You are currently viewing a new version of our website. To view the old version click .
Microbiology Research
  • Article
  • Open Access

10 February 2025

Leptospira interrogans Associated with the Common Vampire Bat (Desmodus rotundus) from the Neotropical Region of Mexico

,
,
,
,
,
,
,
,
and
1
Laboratorio de Enfermedades Infecciosas, Rancho “Torreón del Molino”, Facultad de Medicina Veterinaria y Zootecnia, Universidad Veracruzana, Veracruz 91710, Mexico
2
Instituto de Diagnóstico y Referencia Epidemiológicos, Secretaría de Salud, Mexico City 01480, Mexico
3
Centro de Medicina Tropical, División de Investigación, Facultad de Medicina, Universidad Nacional Autónoma de México, Mexico City 04510, Mexico
4
Laboratorio de Parasitología, Rancho “Torreón del Molino”, Facultad de Medicina Veterinaria y Zootecnia, Universidad Veracruzana, Veracruz 91710, Mexico

Abstract

The genus Leptospira includes at least 69 Gram-negative, aerobic spirochetes, of which 25 are pathogenic and associated with a diverse range of mammals, including members of the order Chiroptera. On the American continent, there are six confirmed Leptospira species. Among these, the common vampire bat (Desmodus rotundus), which ranges widely from northern Mexico to northern Argentina, has been reported to harbor four pathogenic taxa: Leptospira borgpetersenii, Leptospira interrogans, Leptospira weilii, and Leptospira cf. noguchii. All these species are frequently isolated from beef and dairy cattle, suggesting that contact with urine from infected cattle could serve as a potential source of infection for bats. However, previous studies have been limited by small sample sizes and low geographical representation among the countries where they were conducted. For this reason, the aim of this study was to identify the species of Leptospira associated with D. rotundus populations in five states within the Neotropical region of Mexico. Between 2015 and 2021, 54 bats were collected across five Mexican states. Our analysis identified the exclusive presence of L. interrogans in 13 specimens. The findings are discussed within the framework of a One Health perspective, emphasizing their relevance to understanding interspecies transmission dynamics.

1. Introduction

The genus Leptospira comprises a group of Gram-negative, aerobic, and highly motile spirochetes that utilize long-chain fatty acids as primary sources of carbon and energy [1,2]. Currently, the genus includes 69 valid species [3] grouped into four major clusters: the saprophytic S1 and S2, and the pathogenic P1 and P2. Of these, P1 is subdivided into two clades that encompass the subgroups P+ (high-virulence pathogens) and P1- (low-virulence pathogens) species known to infect a wide range of mammals (135 species), including bats [4,5].
Bats represent the second most diverse group of mammals worldwide, with 1446 recognized species [6,7]. Monitoring bat-associated leptospires is of particular interest due to their demonstrated ability to colonize bat kidneys and be excreted via urine (e.g., Leptospira fainei, L. interrogans) [8,9]. Given their unique ability to fly and their high abundance, bats have significant potential to spread these microorganisms over long distances [9].
Serological evidence of exposure to Leptospira in bats has grown in recent decades, with prevalence varying depending on the species and geographical region [9,10]. However, these techniques rely on isolates and/or serovars for more accurate identification; to avoid this bias, molecular identification has been of great help in detecting new host-pathogen associations [10]. Molecular techniques have revealed that Neotropical bats are infected by at least five valid species—Leptospira borgpetersenii, L. fainei, L. interrogans, Leptospira kirschneri, Leptospira noguchi, and Leptospira weilii—in addition to several undefined genetic lineages [11,12,13,14,15,16].
The common vampire bat, Desmodus rotundus, is one of three hematophagous bat species (along with the hairy-legged vampire bat (Diphylla ecaudata) and the white-winged vampire bat (Diaemus youngi)) that have been poorly studied concerning the diversity and prevalence of Leptospira species [11]. Desmodus rotundus is a medium-sized bat characterized by its tailless body and dark gray dorsal coloration, which can vary from reddish to golden. It has small, rounded ears, a deeply grooved lower lip, and a circumnarial ridge resembling a noseleaf. The upper incisors are large and knife-like, adapted for its feeding habits. Its unique features include reduced facial structures, quadrupedal locomotion, and the remarkable ability to take flight directly from the ground [17,18,19]. The distribution of D. rotundus is restricted to the Neotropical region, spanning from northern Mexico to Chile on the Pacific coast and from the Gulf of Mexico to southern Brazil, Uruguay, and northern Argentina on the Atlantic coast [17,18]. Two subspecies are recognized: D. r. rotundus (Trinidad and Tobago, Colombia, Venezuela, the Guianas, Ecuador, Peru, Brazil, Bolivia, Paraguay, Argentina, Uruguay, and central Chile) and D. r. murinus (Mexico, Central America, northern and western Colombia, and the western Andean slopes in Ecuador and Peru) [17]. This species thrives at altitudes ranging from sea level to over 3000 m and inhabits caves, drains, or logs, forming family groups of 40–200 individuals [18].
Desmodus rotundus feeds exclusively on blood from a wide range of mammalian hosts, primarily species within the orders Artiodactyla and Perissodactyla [19]. Among these, cattle stand out due to their close association with vampire bats, a relationship that developed within 500 years of European colonization and the introduction of livestock to the Americas [20].
The economic impact of D. rotundus on livestock is significant but challenging to quantify [21]. Besides transmitting the rabies virus, their feeding weakens livestock through blood loss, reducing milk and meat production and increasing susceptibility to secondary parasitic and bacterial infections [21,22]. This interaction has facilitated the exchange of microorganisms between bats and cattle, with much attention given to the rabies virus but less to other pathogens, particularly bacteria of the genus Leptospira.
Molecular reports indicate that D. rotundus harbors four pathogenic leptospire species, L. borgspeterseni, L. interrogans, L. noguchii, and L. weilii, all of which are frequently isolated from beef and dairy cattle [15,23,24,25,26] (Supplementary Table S1).
It is plausible that contact with urine from infected cattle is a primary source of infection for these bats. However, the impact of such infections on the fitness of hematophagous bat populations remains unknown [8,27,28].
To better understand the role of D. rotundus in the epidemiology and ecology of Leptospira, it is crucial to establish the inventory and prevalence of leptospire species within their populations. Thus, the present study aimed to analyze the diversity and prevalence of Leptospira species in populations of D. rotundus across five states in the Neotropical region of Mexico.

