Next Article in Journal
Liposomal CRISPR/Cas9-Mediated Local Genome Editing for Joint Disease in Mucopolysaccharidosis Type I
Previous Article in Journal
Cytotoxic and Cytostatic Effects of Nanoformulated Fenretinide on MG63 Osteosarcoma Cells
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pharmaceutics
Volume 18
Issue 2
10.3390/pharmaceutics18020279
pharmaceutics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Psoralen Promotes Direct Chemical Reprogramming of Mouse Embryonic Fibroblasts into Osteoblast-like Cells

by
Wenjie Li
,
Haixia Liu
,
Xinyu Wan
,
Ding Cheng
,
Ruyuan Zhu
* and
Zhiguo Zhang
*
Institute of Basic Theory for Chinese Medicine, China Academy of Chinese Medical Sciences, Beijing 100700, China
*
Authors to whom correspondence should be addressed.
Pharmaceutics 2026, 18(2), 279; https://doi.org/10.3390/pharmaceutics18020279
Submission received: 22 January 2026 / Revised: 15 February 2026 / Accepted: 20 February 2026 / Published: 23 February 2026
(This article belongs to the Section Biopharmaceutics)
Browse Figures
Versions Notes

Abstract

Background/Objectives: Cells derived from direct chemical reprogramming into osteoblasts represent a promising source for bone regeneration, but the efficiency needs improvement. Here, we systematically evaluated whether the natural compound psoralen (Psr) could enhance this process and explored its therapeutic potential and mechanism of action. Methods: Mouse embryonic fibroblasts (MEFs) were treated with a cocktail of forskolin and phenamil (FP), supplemented with Psr. In vitro differentiation was assessed by alkaline phosphatase and Alizarin Red S staining, reverse transcription quantitative PCR, immunofluorescence and Western blot. The bone-regenerative potential of the derived chemically induced osteoblast-like cells (ciOBs) was evaluated in critical-sized calvarial defects, femoral cortical defects and a subcutaneous ectopic implantation model, using micro-computed tomography and histology. Mechanistic insights of Psr were gained by analyzing the adenylyl cyclase 9 (ADCY9)/cyclic adenosine monophosphate (cAMP)/protein kinase A (PKA)/cAMP response element-binding protein (CREB) axis using inhibitor SQ22536. Results: Psr acted synergistically with the FP cocktail to drive efficient osteogenic reprogramming of MEFs. At an optimal concentration of 25 μM, Psr enabled the most robust induction of early osteogenic markers and generation of mature, mineralizing ciOBs in vitro. In vivo, FP + Psr-induced ciOBs repaired critical-sized calvarial and femoral cortical defects and generated substantial, vascularized bone tissue in ectopic sites. Mechanistically, Psr co-treatment potently activated the ADCY9/cAMP/PKA/CREB pathway, and pharmacological inhibition of this pathway completely abolished the pro-osteogenic effects of Psr. Conclusions: Psr acts as a potent synergistic enhancer of direct chemical reprogramming, generating functional osteoblast-like cells with robust bone-regenerative capacity via activation of the ADCY9/cAMP/PKA/CREB pathway.

Graphical Abstract

1. Introduction

Recent advances in direct lineage reprogramming have provided novel approaches for generating therapeutic cell types without the need for genetic modifications [1]. This approach is particularly advantageous for bone regeneration, as a major clinical challenge is the limited availability of functional osteoblasts [2]. Chemical reprogramming using small molecules offers notable advantages over genetic methods, including higher reproducibility, better scalability, and lower cost [3,4]. Therefore, establishing highly efficient chemical reprogramming protocols has the potential to significantly advance the treatment of bone defects, fractures, and osteoporosis by ensuring a dependable supply of osteogenic cells [5,6].
Current chemical reprogramming of fibroblasts into osteoblast-like cells relies on small molecules that target key regulatory proteins in osteogenesis-associated pathways [7]. Examples include transforming growth factor-beta (TGF-β) receptor kinase inhibitors (RepSox [8], SD-208 [9]), adenylyl cyclase (ADCY) activators (Forskolin [10,11]), bone morphogenetic protein (BMP) activator (Phenamil [12,13]), 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase inhibitors (Simvastatin [14]), calcineurin inhibitors (Tacrolimus [15], Cyclosporine [16]), and glycogen synthase kinase-3 alpha/beta (GSK-3α/β) inhibitors (CHIR-99021 [17]). Although small-molecule cocktails can induce direct reprogramming toward osteoblasts, existing protocols are often encumbered by practical complexities. These typically involve the use of numerous compounds (e.g., six or more small molecules [18]), alongside dynamic changes in culture conditions such as the concentration of fetal bovine serum (FBS) [12]. Such changes can lead to cellular stress or unintended phenotypic shifts [19]. Previously, our group identified the combination of Forskolin and Phenamil (FP) as a promising foundation for reprogramming mouse embryonic fibroblasts (MEFs) into chemically induced osteoblast-like cells (ciOBs). However, the suboptimal efficiency and lengthy timeline of the FP cocktail alone highlight the need for identifying synergistic adjuvants to develop a more potent and rapid reprogramming regimen. We therefore sought to identify a synergistic molecule that could be integrated into the FP cocktail to address these limitations.
Psoralen (Psr), a compound derived from Psoralea corylifolia, presents outstanding osteogenic effects [20]. Notably, it has been reported to modulate several signaling pathways critically involved in osteoblast differentiation and direct reprogramming, including the cyclic adenosine monophosphate (cAMP)/protein kinase A (PKA) [21], TGF-β [22], Akt/GSK-3β/β-catenin [23], and BMP [24] signaling. This suggests that Psr holds strong potential to act synergistically with established reprogramming cocktails to enhance both the efficiency and speed of osteogenic conversion. To investigate the potential mechanism underlying Psr’s synergistic effect, we focused on the ADCY/cAMP/PKA/cAMP response element-binding protein (CREB) signaling axis. This pathway is central to mediating the osteogenic effects of our foundational FP cocktail [25,26] and represents a highly plausible target for Psr based on prior evidence [27].
In this study, we investigated whether Psr could act as a synergistic enhancer to the FP cocktail for direct osteogenic reprogramming of MEFs. We determined the optimal concentration of Psr for promoting osteogenic commitment and maturation, evaluated the bone-regenerative capacity of the resulting ciOBs in various in vivo models, and elucidated the underlying molecular mechanism involving the ADCY9/cAMP/PKA/CREB signaling pathway. Our findings may provide an efficient and translatable strategy for bone regeneration.

2. Materials and Methods

2.1. Reagents

The materials used included: DMEM/F12 (1:1) basal medium (1X) (Gibco, Thermo Fisher Scientific, Waltham, MA, USA, 6123073), fetal bovine serum (FBS, Procell, Wuhan, China, 164210-50), L-ascorbic acid (Sigma-Aldrich, St. Louis, MO, USA, SLCF5765), Penicillin/Streptomycin solution (100X, Servicebio, Wuhan, China, G4003-100ML), Sodium β-glycerophosphate disodium salt hydrate (Biorigin, Beijing, China, BN35422-10g), RUNX2 polyclonal antibody (Proteintech, Wuhan, China, 20700-1-AP), Vimentin polyclonal antibody (Proteintech, Wuhan, China, 22031-1-AP), Beta-actin polyclonal antibody (Proteintech, Wuhan, China, 20536-1-AP), Osteocalcin polyclonal antibody (Proteintech, Wuhan, China, 16157-1-AP), A Cyclase IX Rabbit Polyclonal Antibody (Biodragon, Beijing, China, BD-PT0031), PRKACB Polyclonal antibody (Proteintech, Wuhan, China, 55382-1-AP), CREB1 Monoclonal antibody (Proteintech, Wuhan, China, 67927-1-Ig), Phospho-CREB1 (Ser133) Polyclonal antibody (Proteintech, Wuhan, China, 28792-1-AP), ATP1A1 Polyclonal antibody (Proteintech, Wuhan, China, 14418-1-AP), Alexa Fluor 594-labeled goat anti-rabbit IgG (Servicebio, Wuhan, China, GB28301), Alexa Fluor 488-labeled goat anti-rabbit IgG (Servicebio, Wuhan, China, GB25303), DAPI staining reagent (Servicebio, Wuhan, China, G1012), Pluripotent Stem Cell Alkaline Phosphatase (ALP) Color Development Kit (Beyotime, Shanghai, China, C3250S), First Strand cDNA Synthesis Kit (RNase H minus, Beyotime, Shanghai, China, D7168M), Alizarin Red S (ARS) Solution (OriCell, Suzhou, China, ALIR-10001), Cell Counting Kit-8 (Beyotime, Shanghai, China, C0038), Cyclosporine (GLPBIO, Montclair, CA, USA, GC11328), CHIR-99021 (GLPBIO, Montclair, CA, USA, GC16702-10), Tacrolimus (GLPBIO, Montclair, CA, USA, GC16233-50), SD-208 (GLPBIO, Montclair, CA, USA, GC13904), Simvastatin (GLPBIO, Montclair, CA, USA, GC10585), RepSox (GLPBIO, Montclair, CA, USA, GC16793), Forskolin (GLPBIO, Montclair, CA, USA, GC11920), Psoralen (Beijing Bethealth People Biomedical Technology Co., Ltd., Beijing, China, 23010802), Phenamil (GLPBIO, Montclair, CA, USA, GC13994), SQ22536 (GLPBIO, Montclair, CA, USA, GC13867), One-Step Western Kit HRP (CWBio, Beijing, China, CW2029M), high-strength RIPA buffer (Solarbio, Wuhan, China, R0010-20mL), BCA Protein Assay Kit (Solarbio, Wuhan, China, PC0020), SuperSignal™ West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific, Waltham, MA, USA, 34577), and qPCR SYBR Green Master Mix (High Rox Plus, Yeasen, Shanghai, China, 11203ES08), Matrigel (CODONX, Beijing, China, KMS-03), Primers were synthesized by Sangon Biotech (Shanghai, China).

