pathogens: Communicating Current Research and Technological Advances; Méndez-Vilas, A., Ed.; Microbiology book series number 3; Formatex Research Center: Badajoz, Spain, 2011; Volume 2, pp. 695–705. [Google Scholar]
  4. Ghssein, G.; Ezzeddine, Z. The Key Element Role of Metallophores in the Pathogenicity and Virulence of Staphylococcus aureus: A Review. Biology 2022, 11, 1525. [Google Scholar] [CrossRef]
  5. Mohsen, Y.; Tarchichi, N.; Barakat, R.; Kawtharani, I.; Ghandour, R.; Ezzeddine, Z.; Ghssein, G. The Different Types of Metallophores Produced by Salmonella enterica: A Review. Microbiol. Res. 2023, 14, 1457–1469. [Google Scholar] [CrossRef]
  6. Hider, R.C.; Kong, X. Chemistry and biology of siderophores. Nat. Prod. Rep. 2010, 27, 637–657. [Google Scholar] [CrossRef]
  7. Ratledge, C.; Dover, L.G. Iron metabolism in pathogenic bacteria. Annu. Rev. Microbiol. 2000, 54, 881–941. [Google Scholar] [CrossRef]
  8. Li, K.; Chen, W.H.; Bruner, S.D. Microbial siderophore-based iron assimilation and therapeutic applications. BioMetals 2016, 29, 377–388. [Google Scholar] [CrossRef] [PubMed]
  9. Torres, A.G.; Payne, S.M. Haem iron-transport system in enterohaemorrhagic Escherichia coli O157:H7. Mol. Microbiol. 1997, 23, 825–833. [Google Scholar] [CrossRef] [PubMed]
  10. Nagy, G.; Dobrindt, U.; Kupfer, M.; Emödy, L.; Karch, H.; Hacker, J. Expression of hemin receptor molecule ChuA is influenced by RfaH in uropathogenic Escherichia coli strain 536. Infect. Immun. 2001, 69, 1924–1928. [Google Scholar] [CrossRef]
  11. Lau, C.K.; Krewulak, K.D.; Vogel, H.J. Bacterial ferrous iron transport: The Feo system. FEMS Microbiol. Lett. 2016, 40, 273–298. [Google Scholar] [CrossRef] [PubMed]
  12. Cavas, L.; Kirkiz, I. Characterization of siderophores from Escherichia coli strains through genome mining tools: An antiSMASH study. AMB Express 2022, 12, 74. [Google Scholar] [CrossRef] [PubMed]
  13. Dozois, C.M.; Daigle, F.; Curtiss, R. Identification of pathogen-specific and conserved genes expressed in vivo by an avian pathogenic Escherichia coli strain. Proc. Natl. Acad. Sci. USA 2003, 100, 247–252. [Google Scholar] [CrossRef] [PubMed]
  14. Miethke, M.; Marahiel, M.A. Siderophore-based iron acquisition and pathogen control. Microbiol. Mol. Biol. Rev. 2007, 71, 413–451. [Google Scholar] [CrossRef] [PubMed]
  15. Khasheii, B.; Mahmoodi, P.; Mohammadzadeh, A. Siderophores: Importance in bacterial pathogenesis and applications in medicine and industry. Microbiol. Res. 2021, 250, 126790. [Google Scholar] [CrossRef]
  16. Fetherston, J.D.; Kirillina, O.; Bobrov, A.G.; Paulley, J.T.; Perry, R.D. The yersiniabactin transport system is critical for the pathogenesis of bubonic and pneumonic plague. Infect. Immun. 2010, 78, 2045–2052. [Google Scholar] [CrossRef] [PubMed]
  17. Azpiroz, M.F.; Laviña, M. Involvement of Enterobactin Synthesis Pathway in Production of Microcin H47. Antimicrob. Agents Chemother. 2004, 48, 1235–1241. [Google Scholar] [CrossRef] [PubMed]
  18. Thomas, X.; Destoumieux-Garzón, D.; Peduzzi, J.; Afonso, C.; Blond, A.; Birlirakis, N.; Goulard, C.; Dubost, L.; Thai, R.; Tabet, J.C.; et al. Siderophore peptide, a new type of post-translationally modified antibacterial peptide with potent activity. J. Biol. Chem. 2004, 279, 28233–28242. [Google Scholar] [CrossRef]