2. Materials and Methods

As a part of the ‘National Program for Rabies Surveillance’, specimens of D. rotundus negative for rabies from the Rabies Laboratory of the Institute of Epidemiological Diagnosis and Reference, which concentrates specimens from the National Network of Public Health Laboratories of the Mexican states of Michoacan, Morelos, Nayarit, and Oaxaca, were tested. Additionally, several bats collected in the field in conjunction with the Committee for the Promotion and Protection of Livestock [Comité para Fomento y Protección Pecuaria of the state of Veracruz] were analyzed (Table 1; Figure 1).
Table 1. Desmodus rotundus collected and positive to Leptospira DNA.
Figure 1. Sampling sites of Desmodus rotundus selected for Leptospira sp. molecular detection in Mexico. Orange circles correspond to D. rotundus collection localities.
Field specimen collection was conducted using three vertically positioned mist nets, strategically placed at locations identified as potential shelters, such as caves and drains. Nets were deployed during twilight hours (7:00 p.m. to 12:00 a.m.), with monitoring conducted at 30 min intervals throughout the night.
All mammals were euthanized following the “Guidelines of the American Society of Mammalogists for the Use of Wild Mammals in Research” [29], ensuring ethical standards were met during the research process.
A necropsy of each animal was carried out, extracting the kidney, which was fixed in 96% ethanol until its processing in the laboratory. To avoid cross-contamination between animals, the surgical material was disinfected with a 10% NaClO and 96% EtOH solutions between each sample. DNA extraction was performed individually using 500 μL of a 10% Chelex 100 SIGMA® chelating resin solution (Bio-Rad, Hercules, CA, USA) per sample, to which 20 μL of Proteinase K (SIGMA life sciences, Burlington, VT, USA) was added and left to incubate at 56 °C for 24 h. The samples were centrifuged at 25,000× g for 15 min, and the supernatant was collected in new tubes and stored at −20 °C until further use. As an endogenous control to validate the DNA extraction, a 450 bp fragment of the mammalian Cytochrome Oxidase Subunit I (COI) gene was amplified using the primers L6625 (5′-CCGGATCCTTYTGRTTYTTYGGNCAYCC-3′) and H7005 (5′-CCGGATCCACNACRTARTANGTRTCRTG-3′) [30].
Leptospira DNA was identified via a previously standardized conventional polymerase chain reaction (PCR) technique. A 474 bp segment of the LipL32 gene was amplified using the primers LipL32F: 5’ATCTCCGTTGCACTCTTTGC3’ and LipL32R: 5’ACCATCATCATCATCGTCCA3’ [31] and a 549 bp fragment of the SecY gene with the primers SecYF-ATGCCGATCATTTTTGCTTC and SecYR-AGTTGAGCCCGCAGTTTTC [32]. The reaction mix consisted of 12.5 μL of a 2X solution of GoTaq® Green Master Mix (Promega Corporation Madison, WI, USA), 1 μL of each oligonucleotide (2 μM each), 6.5 μL of DNase-free water, and 4 µL of DNA (200–300 ng) to make a final volume of 25 µL. Negative (a reaction mix without DNA) and positive (DNA from Leptospira santarosai [MG733099]) controls were included. To visualize the amplicons, 2% agarose gels stained with Smartglow (Accuris Instruments, Edison, NJ, USA) were used, using a 2% TAE solution (Bio-Rad, Hercules, CA, USA) as the running buffer, at 85 V for 45 min. Subsequently, they were viewed with an Accuris Smartdoc photo documenter (ACCURIS INSTRUMENTS, Edison, NJ, USA).
All positive PCR products were purified and sequenced at Macrogen, Korea (Seoul, Republic of Korea). The recovered electropherograms were visually inspected and edited in Chromas (version 5, Technelysium, South Brisbane, QLD, Australia). Sequences were compared with validated species of the genus Leptospira deposited in GenBank using the BLASTn tool (National Center for Biotechnology Information, Bethesda, MD, USA). From each sequence, the coverage percentage and the similarity with respect to the valid species were obtained.
The sequences generated in this study were aligned with other reference sequences deposited in GenBank using the CLUSTAL W algorithm in MEGA 11.0 (Center for Evolutionary Medicine and Informatics, Tempe, AZ, USA). On this basis, a phylogenetic reconstruction was performed using the Maximum Likelihood method (MaximumLikelihood) with 10,000 bootstrap iterations in IQ-TREE (http://www.iqtree.org/, accessed on 15 October 2024), eliminating the gaps during the analysis.
The obtained sequences were deposited in GenBank with the accession numbers PQ753280–PQ753304.
Prevalence and 95% confidence intervals were calculated using the VassarStats software platform (available at http://vassarstats.net/, accessed on 12 December 2024).