2.2. Extraction and Primary Culture of MEFs

MEFs were isolated from embryonic day 13.5 (E13.5) C57BL/6J mouse fetuses as described [28]. Briefly, two pregnant dams (10 weeks old, 18–20 g) were euthanized under anesthesia. The uteri were surgically excised under sterile conditions, yielding 6 embryos from one dam and 8 embryos from the other. After removing fetal heads, limbs, and internal organs, the remaining trunks from all embryos of each dam were rinsed with PBS, pooled, and minced into fragments (<1 mm3). Tissue digestion was performed using 0.25% trypsin at 37 °C for 15 min. The resultant cell suspension was centrifuged and resuspended in DMEM/F12 medium supplemented with 10% FBS, then cultured in T25 flasks. Cells at passage 4 (P4) were used for subsequent experiments. Each batch of MEFs was derived from one pregnant dam, representing one independent biological replicate. A total of two independent biological replicates (from two different dams) were used for all experiments in this study. All experiments were performed with at least three technical replicates per biological replicate.

2.3. Cell Grouping and Treatment

Passage-4 MEFs were seeded in 12-well plates at a density of 1 × 105 cells per well. Upon reaching approximately 80% confluency, cells were treated with osteogenic induction medium (OM), consisting of DMEM/F12 medium supplemented with 10% FBS, 1% penicillin/streptomycin, 50 mg/L ascorbic acid, 0.1 μM dexamethasone, and 10 mM β-glycerophosphate [8]. Different small molecules, including Forskolin (F, 10 μM), Phenamil (P, 10 μM) and varying concentrations of Psr (10–50 μM), were added to the OM as needed. For mechanistic studies, the adenylyl cyclase inhibitor SQ22536 (SQ, 10 μM) was also added to selected groups as indicated. All small molecules were continuously present in the OM throughout the entire induction period (up to 21 days), with fresh medium containing the same concentrations of molecules replaced every 2–3 days. No stepwise change of factors or serum concentration was performed.

2.4. Cell Viability Assay (CCK-8 Assay)

Passage-4 MEFs were seeded in 96-well plates at a density of 5 × 103 cells per well with DMEM/F12 medium supplemented with 10% FBS. After overnight attachment, the medium was replaced with OM containing the indicated small molecules: OM alone, OM with 10 μM Forskolin and 10 μM Phenamil (FP group), or OM with FP + (10–50 μM) Psoralen (FP + Psr group). On day 6, 20 μL of CCK-8 reagent was added to each well (200 μL medium system) and the plates were incubated at 37 °C for 2 h. Absorbance was then measured at 450 nm using an ELISA plate reader. All experiments were performed with six replicates per group (n = 6).

2.5. Alkaline Phosphatase (ALP) Staining

ALP staining was used to evaluate osteogenic differentiation. Cells were fixed using 4% paraformaldehyde (PFA) solution for 10 min, rinsed with PBS, and subsequently incubated with ALP staining solution in darkness at room temperature for 30 min. Following an additional PBS wash, osteogenic differentiation was confirmed by visualizing blue-purple staining under microscopy.

2.6. Alizarin Red S (ARS) Staining

To determine cellular mineralization, cells cultured for 21 days were fixed in 4% PFA solution for 10 min and stained using ARS solution for 15 min. After extensive washing with deionized water, images of the stained cultures were captured. To quantify the staining, ARS was extracted with 10% cetylpyridinium chloride solution, and the absorbance of the resulting solution was measured spectrophotometrically at 560 nm.

2.7. Reverse Transcription Quantitative PCR

Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) from cells. Subsequently, 500 ng RNA was reverse-transcribed into cDNA using the First Strand cDNA Synthesis Kit (RNase H minus, Beyotime, Shanghai, China, D7168M). Gene expression analysis was performed by RT-qPCR using SYBR Green Master Mix on a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA; software version: CFX Manager 3.1). Reactions were performed in triplicate under the following cycling parameters: initial denaturation at 95 °C for 30 s, then 40 cycles comprising denaturation at 95 °C for 10 s, annealing/extension at 60 °C for 30 s, and melting curve analysis. Primer sequences are listed in Table 1.

2.8. Immunofluorescence

Cells were fixed with 4% PFA for 10 min, washed with PBS, and permeabilized using 0.5% Triton X-100 for 10 min. Following blocking with 5% BSA for 1 h, cells were incubated overnight at 4 °C with primary antibodies (RUNX2, 1:200; Vimentin, 1:200) diluted in 5% BSA. Alexa Fluor 594-conjugated goat anti-rabbit IgG (1:400) or Alexa Fluor 488-conjugated goat anti-rabbit IgG (1:400) were applied at room temperature for 1 h. Nuclei were counterstained with DAPI. Fluorescence images were obtained using a Confocal laser scanning microscope (Olympus, Tokyo, Japan, FV3000) with Olympus FV31S-SW software (version 2.3.1), and mean fluorescence intensity was quantified with ImageJ software (National Institutes of Health, Bethesda, MD, USA; Java 1.8.0_172, 64-bit).

2.9. Western Blot (WB) Analysis

Cells were lysed on ice with RIPA buffer containing protease and phosphatase inhibitors, followed by centrifugation at 12,000× g for 10 min at 4 °C. Protein concentration was quantified using the BCA Protein Assay Kit (Beyotime, Shanghai, China, P0012). Equal amounts of protein (30 μg) were separated by 10% SDS-polyacrylamide gels, transferred onto PVDF membranes, and blocked for 5 min. Membranes were incubated with primary antibodies (RUNX2, 1:500; Vimentin, 1:1000; Osteocalcin, 1:1000; β-actin, 1:2000; Adcy9, 1:1000; PRKACB, 1:1000; CREB, 1:1000; p-CREB, 1:1000; ATP1A1, 1:1000) for 1 h at room temperature. After washing, HRP-conjugated secondary antibodies provided in the One-Step Western Kit HRP (CWBio, Beijing, China, CW2029M) were applied. Protein bands were visualized using SuperSignal™ West Pico PLUS Chemiluminescent Substrate and imaged using the ChemiDOCTM XRS+ Imaging System (Bio-Rad, Hercules, CA, USA).

2.10. Calvarial Defect Model and Cell Transplantation

To evaluate the bone regenerative capacity of ciOBs in an orthotopic environment, a critical-sized calvarial defect model was employed. Twenty-five male C57BL/6J mice (8–10 weeks old) were randomly assigned to five groups (n = 5) using a computer-generated random number sequence: Model, Matrigel only, Matrigel + OM, Matrigel + FP, and Matrigel + FP + Psr. ciOBs were generated as described and harvested after 14 days of induction. For transplantation, 2 × 106 cells were resuspended in 40 µL of cold Matrigel. For surgery, mice were anesthetized by intraperitoneal injection of 1% sodium pentobarbital (50 mg/kg body weight). The cranial skin was shaved and a longitudinal incision was made to expose the skull. A 4 mm diameter full-thickness craniotomy defect was created in the left parietal bone using a drill [29]. The defect was rinsed and immediately filled with the 40 µL Matrigel-cell mixture (or cell-free Matrigel). The gel was allowed to polymerize for 5–10 min before skin closure with sutures. At the 4-week endpoint, mice were deeply anesthetized with sodium pentobarbital (50 mg/kg, i.p.) and euthanized by cervical dislocation. The calvaria was immediately dissected and scanned by micro-computed tomography (micro-CT) to assess bone regeneration.

2.11. Distal Femoral Cortical Defect Model and Cell Transplantation

To evaluate bone regeneration in a load-bearing environment, a distal femoral cortical defect model was employed. A total of twenty-five male C57BL/6J mice (8–10 weeks old) were randomly assigned to five groups (n = 5) using a computer-generated random number sequence: Model, Matrigel, Matrigel + OM, Matrigel + FP, and Matrigel + FP + Psr. ciOBs were prepared as described for the calvarial defect model, and 2 × 106 cells were resuspended in 40 µL of cold Matrigel for transplantation. For surgery, mice were anesthetized by intraperitoneal injection of 1% sodium pentobarbital (50 mg/kg body weight). The surgical site on the right limb was shaved, and a longitudinal incision was made to expose the distal femur. Following soft tissue retraction, a 1 mm diameter, full-thickness cortical bone defect was created in the distal femoral metaphysis, approximately 1–2 mm proximal to the femoral condyle, exposing the marrow cavity [30]. The defect was rinsed and immediately filled with the 40 µL Matrigel-cell mixture (or cell-free Matrigel). The gel was allowed to polymerize for 5–10 min before skin closure with sutures. At the 2-week endpoint, mice were deeply anesthetized with sodium pentobarbital (50 mg/kg, i.p.) and euthanized by cervical dislocation. The femur was immediately dissected and scanned by micro-computed tomography (micro-CT) to assess bone regeneration.

2.12. Histological Assessment in Ectopic Bone Formation Models

To assess the cell-autonomous osteogenic potential in vivo, an ectopic bone formation assay was performed. A total of twelve young adult male C57BL/6J mice (8–10 weeks old, 18–20 g) were used. Upon arrival, mice were acclimatized for one week and then randomly assigned into four experimental groups (n = 3) using a computer-generated random number sequence: β-TCP, β-TCP + OM, β-TCP + FP, β-TCP + FP + Psr. ciOBs were generated from MEFs as described above and cultured for 14 days under the respective conditions (OM, FP, or FP + Psr). On the day of surgery, cells were harvested by trypsinization, resuspended in DMEM/F12 at a density of 1 × 106/100 μL, and seeded onto β-TCP scaffolds (2 × 2 × 2 mm). Scaffolds were incubated at 37 °C for 1 h in a CO2 incubator to facilitate cell attachment. For surgery, mice were anesthetized by intraperitoneal injection of 1% sodium pentobarbital (50 mg/kg body weight). Under aseptic conditions and upon confirmation of deep anesthesia (loss of pedal reflex), one scaffold per mouse was surgically implanted into a subcutaneous pocket created on the dorsal flank [31]. At the 8-week endpoint, mice were euthanized following deep anesthesia (sodium pentobarbital, 50 mg/kg, i.p.) via cervical dislocation; the implants and surrounding tissues were then harvested, fixed in 4% PFA, decalcified, dehydrated, and paraffin-embedded.