  19. Paauw, A.; Leverstein-van Hall, M.A.; van Kessel, K.P.; Verhoef, J.; Fluit, A.C. Yersiniabactin reduces the respiratory oxidative stress response of innate immune cells. PLoS ONE 2009, 4, e8240. [Google Scholar] [CrossRef] [PubMed]
  20. Holden, V.I.; Bachman, M.A. Diverging roles of bacterial siderophores during infection. Metallomics 2015, 7, 986–995. [Google Scholar] [CrossRef] [PubMed]
  21. Martin, P.; Tronnet, S.; Garcie, C.; Oswald, E. Interplay between siderophores and colibactin genotoxin in Escherichia coli. IUBMB Life 2017, 69, 435–441. [Google Scholar] [CrossRef]
  22. Vagarali, M.A.; Karadesai, S.G.; Patil, C.S.; Metgud, S.C.; Mutnal, M.B. Haemagglutination and siderophore production as the urovirulence markers of uropathogenic Escherichia coli. Indian J. Med. Microbiol. 2008, 26, 68–70. [Google Scholar] [CrossRef]
  23. Watts, R.E.; Totsika, M.; Challinor, V.L.; Mabbett, A.N.; Ulett, G.C.; De Voss, J.J.; Schembri, M.A. Contribution of siderophore systems to growth and urinary tract colonization of asymptomatic bacteriuria Escherichia coli. Infect. Immun. 2012, 80, 333–344. [Google Scholar] [CrossRef] [PubMed]
  24. Sonnenborn, U.; Schulze, J. The non-pathogenic Escherichia coli strain Nissle 1917—features of a versatile probiotic. Microb. Ecol. Health Dis. 2009, 21, 122–158. [Google Scholar] [CrossRef]
  25. Kuznetsova, M.V.; Provorova, S.V.; Kubarev, O.G.; Yudin, D.S.; Karimova, N.V.; Bajandina, N.V.; Teplyakova, M.A.; Demakov, V.A. Comparative characteristics of uropathogenic Escherichia coli strains, allocated in polyclinic and stationary conditions. Urologiia 2018, 6, 37–44. [Google Scholar] [CrossRef]
  26. Kuznetsova, M.V.; Gizatullina, J.S.; Nesterova, L.Y.; Starčič Erjavec, M. Escherichia coli isolated from cases of colibacillosis in Russian poultry farms (Perm Krai): Sensitivity to antibiotics and bacteriocins. Microorganisms 2020, 8, 741. [Google Scholar] [CrossRef] [PubMed]
  27. Mihailovskaya, V.S.; Remezovskaya, N.B.; Zhdanova, I.N.; Starčič Erjavec, M.; Kuznetsova, M.V. Virulence potential of faecal Escherichia coli strains isolated from healthy cows and calves on farms in Perm Krai. Vavilovskii Zhurnal Genet. I Sel. [Vavilov J. Genet. Breed.] 2022, 26, 486–494. [Google Scholar] [CrossRef]
  28. Heijnen, L.; Medema, G. Quantitative detection of E. coli, E. coli O:157 and other shiga toxin producing E. coli in water samples using a culture method combined with real-time PCR. J. Water Health 2006, 4, 487–498. [Google Scholar] [CrossRef]
  29. Alexander, D.B.; Zuberer, D.A. Use of chrome azurol S reagents to evaluate siderophore production by rhizosphere bacteria. Biol. Fertil. Soils 1991, 12, 39–45. [Google Scholar] [CrossRef]
  30. Searle, L.J.; Méric, G.; Porcelli, I.; Sheppard, S.K.; Lucchini, S. Variation in Siderophore Biosynthetic Gene Distribution and Production across Environmental and Faecal Populations of Escherichia coli. PLoS ONE 2015, 10, e0117906. [Google Scholar] [CrossRef] [PubMed]
  31. Johnson, J.R.; Stell, A.L. Extended Virulence Genotypes of Escherichia coli Strains from Patients with Urosepsis in Relation to Phylogeny and Host Compromise. J. Infect. Dis. 2000, 181, 261–272. [Google Scholar] [CrossRef]