3. Results

Between 2015 and 2022, a total of 54 Desmodus rotundus individuals were collected from nine municipalities across five Mexican states. Michoacán accounted for the highest proportion of specimens, with 46.30% (25), followed by Morelos and Oaxaca, each contributing 16.67% (9). The lowest number of records was from Nayarit, comprising 9.26% (5) (Table 1). In terms of sex distribution, 64.81% (35) of the specimens were female, while 35.19% (19) were male. Leptospira DNA was detected in 24.07% (13/54) of the specimens during the initial screening using the lipL32 and secY genes. Between 2015 and 2022, a total of 54 Desmodus rotundus individuals were collected from nine municipalities across five Mexican states. Michoacán accounted for the highest proportion of specimens, with 46.30% (25), followed by Morelos and Oaxaca, each contributing 16.67% (9). The lowest number of records was from Nayarit, comprising 9.26% (5) (Table 1). In terms of sex distribution, 64.81% (35) of the specimens were female, while 35.19% (19) were male. Leptospira DNA was detected in 24.07% (13/54) of the specimens during the initial screening using the lipL32 and secY genes. The highest prevalence was observed in Santiago (Nayarit) and Alvarado (Veracruz), where 66.67% of the hosts were infected (Table 1). In contrast, no infections were detected in San Blas and Santa María del Oro (Nayarit) or Tlalquitenongo (Morelos). When analyzing sex differences, males showed a higher prevalence, with 47.37% testing positive compared to only 11.43% in females (Table 1).
From these specimens, complete sequences of both genes were successfully recovered from 12 of the 13 positive individuals for phylogenetic analysis. The presence of two haplotypes in the secY gene and three for lipL32 was detected. The sequences generated in this study exhibited high similarity to Leptospira interrogans, which has been detected in various hosts belonging to the orders Carnivora, Chiroptera, Rodentia, and Primates, as well as from several countries across the Neotropical, Afrotropical, and Indoaustral regions, with percentage identity ranging from 99–100% for the lipL32 and secY genes (Table 2).
Table 2. Results of the analysis of Leptospira sequences recovered from D. rotundus from several states of Mexico.
Based on the phylogenetic reconstruction using concatenated analyses, all 12 positive individuals were confirmed as belonging to the pathogenic L. interrogans through maximum likelihood analysis. The sequences from this study grouped with those of L. interrogans from Saint Kitts and Nevis and Brazil in a monophyletic clade with a branch support of 100%, providing strong evidence of their genetic relatedness (Figure 2).
Figure 2. Maximum-likelihood phylogenetic tree generated by using the general time-reversible model using discrete gamma distribution with concatenated segments of the lipL32 and secY genes (900 bp total) of several members of the genus Leptospira. The sequences generated in this work are highlighted with colors. Only bootstrap values >75% are indicated at the nodes. The scale bar indicates nucleotide substitutions per site.