2.13. Micro CT

Micro-computed tomography (micro-CT) analysis was performed to evaluate bone regeneration. Calvarial and femoral samples were harvested, fixed in 4% formaldehyde for 48 h, and scanned using a high-resolution micro-CT system (VNC-102, Pingsheng Healthcare, Beijing, China). Scanning parameters were set at 90 kV, 0.09 mA, with an isotropic voxel size of 10 μm. Three-dimensional reconstructions were generated using the instrument’s proprietary software (Bee Viewer Pro v2.0, Pingsheng Healthcare, Beijing, China). For calvarial defects, a cylindrical volume of interest (VOI) with a diameter of 4 mm and height of 1 mm was centered over the original defect site. For femoral cortical defects, a cylindrical VOI with a diameter of 1 mm and height of 1 mm was positioned to encompass the entire defect region. A consistent global threshold of 220–250 Hounsfield units (HU) was applied to distinguish mineralized bone tissue from soft tissue and background. All micro-CT analyses were performed by an operator blinded to the experimental groups to ensure unbiased quantification. Within the standardized VOI, quantitative morphometric parameters, including bone mineral content (BMC), bone mineral density (BMD), bone surface to total volume ratio (BS/TV), bone volume fraction (BV/TV), tissue mineral content (TMC) and bone surface (BS) were calculated using the Avatar analysis module.

2.14. Histological Processing, Staining, and Analysis

All harvested tissue samples were fixed in 4% paraformaldehyde (48 h, 4 °C). Bone-containing samples were subsequently decalcified in 10% EDTA (pH 7.4; 2 weeks). Following standard dehydration, clearing, and paraffin embedding, 5 µm sections were cut. For analysis, sections were stained with Hematoxylin and Eosin (H&E; standard protocol) or Masson’s Trichrome (to visualize collagen in blue and mineralized matrix in red).

2.15. Statistical Analysis

Data are presented as mean ± standard error of the mean (SEM). Statistical analyses were performed using GraphPad Prism 7.0. All datasets were assessed for normality distribution using Shapiro–Wilk tests (for n < 50), and homogeneity of variance was verified using Brown-Forsythe (for ANOVA). Data comparisons were performed using the statistical tests (Student’s t-test, one-way ANOVA, or two-way ANOVA with appropriate post hoc tests). Sample sizes (n) for each statistical test are noted in the corresponding figure legends. Statistical significance was set at a threshold of p < 0.05.

3. Results

3.1. Psr Enhances Early Osteogenic Reprogramming

Prior to reprogramming, the identity and purity of the isolated MEFs were confirmed. As shown in Supplementary Figure S1A, both freshly isolated (passage 0) and expanded (passage 4) MEFs displayed the characteristic spindle-shaped, fibroblastic morphology. Immunofluorescence staining at passage 4 demonstrated uniform expression of the mesenchymal fibroblast marker Vimentin across the cell population, with no evidence of contamination by other cell types (Supplementary Figure S1B). These data confirm that the cells used for subsequent reprogramming experiments were highly pure populations of MEFs.
MEFs were treated with a base reprogramming cocktail consisting of forskolin and phenamil (FP), supplemented with varying concentrations of Psr (10, 25, 50 μM). After 6 days of induction, morphological changes characteristic of osteogenic commitment were observed. Cells treated with the FP cocktail alone largely retained a fibroblastic spindle shape. In contrast, the addition of Psr, particularly at 25 μM and 50 μM, induced a distinct morphological shift, with a significant proportion of cells adopting a round, cuboidal, or short columnar shape accompanied by nuclear enlargement, reminiscent of osteoblast precursors (Figure 1A, phase-contrast, red arrows).
This morphological transition was strongly correlated with the induction of early osteogenic markers. Alkaline phosphatase (ALP) activity, a key early functional marker, was markedly enhanced by Psr, with the most potent staining observed at 25 μM and 50 μM (Figure 1A, ALP staining). MEFs were treated according to the experimental timeline illustrated (Figure 1B).
Consistent with morphological transition and ALP staining, RT-qPCR analysis revealed that the mRNA expression of core osteogenic transcription factors and markers, including Runx2, Alp, Bmp2, and Osterix, was significantly upregulated by Psr. The combination of FP with 25 μM Psr consistently elicited the most robust transcriptional activation of these genes (Figure 1C).
To further quantify the loss of the fibroblastic identity and the acquisition of an osteogenic phenotype at the protein level, we performed immunofluorescence staining. The expression of Vimentin, a mesenchymal fibroblast marker, was progressively downregulated with increasing concentrations of Psr, with the FP + 25 μM Psr treatment causing the most significant reduction in fluorescence intensity (Figure 1D,E). Conversely, immunofluorescence staining demonstrated a dramatic upregulation in the protein abundance of the master osteogenic regulator RUNX2. This was evidenced by a strong increase in overall cellular fluorescence intensity, with prominent signal in both the nuclear and cytoplasmic compartments, particularly in the FP + 25 μM Psr group (Figure 1F,G). The marked increase in total RUNX2 fluorescence intensity, coupled with prominent cytoplasmic signal, suggests that Psr potently promotes RUNX2 protein synthesis at this early stage (day 6), with a portion of newly synthesized protein yet to undergo complete nuclear translocation. This observation highlights the dynamic nature of RUNX2 subcellular localization during the early phase of chemical reprogramming. The CCK-8 results on day 6 showed that supplementation with Psr further enhanced cell viability, with the 25 μM concentration yielding the most pronounced increase (Figure 1H).

3.2. Psr Promotes Terminal Osteogenic Differentiation and Matrix Mineralization

Following the observation that Psr potently induces early osteogenic commitment, we sought to determine whether this effect culminates in terminal differentiation and functional matrix mineralization—the hallmark of mature osteoblasts. MEFs were treated under the same dose gradients for an extended period of 21 days.
Strikingly, ARS staining and quantitative analysis revealed a clear dose–response relationship for Psr, with an optimal concentration for mineralized matrix deposition at 25 μM. All tested concentrations of Psr (10, 25, 50 μM) enhanced mineralization compared to the FP cocktail alone. However, the effect peaked at 25 μM, which was significantly greater than that at both the lower (10 μM) and higher (50 μM) concentrations (Figure 2A,B). This peak efficacy indicates that the early pro-osteogenic shift most efficiently translates into functional maturation at this specific concentration.
Consistent with the enhanced mineralization, the expression of key late-stage osteogenic markers was markedly upregulated on day 21. RT-qPCR analysis showed that mRNA levels of Osteocalcin, Osteopontin, and Osteoprotegerin, all critical regulators of bone matrix formation and remodeling, were significantly elevated by Psr. The expression of the master regulator Runx2 remained high at this late time point in the FP + 25 μM Psr group (Figure 2C–F). At the protein level, Western blot analysis further confirmed a substantial increase in RUNX2 and Osteocalcin protein abundance, mirroring the mRNA data. Concomitantly, the expression of the fibroblast marker Vimentin was substantially downregulated at the protein level in the groups treated with higher concentrations of Psr (25 and 50 μM), confirming a marked and sustained loss of the original cellular identity (Figure 2G–J).
Therefore, based on its superior efficacy in driving both early commitment (Figure 1) and late functional maturation—especially matrix mineralization—25 μM Psr was unequivocally established as the optimal concentration. The combination of FP and 25 μM Psr (hereafter termed the FP + Psr cocktail) was used for all subsequent mechanistic investigations.
To further assess the maturation and lineage specificity of the FP + Psr (25 μM) cocktail induced cells, we examined markers for mature osteoblasts/osteocytes and for alternative lineages on day 21. FP + Psr (25 μM) cocktail significantly upregulated the mature osteoblast marker Dmp1. A modest but significant increase in the osteocyte marker Sost was also observed, suggesting that a subset of cells may have progressed toward a more mature stage. The predominant phenotype corresponds to mature osteoblasts, consistent with the robust matrix mineralization observed. Crucially, the FP + Psr (25 μM) cocktail significantly suppressed the expression of chondrogenic (Col2a1, Sox9) and adipogenic (Fabp3, Pparg) markers (Figure 2L,M). The absence of these alternative lineage markers further demonstrates the lineage specificity of our reprogramming approach.
Notably, while continuous culture to 21 days yields mature, heavily mineralized ciOBs ideal for in vitro characterization, we observed that a 14-day induction period was optimal for in vivo transplantation. This 14-day time point balances robust osteogenic commitment with higher cell viability upon harvest, as extended culture leads to extensive matrix accumulation that compromises cell recovery during enzymatic dissociation [12]. Having established the appropriate induction duration for transplantation, we next assessed the phenotype stability of the 14-day-induced ciOBs after small molecule withdrawal. As shown in Supplementary Figure S4, after 14 days of induction with the FP + Psr (25 μM) cocktail followed by 7 days of culture in factor-free medium, cells maintained significantly higher mineralization capacity and expression of osteogenic markers (Runx2, Osteocalcin, Osteopontin, Osteoprotegerin) compared to OM group. These results indicate that the osteoblast-like phenotype acquired through our optimized protocol exhibits a notable degree of stability upon factor removal.
Having optimized the generation of ciOBs using the FP + Psr (25 μM) cocktail in vitro and confirmed their phenotypic stability, we next rigorously evaluated their functional bone-forming capacity in vivo. These included a non-load-bearing calvarial defect model, a load-bearing distal femoral cortical defect model, and a stringent subcutaneous ectopic implantation assay.