  32. Nowrouzian, F.; Adlerberth, I.; Wold, A.E. P fimbriae, capsule and aerobactin characterize colonic resistant Escherichia coli. Epidemiol. Infect. 2000, 126, 11–18. [Google Scholar] [CrossRef] [PubMed]
  33. Gordon, D.M.; O’Brien, C.L. Bacteriocin diversity and the frequency of multiple bacteriocin production in Escherichia coli. Microbiology 2006, 152, 3239–3244. [Google Scholar] [CrossRef]
  34. Clermont, O.; Christenson, J.K.; Denamur, E.; Gordon, D.M. The Clermont Escherichia coli phylo-typing method revisited: Improvement of specificity and detection of new phylo-groups. Environ. Microbiol. Rep. 2013, 5, 58–65. [Google Scholar] [CrossRef] [PubMed]
  35. Guiral, E.; Bosch, J.; Vila, J.; Soto, S.M. Prevalence of Escherichia coli among samples collected from the genital tract in pregnant and non-pregnant women: Relationship with virulence. FEMS Microbiol. Lett. 2011, 314, 170–173. [Google Scholar] [CrossRef]
  36. Chapman, T.A.; Wu, X.Y.; Barchia, I.; Bettelheim, K.A.; Driesen, S.; Trott, D.; Wilson, M.; Chin, J.J. Comparison of virulence gene profiles of Escherichia coli strains isolated from healthy and diarrheic swine. Appl. Environ. Microbiol. 2006, 72, 4782–4795. [Google Scholar] [CrossRef] [PubMed]
  37. Ulett, G.C.; Valle, J.; Beloin, C.; Sherlock, O.; Ghigo, J.M.; Schembri, M.A. Functional analysis of antigen 43 in uropathogenic Escherichia coli reveals a role in long-term persistence in the urinary tract. Infect. Immun. 2007, 75, 3233–3244. [Google Scholar] [CrossRef]
  38. Johnson, T.J.; Wannemuehler, Y.; Doetkott, C.; Johnson, S.J.; Rosenberger, S.C.; Nolan, L.K. Identification of minimal predictors of avian pathogenic Escherichia coli virulence for use as a rapid diagnostic tool. J. Clin. Microbiol. 2008, 46, 3987–3996. [Google Scholar] [CrossRef]
  39. Nakano, M.; Yamamoto, S.; Terai, A.; Ogawa, O.; Makino, S.; Hayashi, H.; Balakrish, N.G.; Kurazono, H. Structural and sequence diversity of the pathogenicity island of uropathogenic Escherichia coli which encodes the USP protein. FEMS Microbiol. Lett. 2001, 205, 71–76. [Google Scholar] [CrossRef]
  40. Kuhar, I.; Grabnar, M.; Žgur-Bertok, D. Virulence determinants of uropathogenic Escherichia coli in fecal strains from intestinal infections and healthy individuals. FEMS Microbiol. Lett. 1998, 164, 243–248. [Google Scholar] [CrossRef]
  41. Moulin-Schouleur, M.; Reperant, M.; Laurent, S.; Bree, A.; Mignon-Grasteau, S.; Germon, P.; Rasschaert, D.; Schouler, C. Extraintestinal pathogenic Escherichia coli strains of avian and human origin: Link between phylogenetic relationships and common virulence patterns. J. Clin. Microbiol. 2007, 45, 3366–3376. [Google Scholar] [CrossRef]
  42. Kerényi, M.; Allison, H.E.; Bátai, I.; Sonnevend, A.; Emödy, L.; Plaveczky, N.; Pál, T. Occurrence of hlyA and sheA genes in extraintestinal Escherichia coli strains. J. Clin. Microbiol. 2005, 43, 2965–2968. [Google Scholar] [CrossRef]
  43. Lescat, M.; Clermont, O.; Woerther, P.L.; Glodt, J.; Dion, S.; Skurnik, D. Commensal Escherichia coli strains in Guiana reveal a high genetic diversity with hostdependant population structure. Environ. Microbiol. Rep. 2012, 5, 49–57. [Google Scholar] [CrossRef]
  44. Pugsley, A.P. Escherichia coli K12 strains for use in the identification and characterization of colicins. J. Gen. Microbiol. 1985, 131, 369–376. [Google Scholar] [CrossRef]