4. Discussion

Members of the genus Leptospira have been detected in approximately 55 bat species spanning eight families in tropical and subtropical regions worldwide [9,33]. In the Neotropical region, six Leptospira species have been associated with roughly 36 bat species [10]. This study marks the first report of Leptospira interrogans in Desmodus rotundus from the states of Oaxaca, Michoacán, and Morelos. By documenting these findings, it addresses critical information gaps regarding the association of Leptospira species with bats in the northern edge of the Neotropical region (Supplementary Table S1).
Despite the extensive geographic distribution of D. rotundus across the Americas, studies on Leptospira diversity and infection prevalence in this species remain limited [15,23,24,25,26]. Research in the Neotropical region has focused on only four countries—Brazil, Colombia, Mexico, and Peru—reporting four Leptospira species. Of the seven existing studies, Leptospira interrogans is the most frequently detected species. This leptospire species has been detected in various species belonging to the orders Carnivora, Chiroptera, Rodentia, and Primates, as well as from several countries across the Neotropical, Afrotropical, and Indoaustral regions, which highlights the high capacity of the species to adapt to diverse hosts and environmental conditions [5,34,35].
In Mexico, only two prior studies have analyzed D. rotundus for Leptospira detection, identifying L. interrogans and L. weilii in populations from Veracruz and Yucatán [11,15]. The limited sample sizes in these studies make it difficult to establish reliable prevalence patterns. In this sense, this study stands out as the first work that uses a larger sample size, which opens the epidemiological panorama of Leptospira in vampire bats [11,12,15,24,25,26]. In addition, it shows the importance of this bat in the maintenance and possible dispersion of Leptospira, specifically L. interrogans [25].
In production animals, L. interrogans is a primary cause of leptospirosis, an infectious disease linked to abortions, weakened offspring, and mortality [36]. However, asymptomatic infections in cattle have also been documented [37]. It is plausible that prey species of D. rotundus, particularly cattle, contribute to the infection of these bats. Previous studies, such as that by Ballados et al. [11] in Veracruz, demonstrated a high prevalence of L. weilii in D. rotundus inhabiting close to zebu cattle. The previous study, combined with this study, raises the possibility that D. rotundus may acquire non-Neotropical Leptospira species through exposure to the urine of its prey [10].
Behavioral and ecological traits of D. rotundus [18] may facilitate infection; for example, these species spend prolonged periods on the ground while stalking prey, potentially coming into contact with substrates contaminated with prey urine [37]. Given that leptospires can survive in muddy substrates for up to three months, environmental persistence could contribute to high prevalence rates in these bats [38].
Additionally, the gregarious habits of D. rotundus, which form family groups of up to 200 individuals, could promote pathogen transmission through social behaviors like grooming, recognition activities, or even mutual feeding, as has been previously documented in this bat species [18,39]. To our knowledge, this study is the first to assess the prevalence of L. interrogans by sex in D. rotundus populations [11,12,15,24,25,26]. The results revealed a significantly higher prevalence in males (43.33%) compared to females (11.12%) (Table 1). Male marking behaviors may also contribute to pathogen spread within colonies. Although sexual transmission of leptospires has been documented in other mammals, such as pigs and cattle, its occurrence in bats is still unknown [40,41]. Investigating the presence of Leptospira in bat reproductive organs could help clarify this potential route of transmission.
Future research should focus on the natural history of L. interrogans in D. rotundus, including histopathological analysis of kidney tissues and determining leptospiruria rates. Such studies would clarify whether D. rotundus serves as a reservoir or dispersal agent for Leptospira, considering its mobility ranges up to 100 km [22]. Sero-exposure studies are also needed to assess pathogen interactions and demographic risk factors, such as age and sex.