3.3. FP + Psr-Induced ciOBs Repair Critical-Sized Calvarial Defects

To evaluate the functional bone-forming capacity, ciOBs were generated following the timeline illustrated in Figure 3A. Briefly, MEFs were induced with OM, FP, or FP + Psr (25 μM) for 14 days, then harvested and immediately transplanted into three distinct in vivo models.
We first assessed the ability of ciOBs to regenerate bone in an orthotopic, non-load-bearing environment. Cells generated under OM, FP, or FP + Psr conditions were transplanted into critical-sized calvarial defects in mice. Micro-computed tomography (micro-CT) analysis after 4 weeks revealed a clear, stepwise enhancement in bone regeneration across the treatment groups (Figure 3B). Micro-CT analysis was performed with standardized VOIs and thresholds as described in Section 2.12, by an operator blinded to the experimental groups. Defects treated with Matrigel alone showed minimal repair, similar to the baseline, whereas implantation of ciOBs initiated new bone formation. Notably, transplantation of FP + Psr-induced ciOBs resulted in the most substantial and bridged bone regeneration. Quantitative morphometric analysis corroborated these observations (Figure 3C–H). Key parameters reflecting bone mass and mineralization, including bone volume fraction (BV/TV), bone mineral density (BMD), and bone mineral content (BMC), were all significantly elevated in the FP + Psr group compared to all other groups. This group also exhibited the highest values for bone surface-related metrics (BS/TV, BS).
After micro-CT analysis, a histological analysis of calvarial defect samples was carried out after staining with H&E and Masson’s trichrome. As shown in Figure 3I, the histological findings were consistent with the micro-CT observations. In the Matrigel-only control group, the defect area was predominantly filled with fibrous connective tissue, with only minimal new bone formation at the margins. In the groups receiving OM- or FP-induced ciOBs, the amount of new bone tissue was noticeably higher than in the control. In contrast, transplantation of FP + Psr-induced ciOBs significantly promoted robust bone regeneration. The new bone not only bridged the defect but also extended toward the sagittal suture, featuring a thickened, mature lamellar architecture with vascular channels.

3.4. FP + Psr-Induced ciOBs Heal Critical-Sized Distal Femoral Cortical Defect

We next challenged the cells in a more demanding, load-bearing orthotopic defect model. Transplantation of ciOBs into critical-sized distal femoral cortical defects recapitulated the therapeutic hierarchy observed in the calvarium, but with more pronounced differences at this early 2-week time point (Figure 4A). Micro-CT analysis was performed with standardized VOIs and thresholds as described in Section 2.12, by an operator blinded to the experimental groups. Micro-CT analysis revealed that only the defects implanted with FP + Psr-induced ciOBs exhibited substantial and contiguous new bone formation bridging the defect site.
Quantitative analysis confirmed the superior efficacy of the FP + Psr-induced cells. This group showed significantly greater bone volume fraction (BV/TV) and bone mineral density (BMD) not only compared to the Matrigel control, but also to defects receiving OM- or FP-induced ciOBs (Figure 4B–D). Histological examination of the FP + Psr group confirmed the presence of abundant new osteoid and actively mineralizing matrix at the defect interface, indicating robust and rapid osteogenic activity (Figure 4E).

3.5. FP + Psr-Induced ciOBs Exhibit Cell-Autonomous, Ectopic Bone-Forming Capacity

Finally, to unequivocally demonstrate that the osteogenic potential is intrinsic to the ciOBs and independent of an osteogenic niche, we employed a stringent subcutaneous ectopic implantation model. FP + Psr-induced ciOBs, derived from C57BL/6J mouse embryonic fibroblasts, were seeded on β-tricalcium phosphate (β-TCP) scaffolds and implanted into the dorsal flanks of syngeneic C57BL/6J mice. After 8 weeks, histological analysis revealed that only implants containing FP + Psr-induced ciOBs had generated substantial, well-mineralized, and vascularized bone islands (Figure 5A,B, ☆, arrowheads). Quantitative histomorphometric analysis of bone fill, collagen fibers and empty lacunae further corroborated these observations (Figure 5C–E). This confirms that the FP + Psr reprogramming cocktail endows MEFs with sufficient and autonomous osteogenic commitment to initiate and sustain complete osteogenesis, including vascularization, in a heterotopic site. In stark contrast, scaffolds alone or those seeded with cells reprogrammed under less effective conditions (OM or FP alone) formed only fibrous tissue or minimal, avascular collagenous matrix.
Collectively, these in vivo studies across three independent models demonstrate that ciOBs generated with the FP + Psr cocktail possess robust and cell-autonomous bone-forming capacity capable of repairing challenging skeletal defects and generating vascularized ectopic bone.

3.6. Activation of the Adcy9/CAMP/PKA/CREB Pathway Is Required for Psr-Mediated Osteogenic Reprogramming

We next investigated the signaling mechanism underlying Psr-induced osteogenic reprogramming. We examined the effect of Psr on key components of the Adcy9/cAMP/PKA/CREB axis. The experimental timeline for inhibitor treatment is illustrated in Figure 6A. RT-qPCR analysis revealed that the combination of forskolin, phenamil, and Psr (FP + Psr) significantly upregulated the mRNA levels of Adcy9, Pkaca, Pkacb and Creb compared to the FP cocktail or Psr alone (Figure 6B). Importantly, the cAMP concentration in the culture supernatant, which reflects adenylate cyclase activity, was also profoundly elevated by FP + Psr treatment on day 6 (Figure 6C). Consistently, Western blot analysis confirmed a marked increase in the protein abundance of Adcy9 and PRKACB, along with elevated levels of total CREB and its activated, phosphorylated form (p-CREB) in the FP + Psr group (Figure 6D–J). These data collectively indicate that Psr synergizes with the FP cocktail to potently activate the Adcy9/cAMP/PKA/CREB signaling pathway during reprogramming.
To establish the functional significance of this pathway activation, we employed 10 μM SQ22536 (SQ), a specific inhibitor of adenylate cyclase. This pharmacological inhibition severely impaired the acquisition of the osteoblast-like phenotype, as evidenced by diminished ALP activity and a near-complete abrogation of mineralized matrix deposition (Figure 6K,L). The addition of SQ to the FP + Psr cocktail (FP + Psr + SQ group) effectively blocked the increase in extracellular cAMP (Figure 6M), and subsequently abolished the upregulation of key osteogenic markers (Alp, Runx2, Bmp2, Osterix) and signaling components (Figure 6N). At the protein level, SQ22536 treatment attenuated the induction of Adcy9 and PRKACB, and most notably, completely suppressed CREB phosphorylation induced by FP + Psr (Figure 6O–S). Taken together, these results demonstrate that the small molecule Psr potentiates the chemical reprogramming of MEFs into osteoblast-like cells by co-activating the Adcy9/cAMP/PKA/CREB signaling cascade. The failure to induce osteogenic markers and mineralization upon pathway inhibition confirms that this activation is not merely correlative but is functionally required for the direct reprogramming process.