  45. Spurbeck, R.R.; Dinh, P.C., Jr.; Walk, S.T.; Stapleton, A.E.; Hooton, T.M.; Nolan, L.K.; Kim, K.S.; Johnson, J.R.; Mobley, H.L. Escherichia coli isolates that carry vat, fyuA, chuA, and yfcV efficiently colonize the urinary tract. Infect. Immun. 2012, 80, 4115–4122. [Google Scholar] [CrossRef]
  46. Kumar, G.; Kumar, Y.; Kumar, G.; Tahlan, A. Selection and characterization of siderophores of pathogenic Escherichia coli intestinal and extraintestinal isolates. Open Agric. 2021, 6, 456–465. [Google Scholar] [CrossRef]
  47. Feldmann, F.; Sorsa, L.J.; Hildinger, K.; Schubert, S. The Salmochelin Siderophore Receptor IroN Contributes to Invasion of Urothelial Cells by Extraintestinal Pathogenic Escherichia coli in vitro. Infect. Immun. 2007, 75, 3183–3187. [Google Scholar] [CrossRef]
  48. Khazaal, M.T.; El-Hendawy, H.H.; Mabrouk, M.I.; I Faraag, A.H.; Bakkar, M.R. Antibiotic resistance and siderophores production by clinical Escherichia coli. BioTechnologia 2022, 103, 169–184. [Google Scholar] [CrossRef]
  49. Khasheii, B.; Anvari, S.; Jamalli, A. Frequency evaluation of genes encoding siderophores and the effects of different concentrations of Fe ions on growth rate of uropathogenic Escherichia coli. Iran. J. Microbiol. 2016, 8, 359–365. [Google Scholar] [PubMed]
  50. Karimian, A.; Momtaz, H.; Mahbobe Madani, M. Detection of Uropathogenic Escherichia coli virulence factors in patients with urinary tract infections in Iran. Afr. J. Microbiol. Res. 2012, 6, 6811–6816. [Google Scholar] [CrossRef]
  51. Al-Zerfi, H.S.; Al-Hilu, S.A. Investigation of Genes Encoding Siderophores in Escherichia coli Isolated from Cystitis Patients. BIO Web Conf. 2024, 108, 04006. [Google Scholar] [CrossRef]
  52. Nateghi, F.; Jafarpour, M.; Nazemi, A. A Survey for Detection of Eight Correlated Genes of Avian Pathogenic E coli in Human Uropathogenic Escherichia coli. J. Microb. World 2010, 3, 169–176. [Google Scholar]
  53. Makarova, M.A.; Matveeva, Z.N.; Kaftyreva, L.A. Extended-spectrum cephalosporin resistance of diarrheagenic Escherichia coli strains. Probl. Med. Mycol. 2020, 22, 101. [Google Scholar] [CrossRef]
  54. Gao, Q.; Wang, X.; Xu, H.; Xu, Y.; Ling, J.; Zhang, D.; Gao, S.; Liu, X. Roles of iron acquisition systems in virulence of extraintestinal pathogenic Escherichia coli: Salmochelin and aerobactin contribute more to virulence than heme in a chicken infection model. BMC Microbiol. 2012, 12, 143. [Google Scholar] [CrossRef] [PubMed]
  55. Ons, E.; Bleyen, N.; Tuntufye, H.N.; Vandemaele, F.; Goddeeris, B.M. High prevalence iron receptor genes of avian pathogenic Escherichia coli. Avian Pathol. 2007, 36, 411–414. [Google Scholar] [CrossRef] [PubMed]
  56. Caza, M.; Lépine, F.; Milot, S.; Dozois, C.M. Specific roles of the iroBCDEN genes in virulence of an avian pathogenic Escherichia coli O78 strain and in production of salmochelins. Infect. Immun. 2008, 76, 3539–3549. [Google Scholar] [CrossRef]
  57. Apostolakos, I.; Laconi, A.; Mughini-Gras, L.; Yapicier, Ö.Ş.; Piccirillo, A. Occurrence of Colibacillosis in Broilers and Its Relationship With Avian Pathogenic Escherichia coli (APEC) Population Structure and Molecular Characteristics. Front. Vet. Sci. 2021, 8, 737720. [Google Scholar] [CrossRef]