5. Conclusions

Integrated studies that evaluate the presence and prevalence of Leptospira in hematophagous bats, their prey, and the environment are crucial. Reevaluating the role of D. rotundus in the Leptospira life cycle is essential to understanding its ecological and epidemiological significance. Adopting a holistic approach will provide deeper insights into these interactions, contributing to both bat conservation efforts and the development of effective disease management strategies.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/microbiolres16020043/s1: Table S1: Records of species of the genus Leptospira associated with the bat Desmodus rotundus in America. Abbreviations: MAT: microscopic agglutination; NA: not applicable; PCR: polymerase chain reaction.

Author Contributions

Conceptualization, L.A.C.-G., N.A.-C., G.G.B.-G., P.C.-S., A.C.-R., and S.S.-M.; methodology, L.A.C.-G., N.A.-C., G.G.B.-G., C.I.M.-C., E.G., M.A.-D., D.R.-S., R.I.H.-H., P.S.M.-d.Á., M.A.L.-V., I.B., P.C.-S., A.C.-R., and S.S.-M.; software, L.A.C.-G., P.C.-S., A.C.-R., and S.S.-M.; validation, L.A.C.-G., N.A.-C., G.G.B.-G., C.I.M.-C., E.G., M.A.-D., D.R.-S., R.I.H.-H., P.S.M.-d.Á., M.A.L.-V., I.B., P.C.-S., A.C.-R., and S.S.-M.; formal analysis, L.A.C.-G., N.A.-C., G.G.B.-G., C.I.M.-C., E.G., M.A.-D., D.R.-S., R.I.H.-H., P.S.M.-d.Á., M.A.L.-V., I.B., P.C.-S., A.C.-R., and S.S.-M.; investigation, L.A.C.-G., N.A.-C., G.G.B.-G., C.I.M.-C., E.G., M.A.-D., D.R.-S., R.I.H.-H., P.S.M.-d.Á., M.A.L.-V., I.B., P.C.-S., A.C.-R., and S.S.-M.; resources, L.A.C.-G., N.A.-C., G.G.B.-G., C.I.M.-C., E.G., M.A.-D., D.R.-S., R.I.H.-H., P.S.M.-d.Á., M.A.L.-V., I.B., P.C.-S., A.C.-R., and S.S.-M.; data curation, L.A.C.-G., N.A.-C., G.G.B.-G., C.I.M.-C., E.G., M.A.-D., D.R.-S., R.I.H.-H., P.S.M.-d.Á., M.A.L.-V., I.B., P.C.-S., A.C.-R., and S.S.-M.; writing—original draft preparation, L.A.C.-G., N.A.-C., G.G.B.-G., C.I.M.-C., E.G., M.A.-D., D.R.-S., R.I.H.-H., P.S.M.-d.Á., M.A.L.-V., I.B., P.C.-S., A.C.-R., and S.S.-M.; writing—review and editing, L.A.C.-G., N.A.-C., G.G.B.-G., C.I.M.-C., E.G., M.A.-D., D.R.-S., R.I.H.-H., P.S.M.-d.Á., M.A.L.-V., I.B., P.C.-S., A.C.-R., and S.S.-M.; supervision, L.A.C.-G., N.A.-C., G.G.B.-G., C.I.M.-C., E.G., M.A.-D., D.R.-S., R.I.H.-H., P.S.M.-d.Á., M.A.L.-V., I.B., P.C.-S., A.C.-R., and S.S.-M.; project administration, L.A.C.-G., N.A.-C., G.G.B.-G., C.I.M.-C., E.G., M.A.-D., D.R.-S., R.I.H.-H., P.S.M.-d.Á., M.A.L.-V., I.B., P.C.-S., A.C.-R., and S.S.-M.; funding acquisition, N.A.-C., A.C.-R., and S.S.-M. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Ethical review and approval was not required for the animal study because it is part of the rabies surveillance system performed at the Ministry of Health in Mexico, for which ethics approval is not required. The methods are described in the Mexican Legislation NOM-011-SSA2-2011 for the control and prevention of human rabies in dogs and cats.

Data Availability Statement

Sequences generated in the present study were deposited in GenBank under the following accession numbers: PQ753280–PQ753304.