4. Discussion

Efficient generation of functional osteoblasts is crucial for cell-based bone regeneration [32]. While small-molecule direct reprogramming offers a safer alternative to genetic methods, its application is often hindered by practical limitations. These include reliance on complex cocktails of numerous compounds (e.g., six or more small molecules) administered in precise temporal sequences, which complicates operations and challenges reproducibility [18]. Furthermore, some protocols necessitate dynamic modulation of culture conditions, such as drastic FBS reduction in early stages, which may adversely affect cell viability and introduce additional variability [12].
Here, we demonstrate that the natural compound Psoralen acts as a potent synergistic enhancer. Combined with FP cocktail, Psr enables rapid and efficient reprogramming of MEFs into ciOBs within 21 days. We further identify the specific activation of the Adcy9/cAMP/PKA/CREB signaling axis as the mechanistic basis for Psr’s action.
A number of studies have identified small molecules involved in osteoblast differentiation, from which we selected eight candidate reprogramming factors for initial screening. From this panel, Forskolin (an ADCY activator), Phenamil (a BMP activator), and Tacrolimus (a calcineurin inhibitor) emerged as the most potent primary inducers, based on their ability to stimulate ALP activity, upregulate early osteogenic markers, and initiate mineralization (Supplementary Figure S2). Subsequent combinatorial testing with Psr revealed a specific and potent synergy exclusive to the FP combination, which dramatically accelerated the appearance of ALP activity and enhanced matrix mineralization (Supplementary Figure S3). This optimized FP + Psr cocktail was thereby established and utilized for all subsequent investigations.
Phenamil is a recognized osteoinductive small molecule that functions by potentiating BMP signaling [33]. It has been shown to induce osteogenic differentiation in intact human amniotic epithelial stem cells [34] and to have an osteoinductive effect on the preodontoblastic dental pulp stem cells [35] and adipose-derived stem cells [36]. In an in vivo study, delivery of phenamil together with BMP-2 could coordinately improve bone repair in a rat model of critical-sized bone defect [37]. Forskolin, a diterpenoid from Coleus forskohlii, plays a primary role not only in osteogenic differentiation [38] but also in acquiring fibroblast plasticity [39]. It has been shown to drive cell reprogramming, including the acquisition of pluripotency [40] and induction into neuronal cells [41], cardiac cells (cardiomyocytes) [42], myogenic cells [43] and hepatocytes [44]. Forskolin activates ADCY by binding to an allosteric site adjacent to its catalytic center, where it synergizes with the stimulatory G protein alpha subunit to potently enhance the conversion of ATP to cAMP [45]. This second messenger, cAMP, subsequently regulates several physiological functions in mammals, including vascular relaxation and cardiac contraction [46]. However, the mammalian ADCY family comprises multiple isoforms with distinct regulatory properties [47]. Structural analyses indicate that N503 and S1035 residues are conserved in all the ADCY isoforms except ADCY9, where Serine 1035 aligns instead with an alanine residue [48]. Notably, ADCY9 is relatively insensitive to forskolin stimulation [49], suggesting its activation might be a critical, unaddressed node in reprogramming. Previous research has demonstrated that Psr exhibits a stronger binding affinity for ADCY9 and a higher docking score compared to forskolin [50]. This suggests that Psr may possess a greater capacity to activate ADCY9.
Psr, a natural furanocoumarin, has long been recognized for its osteoinductive properties. It promotes osteogenic differentiation in multiple stem cell types, including periodontal ligament stem cells and human bone marrow-derived mesenchymal stem cells toward osteogenesis [22,51], and stimulates osteoblast proliferation via MAPK signaling pathways [52]. Consistent with these in vitro findings, oral administration of Psr enhances alveolar bone regeneration in periodontitis models and exerts therapeutic effects in osteoporotic models [53,54]. Despite this broad evidence supporting the pro-osteogenic efficacy of Psr, its specific role and mechanism in chemical reprogramming remained unexplored. Given the identified limitation of forskolin in activating ADCY9 and the computational prediction of Psr’s high affinity for this isoform, we posited that Psr might bridge the critical gap in cAMP signaling by activating ADCY9 to complement the FP cocktail.
Our data robustly support this premise. The addition of Psr to the FP cocktail significantly upregulated ADCY9 expression and substantially increased cAMP levels in the culture supernatant compared to FP treatment alone. This Psr-mediated amplification of the upstream cAMP signal potently activated its canonical downstream effectors, PKA and the transcription factor CREB. PKA is a central regulator of diverse cellular functions, and its activity and subunit composition are critically involved in skeletal homeostasis and bone lesion formation [55]. Upon activation, PKA phosphorylates and regulates a wide array of substrates, including CREB [56]. Phosphorylated CREB (p-CREB) then translocates to the nucleus and binds to cAMP response elements (CREs), driving the transcription of key osteogenic genes such as RUNX2 [57]. The functional centrality of this ADCY9-initiated cAMP/PKA/CREB axis to the reprogramming process was definitively established by the adenylate cyclase inhibitor SQ22536 [58], which abolished both the signaling activation and the osteogenic outcomes induced by FP + Psr.
The therapeutic potential of FP + Psr-induced ciOBs was validated in vivo. Transplantation of these cells led to robust repair of both critical-sized calvarial defects and load-bearing distal femoral cortical defects. Moreover, they formed substantial, vascularized bone tissue in a heterotopic subcutaneous site, confirming their cell-autonomous osteogenic potential. Importantly, no tumor formation was observed following transplantation, supporting the safety profile of this cell source. These in vivo findings collectively substantiate the translational promise of our optimized reprogramming strategy for bone repair.
While our findings highlight the ADCY9/cAMP/PKA/CREB axis as a key mediator of Psr-enhanced reprogramming, we acknowledge that the signaling network governing osteogenic reprogramming is complex and that our proposed axis represents one component within this broader regulatory landscape. RUNX2, the master transcription factor of osteogenesis, is known to be regulated by multiple interconnected pathways, including MAPK, Wnt/β-catenin and BMP/SMAD signaling [59,60]. Notably, Psr has been previously reported to activate MAPK and BMP/SMAD pathways in osteoblasts [21,61], suggesting potential crosstalk between the cAMP/PKA/CREB axis and other signaling cascades. For instance, PKA-mediated phosphorylation has been shown to modulate the activity of components in the MAPK, Wnt/β-catenin and BMP/SMAD pathways, and these pathways may converge on common transcriptional targets such as RUNX2 to synergistically enhance osteogenic gene expression [62,63,64]. It is plausible that Psr simultaneously engages multiple pathways that converge on RUNX2 to cooperatively drive efficient osteogenic reprogramming. Future studies investigating the integration of these signaling networks would provide a more comprehensive understanding of the molecular mechanisms by which Psr enhances direct reprogramming.
Several limitations and future directions should be addressed. We observed technical difficulties in harvesting highly mature ciOBs due to extensive extracellular matrix accumulation in 2D culture, which reduced cell viability during enzymatic dissociation. This underscores the need for early integration of three-dimensional scaffolds or biomimetic culture systems to support both differentiation and downstream cell delivery. Furthermore, we acknowledge that the mechanical properties of the mineralized matrix generated by ciOBs were not assessed in this study. Future studies should include biomechanical testing (e.g., nanoindentation) to evaluate the functional integrity and load-bearing capacity of the bone tissue formed by these cells. Regarding sample size, the numbers used in this study varied depending on the experimental design. For most in vitro experiments (e.g., RT-qPCR, Western blot, immunofluorescence), n = 3 independent biological replicates were used. For CCK-8 viability assays and ELISA measurements of cAMP levels, n = 6 technical replicates were employed to ensure robust quantification. For in vivo studies, n = 5 mice per group were used for the calvarial and femoral cortical defect models, while n = 3 mice per group were used for the subcutaneous ectopic implantation model. These sample sizes were chosen based on preliminary effect sizes and common practice in the field and were sufficient to detect significant differences in the primary outcome measures. However, we acknowledge that for some parameters, particularly histological semi-quantitative assessments in the ectopic model, the sample size of n = 3 may be modest. Future studies with larger cohorts are warranted to confirm these findings and enhance statistical power. While we identified a critical signaling axis, the upstream target of Psr and the detailed epigenetic landscape it remodels remain to be fully elucidated. Future studies should focus on mapping the epigenetic and transcriptional changes induced by Psr, particularly in relation to chromatin accessibility, and enhancer activation. Single-cell transcriptomic or epigenomic analyses could provide deeper insights into lineage trajectories and heterogeneity during reprogramming.
In summary, we have developed a rapid and efficient chemical cocktail to generate functional osteoblasts by incorporating Psr as a synergistic enhancer, and we have deciphered that its efficacy stems from the specific potentiation of the ADCY9/cAMP/PKA/CREB pathway. This work provides both an improved cell source with direct therapeutic validation and a pivotal mechanistic insight, advancing the rational design of bone regeneration strategies.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/pharmaceutics18020279/s1, Figure S1: Characterization of mouse embryonic fibroblasts (MEFs) used for reprogramming; Figure S2: Forskolin, Phenamil, and Tacrolimus were identified as the most effective small molecules for directly reprogramming MEFs into ciOBs; Figure S3: Psr(25 μM) enhances the efficiency of direct reprogramming of MEFs into ciOBs; Figure S4: Phenotypic stability of ciOBs after small molecule withdrawal.

Author Contributions

Conceptualization, Z.Z.; methodology, R.Z.; software, W.L.; validation, W.L., H.L., D.C. and X.W.; formal analysis, W.L.; investigation, W.L.; data curation, W.L.; writing—original draft preparation, W.L.; writing—review and editing, H.L., R.Z. and Z.Z.; visualization, W.L.; supervision, Z.Z. and R.Z.; project administration, Z.Z. and R.Z.; funding acquisition, Z.Z., R.Z. and W.L. All authors have read and agreed to the published version of the manuscript.

Funding

This study was financially supported by the Fundamental Research Funds for the Central public welfare research institutes (ZZ16-YQ-033, YZX-202410), National Natural Science Foundation of China (grant number: 82074297), CACMS Innovation Fund (grant number: CI2021A00107).

Institutional Review Board Statement

All experimental procedures involving animals were conducted in strict accordance with the Guidelines for the Care and Use of Laboratory Animals and were approved by the Institutional Animal Care and Use Committee of the Laboratory Animal Center, Institute of Basic Theory for Chinese Medicine, China Academy of Chinese Medical Sciences on 1 March 2024 (Approval Certification No. IBTCMCACMS21-2403-17; Acceptance No. IBTCMCACMS-2403017). The study was performed under a detailed experimental protocol, which was prepared and finalized prior to seeking ethical approval. Every effort was made to minimize animal suffering and to reduce the number of animals used while maintaining scientific validity.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

Abbreviations

ADCYAdenylyl Cyclase
ARSAlizarin Red S
ALPAlkaline Phosphatase
BMCBone Mineral Content
BMDBone Mineral Density
BMPBone Morphogenetic Protein
BSBone Surface
BS/TVBone Surface to Total Volume ratio
BV/TVBone Volume Fraction
cAMPCyclic Adenosine Monophosphate
ciOBsChemically Induced osteoblast-like Cells
FBSFetal Bovine Serum
FForskolin
GSK-3α/βGlycogen Synthase Kinase-3 alpha/beta
micro-CTMicro-computed Tomography
MEFsMouse embryonic fibroblasts
OMOsteogenic Induction Medium
PPhenamil
p-CREBPhosphorylated CREB
PKAProtein kinase A
PsrPsoralen
RT-qPCRReverse Transcription quantitative PCR
SQSQ22536
SEMStandard Error of the Mean.
TMCTissue Mineral Content
TGF-βTransforming Growth Factor-beta
HMG-CoA3-hydroxy-3-methylglutaryl-coenzyme A
WBWestern Blot