  58. Sabaté, M.; Moreno, E.; Pérez, T.; Andreu, A.; Prats, G. Pathogenicity island markers in commensal and uropathogenic Escherichia coli isolates. Eur. J. Clin. Microbiol. Infect. Dis. 2006, 12, 880–886. [Google Scholar] [CrossRef] [PubMed]
  59. Samei, A.; Haghi, F.; Zeighami, H. Distribution of pathogenicity island markers in commensal and uropathogenic Escherichia coli isolates. Folia Microbiol. 2016, 61, 261–268. [Google Scholar] [CrossRef]
  60. Rezatofighi, S.E.; Mirzarazi, M.; Salehi, M. Virulence genes and phylogenetic groups of uropathogenic Escherichia coli isolates from patients with urinary tract infection and uninfected control subjects: A case-control study. BMC Infect. Dis. 2021, 21, 361. [Google Scholar] [CrossRef] [PubMed]
  61. Ochoa, S.A.; Cruz-Córdova, A.; Luna-Pineda, V.M.; Reyes-Grajeda, J.P.; Cázares-Domínguez, V.; Escalona, G.; Sepúlveda-González, M.E.; López-Montiel, F.; Arellano-Galindo, J.; López-Martínez, B. Multidrug- and Extensively Drug-Resistant Uropathogenic Escherichia coli Clinical Strains: Phylogenetic Groups Widely Associated with Integrons Maintain High Genetic Diversity. Front. Microbiol. 2016, 7, 2042. [Google Scholar] [CrossRef] [PubMed]
  62. Mazurek-Popczyk, J.; Pisarska, J.; Bok, E.; Baldy-Chudzik, K. Antibacterial activity of bacteriocinogenic commensal Escherichia coli against zoonotic strains resistant and sensitive to antibiotics. Antibiotics 2020, 9, 411. [Google Scholar] [CrossRef]
  63. Bosák, J.; Hrala, M.; Micenková, L.; Šmajs, D. Non-antibiotic antibacterial peptides and proteins of Escherichia coli: Efficacy and potency of bacteriocins. Expert Rev. Anti-Infect. Ther. 2021, 19, 309–322. [Google Scholar] [CrossRef]
  64. Massip, C.; Oswald, E. Siderophore-Microcins in Escherichia coli: Determinants of Digestive Colonization, the First Step Toward Virulence. Front. Cell. Infect. Microbiol. 2020, 10, 381. [Google Scholar] [CrossRef] [PubMed]
  65. da Rocha, A.C.; da Silva, A.B.; de Brito, A.B.; Moraes, H.L.; Pontes, A.P.; Cé, M.C.; do Nascimento, V.P.; Salle, C.T. Virulence factors of avian pathogenic Escherichia coli isolated from broilers from the south of Brazil. Avian Dis. 2002, 46, 749–753. [Google Scholar] [CrossRef]
  66. Ezzeddine, Z.; Ghssein, G. Towards new antibiotics classes targeting bacterial metallophores. Microb. Pathog. 2023, 182, 106221. [Google Scholar] [CrossRef]
  67. Nair, A.; Juwarkar, A.A.; Singh, S.K. Production and characterization of siderophores and its application in arsenic removal from contaminated soil. Water Air Soil Pollut. 2007, 180, 199–212. [Google Scholar] [CrossRef]
  68. Ezzeddine, Z.; Ghssein, G. Metallophores as promising chelates for heavy metals removal from polluted water. Bioremediation J. 2024, 1–3. [Google Scholar] [CrossRef]
Microbiolres 16 00050 g001
Figure 1. (a) CAS agar: the yellow halo formed around the bacterial colony indicates siderophore production. (b) Siderophore production coefficient (K) for different groups of E. coli strains. Data are mean ± standard error of the mean (SEM), * p < 0.05. Uropathogenic E. coli (UPEC), avian pathogenic E. coli (APEC), fecal E. coli (FEC), E. coli from organic fertilizers based on poultry and cattle manure.