Acknowledgments

We acknowledge the Doctorate Program in Agricultural Sciences, Faculty of Veterinary Medicine and Zootechnics, Universidad Veracruzana, as well as CONACYT, for the scholarship granted to one of the authors of the work with CVU number 781618.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Picardeau, M.; Bertherat, E.; Jancloes, M.; Skouloudis, A.N.; Durski, K.; Hartskeerl, R.A. Rapid tests for diagnosis of leptospirosis: Current tools and emerging technologies. Diagn. Microbiol. Infect. Dis. 2014, 78, 1–8. [Google Scholar] [CrossRef]
  2. Andre-Fontaine, G.; Aviat, F.; Thorin, C. Waterborne Leptospirosis: Survival and Preservation of the Virulence of Pathogenic Leptospira spp. in Fresh Water. Curr. Microbiol. 2015, 71, 136–142. [Google Scholar] [CrossRef] [PubMed]
  3. Fernandes, L.G.V.; Stone, N.E.; Roe, C.C.; Goris, M.G.A.; van der Linden, H.; Sahl, J.W.; Wagner, D.M.; Nally, J.E. Leptospira sanjuanensis sp. nov., a pathogenic species of the genus Leptospira isolated from soil in Puerto Rico. Int. J. Syst. Evol. Microbiol. 2022, 72, 005560. [Google Scholar] [CrossRef] [PubMed]
  4. Giraud-Gatineau, A.; Nieves, C.; Harrison, L.B.; Benaroudj, N.; Veyrier, F.J.; Picardeau, M. Evolutionary insights into the emergence of virulent Leptospira spirochetes. PLoS Pathog. 2024, 20, e1012161. [Google Scholar] [CrossRef] [PubMed]
  5. Hagedoorn, N.N.; Maze, M.J.; Carugati, M.; Cash-Goldwasser, S.; Allan, K.J.; Chen, K.; Cossic, B.; Demeter, E.; Gallagher, S.; German, R.; et al. Global distribution of Leptospira serovar isolations and detections from animal host species: A systematic review and online database. Trop. Med. Int. Health 2024, 29, 161–172. [Google Scholar] [CrossRef]
  6. Dutheil, F.; Clinchamps, M.; Bouillon-Minois, J.B. Bats, pathogens, and species richness. Pathogens 2021, 10, 98. [Google Scholar] [CrossRef]
  7. Llobet-François, O.; Velikov, I.; Sogorb Mallebrera, L.; Peacock, F.; Jutglar, J.; Mascarell-Llosa, A.; Martí de Ahumada, B.; Rodríguez-Osorio, J. All the Mammals of the World; Lynx Nature Books: Barcelona, Spain, 2023; 779p. [Google Scholar]
  8. Ulsenheimer, B.C.; von Laer, A.E.; Tonin, A.A.; Campos, A.A.S.; Dos Santos, H.F.; Sangioni, L.A.; de Avila-Botton, S. Leptospira interrogans in bats in Rio Grande do Sul State, Brazil: Epidemiologic aspects and phylogeny. Braz. J. Microbiol. 2022, 53, 2233–2240. [Google Scholar] [CrossRef]
  9. Dietrich, M.; Mühldorfer, K.; Tortosa, P.; Markotter, W. Leptospira and bats: Story of an emerging friendship. PLoS Pathog. 2015, 11, e1005176. [Google Scholar] [CrossRef]
  10. Esteves, S.B.; Gaeta, N.C.; Batista, J.M.N.; Dias, R.A.; Heinemann, M.B. Leptospira sp. infection in bats: A systematic review and meta-analysis. Transbound Emerg. Dis. 2022, 69, e2456–e2473. [Google Scholar] [CrossRef] [PubMed]
  11. Ballados-González, G.G.; Sánchez-Montes, D.S.; Romero-Salas, D.; Colunga Salas, P.; Gutiérrez-Molina, R.; León-Paniagua, L.; Méndez-Ojeda, M.L.; Barrientos-Salcedo, C.; Serna-Lagunes, R.; Cruz Romero, A. Detection of pathogenic Leptospira species associated with phyllostomid bats (Mammalia: Chiroptera) from Veracruz, Mexico. Transbound Emerg. Dis. 2018, 65, 773–781. [Google Scholar] [CrossRef]
  12. Mateus, J.; Gómez, N.; Herrera-Sepúlveda, M.T.; Hidalgo, M.; Pérez-Torres, J.; Cuervo, C. Bats are a potential reservoir of pathogenic Leptospira species in Colombia. J. Infect. Dev. Ctries 2019, 13, 278–283. [Google Scholar] [CrossRef]