References

  1. Zhang, Y.X.; Chen, S.L.; Li, Y.M.; Zheng, Y.W. Limitations and challenges of direct cell reprogramming in vitro and in vivo. Histol. Histopathol. 2022, 37, 723–737. [Google Scholar] [PubMed]
  2. Fallah, A.; Beke, A.; Oborn, C.; Soltys, C.L.; Kannu, P. Direct Reprogramming of Fibroblasts to Osteoblasts: Techniques and Methodologies. Stem Cells Transl. Med. 2024, 13, 362–370. [Google Scholar] [CrossRef] [PubMed]
  3. Chang, Y.; Cho, B.; Kim, S.; Kim, J. Direct conversion of fibroblasts to osteoblasts as a novel strategy for bone regeneration in elderly individuals. Exp. Mol. Med. 2019, 51, 1–8. [Google Scholar] [CrossRef] [PubMed]
  4. Zhu, H.; Swami, S.; Yang, P.; Shapiro, F.; Wu, J.Y. Direct Reprogramming of Mouse Fibroblasts into Functional Osteoblasts. J. Bone Miner. 2020, 35, 698–713. [Google Scholar] [CrossRef]
  5. Yang, D.W.; Moon, J.S.; Ko, H.M.; Shin, Y.K.; Fukumoto, S.; Kim, S.H.; Kim, M.S. Direct reprogramming of fibroblasts into diverse lineage cells by DNA demethylation followed by differentiating cultures. Korean J. Physiol. Pharmacol. 2020, 24, 463–472. [Google Scholar] [CrossRef]
  6. Ahmed, M.F.; El-Sayed, A.K.; Chen, H.; Zhao, R.; Jin, K.; Zuo, Q.; Zhang, Y.; Li, B. Direct conversion of mouse embryonic fibroblast to osteoblast cells using hLMP-3 with Yamanaka factors. Int. J. Biochem. Cell Biol. 2019, 106, 84–95. [Google Scholar] [CrossRef]
  7. Samoilova, E.M.; Revkova, V.A.; Brovkina, O.I.; Kalsin, V.A.; Melnikov, P.A.; Konoplyannikov, M.A.; Galimov, K.R.; Nikitin, A.G.; Troitskiy, A.V.; Baklaushev, V.P. Chemical Reprogramming of Somatic Cells in Neural Direction: Myth or Reality? Bull. Exp. Biol. Med. 2019, 167, 546–555. [Google Scholar] [CrossRef]
  8. Nakai, K.; Yamamoto, K.; Kishida, T.; Kotani, S.I.; Sato, Y.; Horiguchi, S.; Yamanobe, H.; Adachi, T.; Boschetto, F.; Marin, E.; et al. Osteogenic Response to Polysaccharide Nanogel Sheets of Human Fibroblasts After Conversion into Functional Osteoblasts by Direct Phenotypic Cell Reprogramming. Front. Bioeng. Biotechnol. 2021, 9, 713932. [Google Scholar] [CrossRef]
  9. Feng, L.; Cook, B.; Tsai, S.Y.; Zhou, T.; LaFlamme, B.; Evans, T.; Chen, S. Discovery of a Small-Molecule BMP Sensitizer for Human Embryonic Stem Cell Differentiation. Cell Rep. 2016, 15, 2063–2075. [Google Scholar] [CrossRef]
  10. Han, X.; Yu, H.; Huang, D.; Xu, Y.; Saadatpour, A.; Li, X.; Wang, L.; Yu, J.; Pinello, L.; Lai, S.; et al. A molecular roadmap for induced multi-lineage trans-differentiation of fibroblasts by chemical combinations. Cell Res. 2017, 27, 386–401. [Google Scholar] [CrossRef]
  11. Dai, B.; Li, Q.; Song, X.; Ge, Y.; Wu, J.; Zhang, K.; Wang, C.; Zhang, Y.; Teng, H.; Li, C.; et al. Knockdown of Ggps1 in chondrocyte expedites fracture healing by accelerating the progression of endochondral ossification in mice. J. Bone Miner. Metab. 2018, 36, 133–147. [Google Scholar] [CrossRef] [PubMed]
  12. Yoon, J.Y.; Mandakhbayar, N.; Hyun, J.; Yoon, D.S.; Patel, K.D.; Kang, K.; Shim, H.S.; Lee, H.H.; Lee, J.H.; Leong, K.W.; et al. Chemically-induced osteogenic cells for bone tissue engineering and disease modeling. Biomaterials 2022, 289, 121792. [Google Scholar] [CrossRef] [PubMed]
  13. Yamamoto, K.; Kishida, T.; Nakai, K.; Sato, Y.; Kotani, S.I.; Nishizawa, Y.; Yamamoto, T.; Kanamura, N.; Mazda, O. Direct phenotypic conversion of human fibroblasts into functional osteoblasts triggered by a blockade of the transforming growth factor-β signal. Sci. Rep. 2018, 8, 8463. [Google Scholar] [CrossRef] [PubMed]
  14. Samiei, M.; Aghazadeh, M.; Alizadeh, E.; Aslaminabadi, N.; Davaran, S.; Shirazi, S.; Ashrafi, F.; Salehi, R. Osteogenic/Odontogenic Bioengineering with co-Administration of Simvastatin and Hydroxyapatite on Poly Caprolactone Based Nanofibrous Scaffold. Adv. Pharm. Bull. 2016, 6, 353–365. [Google Scholar] [CrossRef]
  15. Nabavi, M.H.; Salehi, M.; Ehterami, A.; Bastami, F.; Semyari, H.; Tehranchi, M.; Nabavi, M.A.; Semyari, H. A collagen-based hydrogel containing tacrolimus for bone tissue engineering. Drug Deliv. Transl. Res. 2020, 10, 108–121. [Google Scholar] [CrossRef]
  16. Tao, Z.; Ma, T.; Yang, M. Cyclosporine a inhibits bone regeneration and induces bone loss in a rat model. Int. Immunopharmacol. 2024, 132, 111951. [Google Scholar] [CrossRef]
  17. Luo, Y.; Liu, Y.; Wang, B.; Tu, X. CHIR99021-Treated Osteocytes with Wnt Activation in 3D-Printed Module Form an Osteogenic Microenvironment for Enhanced Osteogenesis and Vasculogenesis. Int. J. Mol. Sci. 2023, 24, 6008. [Google Scholar] [CrossRef]
  18. Li, Y.; Jiang, B.; Wu, Z.; Ma, Z.; Qiu, L.; Cui, W.; Zhao, Y.; Yan, J.; Ma, D.; Wu, X.; et al. Engineering fibroblast with reprogramming and spheronization for bone defect repair. Bioact. Mater. 2025, 50, 414–431. [Google Scholar] [CrossRef]
  19. Carreira, M.C.; Branco, A.; Casanova, M.; Smet, C.; da Silva, C.L.; Fernandes-Platzgummer, A. Differential effects of fetal bovine serum and human platelet lysate on mesenchymal stromal cell-mediated support of hematopoietic stem/progenitor cells: A functional and transcriptomic analysis. Stem Cell Res. Ther. 2025, 17, 6. [Google Scholar] [CrossRef]
  20. Zhou, T.; Xiong, H.; Yao, S.Y.; Wang, S.; Li, S.; Chang, J.; Zhai, Z.; Guo, D.S.; Fan, C.; Gao, C. Hypoxia and Matrix Metalloproteinase 13-Responsive Hydrogel Microspheres Alleviate Osteoarthritis Progression In Vivo. Small 2024, 20, e2308599. [Google Scholar] [CrossRef]
  21. Zang, D.; Niu, C.; Lu, X.; Aisa, H.A. A Novel Furocoumarin Derivative, 5-((diethylamino)me-13 thyl)-3-phenyl-7H-furo [3,2-g] chromen-7-one Upregulates Melanin Synthesis via the Activation of cAMP/PKA and MAPKs Signal Pathway: In Vitro and In Vivo Study. Int. J. Mol. Sci. 2022, 23, 14190. [Google Scholar] [CrossRef]
  22. Huang, Y.; Liao, L.; Su, H.; Chen, X.; Jiang, T.; Liu, J.; Hou, Q. Psoralen accelerates osteogenic differentiation of human bone marrow mesenchymal stem cells by activating the TGF-β/Smad3 pathway. Exp. Ther. Med. 2021, 22, 940. [Google Scholar] [CrossRef]
  23. Zang, D.; Niu, C.; Aisa, H.A. Amine derivatives of furocoumarin induce melanogenesis by activating Akt/GSK-3β/β-catenin signal pathway. Drug Des. Dev. Ther. 2019, 13, 623–632. [Google Scholar] [CrossRef] [PubMed]
  24. Liu, T.; Chen, M.; Zhao, Y.; Zhao, S.; Rui, C.; Li, W.; Yang, F. Oyster Shell Powder/PCL Composite Scaffolds Loaded with Psoralen Nanospheres Promote Large Bone Defect Repair. ACS Omega 2025, 10, 2231–2242. [Google Scholar] [CrossRef] [PubMed]
  25. Kulkarni, C.; Sharma, S.; Porwal, K.; Rajput, S.; Sadhukhan, S.; Singh, V.; Singh, A.; Baranwal, S.; Kumar, S.; Girme, A.; et al. A standardized extract of Coleus forskohlii root protects rats from ovariectomy-induced loss of bone mass and strength, and impaired bone material by osteogenic and anti-resorptive mechanisms. Front. Endocrinol. 2023, 14, 1130003. [Google Scholar] [CrossRef] [PubMed]
  26. Truchan, K.; Zagrajczuk, B.; Cholewa-Kowalska, K.; Osyczka, A.M. Rapid osteoinduction of human adipose-derived stem cells grown on bioactive surfaces and stimulated by chemically modified media flow. J. Biol. Eng. 2025, 19, 23. [Google Scholar] [CrossRef]
  27. Wang, Y.Y.; Pu, X.Y.; Shi, W.G.; Fang, Q.Q.; Chen, X.R.; Xi, H.R.; Gao, Y.H.; Zhou, J.; Xian, C.J.; Chen, K.M. Pulsed electromagnetic fields promote bone formation by activating the sAC-cAMP-PKA-CREB signaling pathway. J. Cell. Physiol. 2019, 234, 2807–2821. [Google Scholar] [CrossRef]
  28. Brehm, J.L.; Miles, M.M.; Remondini, K.S.; Ludwig, T.E. Preparation of Mouse Embryonic Fibroblasts as Feeders for iPSC Generation and Maintenance. Methods Mol. Biol. 2021, 2239, 213–234. [Google Scholar]