Figure 1. (a) CAS agar: the yellow halo formed around the bacterial colony indicates siderophore production. (b) Siderophore production coefficient (K) for different groups of E. coli strains. Data are mean ± standard error of the mean (SEM), * p < 0.05. Uropathogenic E. coli (UPEC), avian pathogenic E. coli (APEC), fecal E. coli (FEC), E. coli from organic fertilizers based on poultry and cattle manure.
Microbiolres 16 00050 g001
Microbiolres 16 00050 g002
Figure 2. (a) The number of siderophore receptor genes in E. coli groups isolated from different sources. Data are mean ± standard error of the mean (SEM), * p < 0.05, ** p < 0.005, *** p < 0.0005. (b) Venn diagrams showing combinations of siderophore receptor genes found in different E. coli groups. The number indicates the number of strains. Uropathogenic E. coli (UPEC), avian pathogenic E. coli (APEC), fecal E. coli (FEC), E. coli from organic fertilizers based on poultry and cattle manure.
Figure 2. (a) The number of siderophore receptor genes in E. coli groups isolated from different sources. Data are mean ± standard error of the mean (SEM), * p < 0.05, ** p < 0.005, *** p < 0.0005. (b) Venn diagrams showing combinations of siderophore receptor genes found in different E. coli groups. The number indicates the number of strains. Uropathogenic E. coli (UPEC), avian pathogenic E. coli (APEC), fecal E. coli (FEC), E. coli from organic fertilizers based on poultry and cattle manure.
Microbiolres 16 00050 g002
Microbiolres 16 00050 g003
Figure 3. (a) The number of detected virulence-associated genes (VAGs) among iroN-positive (iroN+), fyuA-positive (fyuA+) and iutA-positive (iutA+) E. coli. Data are mean ± standard error of the mean (SEM), * p < 0.05, ** p < 0.005. (b) A correlation matrix reflecting the strength of the relationship between the siderophore receptor genes and VAGs. Due to only 1 iroN-positive and only 2 iutA-positive strains, this analysis was not performed for cattle organic fertilizers E. coli (OFEC). The color value of each cell corresponds to the Spearman correlation coefficient and is proportional to the correlation strength. Uropathogenic E. coli (UPEC), avian pathogenic E. coli (APEC), fecal E. coli (FEC).
Figure 3. (a) The number of detected virulence-associated genes (VAGs) among iroN-positive (iroN+), fyuA-positive (fyuA+) and iutA-positive (iutA+) E. coli. Data are mean ± standard error of the mean (SEM), * p < 0.05, ** p < 0.005. (b) A correlation matrix reflecting the strength of the relationship between the siderophore receptor genes and VAGs. Due to only 1 iroN-positive and only 2 iutA-positive strains, this analysis was not performed for cattle organic fertilizers E. coli (OFEC). The color value of each cell corresponds to the Spearman correlation coefficient and is proportional to the correlation strength. Uropathogenic E. coli (UPEC), avian pathogenic E. coli (APEC), fecal E. coli (FEC).
Microbiolres 16 00050 g003
Table 1. The primer sequences, PCR programs and expected amplicon size used in this study.
Table 1. The primer sequences, PCR programs and expected amplicon size used in this study.
GeneNucleotide Sequence (5′→3′)ProgramAmplicon Size (bp)Reference
fepATTTGTCGAGGTTGCCATACA
CACGCTGATTTTGATTGACG		95 °C, 3 min;
35 × [95 °C, 2 min; 55 °C, 30 s; 72 °C, 1 min]; 72 °C, 1 min		349[30]
fyuAGGGAATGTGAAACTGCGTCT
CGGGTGCCAAGTTCATAGTT		791
iroNAAGTCAAAGCAGGGGTTCGGGC
GACGCCGACCATTAAGACGCAG		94 °C, 2.5 min;
25 × [94 °C, 30 s; 64 °C, 30 s;
72 °C, 2 min]
72 °C, 10 min		648[31]
iutAGGCTGGACATCATGGGAACTGG
CGTCGGGAACGGGTAGAATCG		94 °C, 4 min;
25 × [94 °C, 2 min; 65 °C, 1 min;
72 °C, 30 s]
72 °C, 10 min 		301[32]
mccH47CACTTTCATCCCTTCGGATTG
AGCTGAAGTCGCTGGCGCACCTCC		95 °C, 12 min;
25 × [94 °C, 30 s;
55 °C, 30 s;
68 °C, 30 s];
72 °C, 3 min		227[33]
mccMCGTTTATTATTTTATGCATA
AAACGGAAGAATGGATGATCTCGCAAA		456
Table 2. Prevalence of siderophore receptor genes in E. coli groups studied.