  13. Pratt, N.; Rajeev, S. Leptospira seroprevalence in animals in the Caribbean region: A systematic review. Acta Trop. 2018, 182, 34–42. [Google Scholar] [CrossRef]
  14. Saraullo, V.; Grune-Loffler, S.; Pastorino, F.; Watanabe, O.; Alonso, M.L.; Hamer, M.; Moreira, C.; Martinez, M.; Martinez, G.; Brihuega, B. First report of pathogenic Leptospira spp. in Tadarida brasiliensis bats (family Molossidae) and Eptesicus furinalis (family Vespertilionidae) of Argentina. New host species in this country? Rev. Arg. Microbiol. 2021, 53, 210–215. [Google Scholar] [CrossRef]
  15. Torres-Castro, M.; Febles-Solís, V.; Hernández-Betancourt, S.; Noh-Pech, H.; Estrella, E.; Peláez-Sánchez, R.; Panti-May, A.; Herrera-Flores, B.; Reyes-Hernández, B.; Sosa-Escalante, J. Leptospira patógena en murciélagos de Campeche y Yucatán, Mexico. Rev. MVZ Córdoba 2020, 25, 17–26. [Google Scholar] [CrossRef]
  16. Silva-Ramos, C.R.; Chala-Quintero, S.M.; Faccini-Martínez, Á.A.; Hidalgo, M.; Pulido-Villamarín, A.D.P.; Pérez-Torres, J.; Cuervo, C. Pathogenic Leptospira Species in Bats: Molecular Detection in a Colombian Cave. Trop. Med. Infect. Dis. 2022, 7, 84. [Google Scholar] [CrossRef] [PubMed]
  17. Wilson, D.E.; Mittermeier, R.A. Handbook of the Mammals of the World. Bats. J. Vert. Biol. 2019, 69, 327–328. [Google Scholar]
  18. Greenhall, A.M.; Joermann, G.; Schmidt, U. Desmodus rotundus. Mamm. Species 1983, 202, 1–6. [Google Scholar] [CrossRef]
  19. Bobrowiec, P.E.D.; Lemes, M.R.; Gribel, R. Prey preference of the common vampire bat (Desmodus rotundus, Chiroptera) using molecular analysis. J. Mammal. 2015, 96, 54–63. [Google Scholar] [CrossRef]
  20. Brown, N.; Escobar, L.E. A review of the diet of the common vampire bat (Desmodus rotundus) in the context of anthropogenic change. Mamm. Biol. 2023, 103, 433–453. [Google Scholar] [CrossRef]
  21. Mello, A.K.M.; Brumatti, R.C.; Neves, D.A.; Alcântara, L.O.; Araújo, F.S.; Gaspar, A.O.; Lemos, R.A. Bovine rabies: Economic loss and its mitigation through antirabies vaccination. Pesq. Vet. Bras. 2019, 39, 179–185. [Google Scholar] [CrossRef]
  22. Hayes, M.A.; Piaggio, A.J.; Antoinette, J. Assessing the potential impacts of a changing climate on the distribution of a rabies virus vector. PLoS ONE 2018, 13, e0192887. [Google Scholar] [CrossRef] [PubMed]
  23. Zetun, C.; Hoffmann, J.; Silva, R.; Souza, L.; Langoni, H. Leptospira spp. and Toxoplasma gondii antibodies in Vampire bats (Desmodus rotundus) in Botucatu region, Brazil. J. Venom. Anim. Toxins Incl. Trop. Dis. 2009, 15, 546–552. [Google Scholar] [CrossRef]
  24. Di Azevedo, M.I.N.; Verde, R.d.S.; Ezepha, C.; Carvalho-Costa, F.A.; D’Andrea, P.S.; Medeiros, L.d.S.; Lilenbaum, W. Genetic Evidence for a Potentially New Pathogenic Leptospira sp. Circulating in Bats from Brazilian Amazon. Transbound Emerg. Dis. 2023, 2023, 9677047. [Google Scholar] [CrossRef]
  25. Verde, R.S.; Di Azevedo, M.I.N.; Dias, D.; Tavares de Freitas, T.P.; Carvalho-Costa, F.A.; Bonvicino, C.; Lilenbaum, W.; D’Andrea, P.S.; Medeiros, L.S. Bat-Associated Pathogenic Leptospira spp. from Forest Fragments in Southwestern Brazilian Amazonia. Transbound Emerg. Dis. 2024, 2024, 6633866. [Google Scholar] [CrossRef]
  26. Matthias, M.A.; Díaz, M.M.; Campos, K.J.; Calderon, M.; Willig, M.R.; Pacheco, V.; Gotuzzo, E.; Gilman, R.H.; Vinetz, J.M. Diversity of bat-associated Leptospira in the Peruvian Amazon inferred by bayesian phylogenetic analysis of 16S ribosomal DNA sequences. Am. J. Trop. Med. Hyg. 2005, 73, 964–974. [Google Scholar] [CrossRef] [PubMed]