  29. Zhang, Y.; Wang, L.; Deng, F.; Qiu, H.; Wu, X. Determination of a critical size calvarial defect in senile osteoporotic mice model based on in vivo micro-computed tomography and histological evaluation. Arch. Gerontol. Geriatr. 2015, 61, 44–55. [Google Scholar] [CrossRef]
  30. Bondarenko, S.; Filipenko, V.; Ashukina, N.; Maltseva, V.; Ivanov, G.; Lazarenko, I.; Sereda, D.; Schwarzkopf, R. Comparative study in vivo of the osseointegration of 3D-printed and plasma-coated titanium implants. World J. Orthop. 2023, 14, 682–689. [Google Scholar] [CrossRef]
  31. Fu, L.; Zhao, Q.; Li, J.; Zhao, Z.; Wang, M.; Sun, H.; Xia, H. Fibroblasts Mediate Ectopic Bone Formation of Calcium Phosphate Ceramics. Materials 2022, 15, 2569. [Google Scholar] [CrossRef] [PubMed]
  32. Zhu, M.; Zhang, H.; Zhou, Q.; Sheng, S.; Gao, Q.; Geng, Z.; Chen, X.; Lai, Y.; Jing, Y.; Xu, K.; et al. Dynamic GelMA/DNA Dual-Network Hydrogels Promote Woven Bone Organoid Formation and Enhance Bone Regeneration. Adv. Mater. 2025, 37, e2501254. [Google Scholar] [CrossRef]
  33. Liu, Y.; Hu, J.; Sun, H. Mineralized nanofibrous scaffold promotes phenamil-induced osteoblastic differentiation while mitigating adipogenic differentiation. J. Tissue Eng. Regen. Med. 2020, 14, 464–474. [Google Scholar] [CrossRef] [PubMed]
  34. Ahmadi, A.; Ebadi, S.S.; Tayebi, T.; Ebadi, S.A.; Sarzaeem, M.M.; Niknejad, H. Osteogenic Differentiation Effect of BMP-9 with Phenamil and Simvastatin on Intact Human Amniotic Epithelial Stem Cells. Iran. Biomed. J. 2022, 26, 463–474. [Google Scholar] [CrossRef]
  35. Phung, S.; Lee, C.; Hong, C.; Song, M.; Yi, J.K.; Stevenson, R.G.; Kang, M.K.; Shin, K.H.; Park, N.H.; Kim, R.H. Effects of Bioactive Compounds on Odontogenic Differentiation and Mineralization. J. Dent. Res. 2017, 96, 107–115. [Google Scholar] [CrossRef]
  36. Fan, J.; Im, C.S.; Cui, Z.K.; Guo, M.; Bezouglaia, O.; Fartash, A.; Lee, J.Y.; Nguyen, J.; Wu, B.M.; Aghaloo, T.; et al. Delivery of Phenamil Enhances BMP-2-Induced Osteogenic Differentiation of Adipose-Derived Stem Cells and Bone Formation in Calvarial Defects. Tissue Eng. Part A 2015, 21, 2053–2065. [Google Scholar] [CrossRef]
  37. Fan, J.; Guo, M.; Im, C.S.; Pi-Anfruns, J.; Cui, Z.K.; Kim, S.; Wu, B.M.; Aghaloo, T.L.; Lee, M. Enhanced Mandibular Bone Repair by Combined Treatment of Bone Morphogenetic Protein 2 and Small-Molecule Phenamil. Tissue Eng. Part A 2017, 23, 195–207. [Google Scholar] [CrossRef]
  38. Awale, G.M.; Barajaa, M.A.; Kan, H.M.; Seyedsalehi, A.; Nam, G.H.; Hosseini, F.S.; Ude, C.C.; Schmidt, T.A.; Lo, K.W.; Laurencin, C.T. Regenerative engineering of long bones using the small molecule forskolin. Proc. Natl. Acad. Sci. USA 2023, 120, e2219756120. [Google Scholar] [CrossRef]
  39. E, W.; Fei, L.; Wang, J.; Wang, X.; Wang, R.; Wang, X.; Zhang, P.; Chen, J.; Wu, J.; Jiang, M.; et al. Dynamics of Cell Fate Decisions during Chemically Induced Multi-Lineage Trans-Differentiation at Single-Cell Level. Adv. Sci. 2025, 12, e2409642. [Google Scholar] [CrossRef]
  40. Kimura, K.; Tsukamoto, M.; Tanaka, M.; Kuwamura, M.; Ohtaka, M.; Nishimura, K.; Nakanishi, M.; Sugiura, K.; Hatoya, S. Efficient Reprogramming of Canine Peripheral Blood Mononuclear Cells into Induced Pluripotent Stem Cells. Stem Cells Dev. 2021, 30, 79–90. [Google Scholar] [CrossRef]
  41. Röderer, P.; Belu, A.; Heidrich, L.; Siobal, M.; Isensee, J.; Prolingheuer, J.; Janocha, E.; Valdor, M.; Hagendorf, S.; Bahrenberg, G.; et al. Emergence of nociceptive functionality and opioid signaling in human induced pluripotent stem cell-derived sensory neurons. Pain 2023, 164, 1718–1733. [Google Scholar] [CrossRef] [PubMed]
  42. Cai, Z.; Zhu, M.; Xu, L.; Wang, Y.; Xu, Y.; Yim, W.Y.; Cao, H.; Guo, R.; Qiu, X.; He, X.; et al. Directed Differentiation of Human Induced Pluripotent Stem Cells to Heart Valve Cells. Circulation 2024, 149, 1435–1456. [Google Scholar] [CrossRef] [PubMed]
  43. Niu, X.; Melendez, D.L.; Raj, S.; Cai, J.; Senadeera, D.; Mandelbaum, J.; Shestopalov, I.A.; Martin, S.D.; Zon, L.I.; Schlaeger, T.M.; et al. A conserved transcription factor regulatory program promotes tendon fate. Dev. Cell 2024, 59, 3106–3123.e12. [Google Scholar] [CrossRef] [PubMed]
  44. Blackford, S.J.I.; Yu, T.T.L.; Norman, M.D.A.; Syanda, A.M.; Manolakakis, M.; Lachowski, D.; Yan, Z.; Guo, Y.; Garitta, E.; Riccio, F.; et al. RGD density along with substrate stiffness regulate hPSC hepatocyte functionality through YAP signalling. Biomaterials 2023, 293, 121982. [Google Scholar] [CrossRef]
  45. Qi, C.; Sorrentino, S.; Medalia, O.; Korkhov, V.M. The structure of a membrane adenylyl cyclase bound to an activated stimulatory G protein. Science 2019, 364, 389–394. [Google Scholar] [CrossRef]
  46. MacRitchie, N.; Gurgone, D.; Wiejak, J.; Barker, G.; Burgoyne, P.; Lezoualc’h, F.; Maffia, P.; Yarwood, S.J. Selective EPAC1 activators enhance endothelial function in models of vascular inflammation. Pharmacol. Res. 2025, 220, 107923. [Google Scholar] [CrossRef]
  47. Antoni, F.A. The chilling of adenylyl cyclase 9 and its translational potential. Cell. Signal. 2020, 70, 109589. [Google Scholar] [CrossRef]
  48. Bhatia, V.; Maghsoudi, S.; Hinton, M.; Bhagirath, A.Y.; Singh, N.; Jaggupilli, A.; Chelikani, P.; Dakshinamurti, S. Characterization of Adenylyl Cyclase Isoform 6 Residues Interacting with Forskolin. Biology 2023, 12, 572. [Google Scholar] [CrossRef]
  49. Qi, C.; Lavriha, P.; Mehta, V.; Khanppnavar, B.; Mohammed, I.; Li, Y.; Lazaratos, M.; Schaefer, J.V.; Dreier, B.; Plückthun, A.; et al. Structural basis of adenylyl cyclase 9 activation. Nat. Commun. 2022, 13, 1045. [Google Scholar] [CrossRef]
  50. Tang, X.Y.; Dai, Z.Q.; Shi, D.F.; Zeng, J.X.; Wang, X.L.; Li, L.; Yao, X.S.; Dai, Y. An UHPLC-MS/MS method for simultaneous determination of ten sex steroid hormones in ovariectomy-induced osteoporosis rat and its application in discovery of sex steroid hormones regulatory components of Xian-Ling-Gu-Bao capsule. J. Pharm. Biomed. Anal. 2021, 195, 113888. [Google Scholar] [CrossRef]
  51. Yu, J.; Wu, X.; Zhang, W.; Chu, F.; Zhang, Q.; Gao, M.; Xu, Y.; Wu, Y. Effect of psoralen on the regulation of osteogenic differentiation induced by periodontal stem cell-derived exosomes. Hum. Cell 2023, 36, 1389–1402. [Google Scholar] [CrossRef]
  52. Li, F.; Li, Q.; Huang, X.; Wang, Y.; Ge, C.; Qi, Y.; Guo, W.; Sun, H. Psoralen stimulates osteoblast proliferation through the activation of nuclear factor-κB-mitogen-activated protein kinase signaling. Exp. Ther. Med. 2017, 14, 2385–2391. [Google Scholar] [CrossRef] [PubMed]
  53. Liu, H.; Xu, Y.; Cui, Q.; Liu, N.; Chu, F.; Cong, B.; Wu, Y. Effect of Psoralen on the Intestinal Barrier and Alveolar Bone Loss in Rats With Chronic Periodontitis. Inflammation 2021, 44, 1843–1855. [Google Scholar] [CrossRef] [PubMed]
  54. Yuan, X.; Bi, Y.; Yan, Z.; Pu, W.; Li, Y.; Zhou, K. Psoralen and Isopsoralen Ameliorate Sex Hormone Deficiency-Induced Osteoporosis in Female and Male Mice. BioMed Res. Int. 2016, 2016, 6869452. [Google Scholar] [CrossRef] [PubMed]
  55. Peng, H.; Hu, B.; Xie, L.Q.; Su, T.; Li, C.J.; Liu, Y.; Yang, M.; Xiao, Y.; Feng, X.; Zhou, R.; et al. A mechanosensitive lipolytic factor in the bone marrow promotes osteogenesis and lymphopoiesis. Cell Metab. 2022, 34, 1168–1182.e6. [Google Scholar] [CrossRef]
  56. Li, J.; Ye, H.; Xu, F.; Yang, Y.; Ge, C.; Yao, M.; Huang, P.; Wang, L.; Wang, N.; Zhou, X.; et al. Tong-Qiao-Huo-Xue Decoction promotes synaptic remodeling via cAMP/PKA/CREB pathway in vascular dementia rats. Phytomed. Int. J. Phytother. Phytopharm. 2024, 135, 156166. [Google Scholar] [CrossRef]