Table 2. Prevalence of siderophore receptor genes in E. coli groups studied.
ProteinGenePrevalence of Siderophore Receptor Genes in E. coli Groups (%)
Human UPEC (n = 26)APEC (n = 28)Avian OFEC (n = 19)Cattle FEC (n = 49)Cattle OFEC (n = 35)
Salmochelin receptoriroN23.167.968.422.45.7
Ferric aerobactin receptoriutA61.542.942.126.52.9
Yersiniabactin receptorfyuA69.228.631.628.625.7
Ferric enterobactin receptorfepA10089.310095.994.3
Note. Uropathogenic E. coli (UPEC), avian pathogenic E. coli (APEC), fecal E. coli (FEC), E. coli from organic fertilizers based on poultry and cattle manure.
Table 3. Distribution of microcin genes and bacteriocin production in E. coli populations.
Table 3. Distribution of microcin genes and bacteriocin production in E. coli populations.
Gene/PropertyPrevalence in E. coli Groups (%)
Human UPEC (n = 26)APEC (n = 28)Avian OFEC (n = 19)Cattle FEC (n = 49)Cattle OFEC (n = 35)
mccM15.43.621.020.50
mccH477.7010.54.10
Bacteriocin production19.271.489.526.514.3
Note. Uropathogenic E. coli (UPEC), avian pathogenic E. coli (APEC), fecal E. coli (FEC), E. coli from organic fertilizers based on poultry and cattle manure.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kuznetsova, M.V.; Mihailovskaya, V.S.; Selivanova, P.A.; Kochergina, D.A.; Remezovskaya, N.B.; Starčič Erjavec, M. Siderophore Production, Diversity of Siderophore Receptors and Associations with Virulence-Associated Genes, Phylogroups and Bacteriocin Production in Escherichia coli Strains Isolated from Humans, Animals and Organic Fertilizers. Microbiol. Res. 2025, 16, 50. https://doi.org/10.3390/microbiolres16020050

AMA Style

Kuznetsova MV, Mihailovskaya VS, Selivanova PA, Kochergina DA, Remezovskaya NB, Starčič Erjavec M. Siderophore Production, Diversity of Siderophore Receptors and Associations with Virulence-Associated Genes, Phylogroups and Bacteriocin Production in Escherichia coli Strains Isolated from Humans, Animals and Organic Fertilizers. Microbiology Research. 2025; 16(2):50. https://doi.org/10.3390/microbiolres16020050

Chicago/Turabian Style

Kuznetsova, Marina V., Veronika S. Mihailovskaya, Polina A. Selivanova, Darja A. Kochergina, Natalia B. Remezovskaya, and Marjanca Starčič Erjavec. 2025. "Siderophore Production, Diversity of Siderophore Receptors and Associations with Virulence-Associated Genes, Phylogroups and Bacteriocin Production in Escherichia coli Strains Isolated from Humans, Animals and Organic Fertilizers" Microbiology Research 16, no. 2: 50. https://doi.org/10.3390/microbiolres16020050

APA Style

Kuznetsova, M. V., Mihailovskaya, V. S., Selivanova, P. A., Kochergina, D. A., Remezovskaya, N. B., & Starčič Erjavec, M. (2025). Siderophore Production, Diversity of Siderophore Receptors and Associations with Virulence-Associated Genes, Phylogroups and Bacteriocin Production in Escherichia coli Strains Isolated from Humans, Animals and Organic Fertilizers. Microbiology Research, 16(2), 50. https://doi.org/10.3390/microbiolres16020050

Article Metrics

Back to TopTop