  27. Cilia, G.; Bertelloni, F.; Fratini, F. Leptospira infections in domestic and wild animals. Pathogens 2020, 9, 573. [Google Scholar] [CrossRef]
  28. Ellis, W.A. Animal leptospirosis. In Leptospira and Leptospirosis; Springer: Berlin/Heidelberg, Germany, 2015; pp. 99–137. [Google Scholar]
  29. Sikes, R.S. Animal Care and Use Committee of the American Society of Mammalogists Guidelines of the American Society of Mammalogists for the use of wild mammals in research and education. J. Mammal. 2016, 97, 663–688. [Google Scholar] [CrossRef] [PubMed]
  30. Hafner, M.S.; Sudman, P.D.; Villablanca, F.X.; Spradling, T.A.; Demastes, J.W.; Nadler, S.A. Disparate rates of molecu-lar evolution in cospeciating hosts and parasites. Science 1994, 265, 1087–1090. [Google Scholar] [CrossRef] [PubMed]
  31. Vital-Brazil, J.M.; Balassiano, I.T.; Oliveira, F.S.D.; Costa, A.D.D.S.; Hillen, L.; Pereira, M.M. Multiplex PCR-based detection of Leptospira in environmental water samples obtained from a slum settlement. Mem. Inst. Oswaldo Cruz. 2010, 105, 353–355. [Google Scholar] [CrossRef]
  32. Ahmed, N.; Devi, S.M.; De los Á Valverde, M.; Vijayachari, P.; Machang’u, R.S.; Ellis, W.A.; Hartskeerl, R.A. Multilocus sequence typing method for identification and genotypic classification of pathogenic Leptospira species. Ann. Clin. Microbiol. Antimicrob. 2006, 5, 28. [Google Scholar]
  33. Matiz-González, J.M.; Ballesteros-Ballesteros, J.A.; Hernández, M.; Mejorano-Fonseca, J.A.; Cuervo, C.; Faccini-Martínez, Á.A.; Hidalgo, M.; Pérez-Torres, J.; Silva-Ramos, C.R. Genetic diversity of P1/pathogenic Leptospira species hosted by bats worldwide. Zoonoses Public Health 2024, 71, 457–468. [Google Scholar] [CrossRef]
  34. Bonhomme, D.; Werts, C. Host and species-specificities of pattern recognition receptors upon infection with Leptospira interrogans. Front. Cell. Infect. Microbiol. 2022, 12, 932137. [Google Scholar] [CrossRef]
  35. Sykes, J.E.; Reagan, K.L.; Nally, J.E.; Galloway, R.L.; Haake, D.A. Role of diagnostics in epidemiology, management, surveillance, and control of leptospirosis. Pathogens 2022, 11, 395. [Google Scholar] [CrossRef]
  36. Soares, R.R.; da Costa Barnabé, N.N.; Júnior, J.P.A.; Malossi, C.D.; Ullmann, L.S.; da Costa, D.F.; Alves, C.J. Investigation of the Presence of Leptospira interrogans in urinary and genital tracts of male goats raised in the semiarid region of Brazil. Small Rumin. Res. 2023, 218, 106880. [Google Scholar] [CrossRef]
  37. Schutt, W.A., Jr.; Altenbach, J.S.; Chang, Y.H.; Cullinane, D.M.; Hermanson, J.W.; Muradali, F.; Bertram, J.E. The dynamics of flight-initiating jumps in the common vampire bat Desmodus rotundus. J. Exp. Biol. 1997, 200 Pt 23, 3003–3012. [Google Scholar] [CrossRef] [PubMed]
  38. Lehmann, J.S.; Matthias, M.A.; Vinetz, J.M.; Fouts, D.E. Leptospiral Pathogenomics. Pathogens 2014, 3, 280–308. [Google Scholar] [CrossRef] [PubMed]
  39. Ceballos, G. Mammals of Mexico; Johns Hopkins University Press: Baltimore, MD, USA, 2014. [Google Scholar]
  40. Aymée, L.; Mendes, J.; Lilenbaum, W. Bovine Genital Leptospirosis: An Update of This Important Reproductive Disease. Animals 2024, 14, 322. [Google Scholar] [CrossRef]
  41. Monroy-Díaz, A.L.; Vargas-Arias, J.A.; Filippo-Iriarte, G.D.; Quimbaya-Ramírez, J.J. Leptospirosis en reservorios animales: Una revisión de tema. Rev. Lasallista. Investig 2020, 17, 266–279. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Article Metrics

Citations

Article Access Statistics

Multiple requests from the same IP address are counted as one view.