  57. Wang, X.; Chen, Y.; Cheng, Z.; Cao, Z.; Cheng, S.; Xin, C.; Zhang, J.; Zhang, F.; Chen, Y.; Wang, J.; et al. Pilose antler peptide enhances diabetic fracture healing by modulating the CREB-Smad2/3-Runx2 signaling axis. J. Ethnopharmacol. 2026, 354, 120514. [Google Scholar] [CrossRef]
  58. Rumiński, S.; Kalaszczyńska, I.; Lewandowska-Szumieł, M. Effect of cAMP Signaling Regulation in Osteogenic Differentiation of Adipose-Derived Mesenchymal Stem Cells. Cells 2020, 9, 1587. [Google Scholar] [CrossRef]
  59. Wang, K.; Kong, X.; Du, M.; Yu, W.; Wang, Z.; Xu, B.; Yang, J.; Xu, J.; Liu, Z.; Cheng, Y.; et al. Novel Soy Peptide CBP: Stimulation of Osteoblast Differentiation via TβRI-p38-MAPK-Depending RUNX2 Activation. Nutrients 2022, 14, 1940. [Google Scholar] [CrossRef]
  60. Zhu, S.; Chen, W.; Masson, A.; Li, Y.P. Cell signaling and transcriptional regulation of osteoblast lineage commitment, differentiation, bone formation, and homeostasis. Cell Discov. 2024, 10, 71. [Google Scholar] [CrossRef]
  61. Tang, D.Z.; Yang, F.; Yang, Z.; Huang, J.; Shi, Q.; Chen, D.; Wang, Y.J. Psoralen stimulates osteoblast differentiation through activation of BMP signaling. Biochem. Biophys. Res. Commun. 2011, 405, 256–261. [Google Scholar] [CrossRef]
  62. Yang, G.; Liu, H.; Yin, Z.; Zhao, L.; Chen, Y.; Li, Y.; Cheng, L.; Ma, J.; Yu, J.; Zhang, Y.; et al. ucOCN Promotes Testosterone Synthesis via the PKA-MAPK/ERK-CREB Signaling Pathway in Porcine Leydig Cells. Cells 2025, 14, 1937. [Google Scholar] [CrossRef]
  63. Yang, R.; Chu, H.; Yue, H.; Mishina, Y.; Zhang, Z.; Liu, H.; Li, B. BMP signaling maintains auricular chondrocyte identity and prevents microtia development by inhibiting protein kinase A. eLife 2024, 12, RP91883. [Google Scholar] [CrossRef]
  64. Yan, Z.; Ruan, B.; Zhu, Z.; Cao, X.; Lu, Z. Azoramide, a novel regulator, favors adipogenesis against osteogenesis through inhibiting the GLP-1 receptor-PKA-β-catenin pathway. Hum. Cell 2025, 38, 73. [Google Scholar] [CrossRef]
Pharmaceutics 18 00279 g001
Figure 1. Psr enhances FP-induced early osteogenic reprogramming of MEFs with an optimal concentration of 25 μM. (A), Phase-contrast images (upper panels) and ALP staining (lower panels) of MEFs on day 6 of induction under the indicated conditions. Red arrows in the phase-contrast images indicate cells that have transitioned from a fibroblastic spindle shape to a round, cuboidal, or short columnar morphology characteristic of osteoblast-like cells, with apparent nuclear enlargement. (B), Schematic diagram of the experimental timeline for in vitro reprogramming and analysis. (C), Quantitative real-time PCR (RT-qPCR) analysis of the mRNA expression levels of osteogenic markers Alp, Osterix, Bmp2 and Runx2 on day 6 (n = 3 per group). (D,E), Representative immunofluorescence images (red: Vimentin; blue: DAPI) and quantitative analysis of Vimentin fluorescence intensity on day 6 (n = 3 per group). Scale bars, 50 μm. (F,G), Representative immunofluorescence images (red: RUNX2; blue: DAPI) and quantitative analysis of RUNX2 fluorescence intensity on day 6 (n = 3 per group). Scale bars, 50 μm. (H), CCK-8 assay assessing cell viability on day 6 under the indicated conditions (n = 6 per group). All data are expressed as mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001; ns, not significant (p > 0.05).
Figure 1. Psr enhances FP-induced early osteogenic reprogramming of MEFs with an optimal concentration of 25 μM. (A), Phase-contrast images (upper panels) and ALP staining (lower panels) of MEFs on day 6 of induction under the indicated conditions. Red arrows in the phase-contrast images indicate cells that have transitioned from a fibroblastic spindle shape to a round, cuboidal, or short columnar morphology characteristic of osteoblast-like cells, with apparent nuclear enlargement. (B), Schematic diagram of the experimental timeline for in vitro reprogramming and analysis. (C), Quantitative real-time PCR (RT-qPCR) analysis of the mRNA expression levels of osteogenic markers Alp, Osterix, Bmp2 and Runx2 on day 6 (n = 3 per group). (D,E), Representative immunofluorescence images (red: Vimentin; blue: DAPI) and quantitative analysis of Vimentin fluorescence intensity on day 6 (n = 3 per group). Scale bars, 50 μm. (F,G), Representative immunofluorescence images (red: RUNX2; blue: DAPI) and quantitative analysis of RUNX2 fluorescence intensity on day 6 (n = 3 per group). Scale bars, 50 μm. (H), CCK-8 assay assessing cell viability on day 6 under the indicated conditions (n = 6 per group). All data are expressed as mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001; ns, not significant (p > 0.05).
Pharmaceutics 18 00279 g001
Pharmaceutics 18 00279 g002
Figure 2. Psr enhances FP-induced osteogenic maturation and matrix mineralization with an optimal concentration of 25 μM. (A,B), Alizarin Red S (ARS) staining and quantitative analysis of mineralized calcium deposition on day 21 of reprogramming under the indicated culture conditions (n = 3 per group). (C–F), mRNA expression levels of osteogenic markers (Runx2, Osteocalcin, Osteopontin, and Osteoprotegerin) on day 21 (n = 3 per group). (G–J), Western blot analysis and corresponding quantification of RUNX2, Osteocalcin and Vimentin protein expression on day 21 (n = 3 per group). β-actin was used as a loading control. (K), mRNA expression levels of mature osteoblast markers (Dmp1 and Sost) on day 21 (n = 3 per group). (L), mRNA expression levels of chondrogenic lineage markers (Sox9 and Col2a1) on day 21 (n = 3 per group). (M), mRNA expression levels of adipogenic lineage markers (Pparg and Fabp3) on day 21 (n = 3 per group). All data are expressed as mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001; ns, not significant (p > 0.05).
Figure 2. Psr enhances FP-induced osteogenic maturation and matrix mineralization with an optimal concentration of 25 μM. (A,B), Alizarin Red S (ARS) staining and quantitative analysis of mineralized calcium deposition on day 21 of reprogramming under the indicated culture conditions (n = 3 per group). (C–F), mRNA expression levels of osteogenic markers (Runx2, Osteocalcin, Osteopontin, and Osteoprotegerin) on day 21 (n = 3 per group). (G–J), Western blot analysis and corresponding quantification of RUNX2, Osteocalcin and Vimentin protein expression on day 21 (n = 3 per group). β-actin was used as a loading control. (K), mRNA expression levels of mature osteoblast markers (Dmp1 and Sost) on day 21 (n = 3 per group). (L), mRNA expression levels of chondrogenic lineage markers (Sox9 and Col2a1) on day 21 (n = 3 per group). (M), mRNA expression levels of adipogenic lineage markers (Pparg and Fabp3) on day 21 (n = 3 per group). All data are expressed as mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001; ns, not significant (p > 0.05).
Pharmaceutics 18 00279 g002
Pharmaceutics 18 00279 g003
Figure 3. Transplanted ciOBs promote bone regeneration in a mouse model of critical-sized calvarial defect. (A), Schematic timeline for the generation of ciOBs for in vivo transplantation studies. (B–H), In vivo osteogenic capacity of ciOBs. (B), Representative three-dimensional reconstruction images from micro-computed tomography (micro-CT) of calvarial defects at 4 weeks post-transplantation. Defects were treated with Matrigel, or Matrigel with ciOBs generated under the indicated conditions (OM, FP, FP + Psr). (C–H), Quantitative morphometric analysis of newly formed bone within the defect region (n = 5 mice per group). Yellow area indicates newly formed bone within the calvarial defect site. (C), Bone mineral content (BMC). (D), Bone mineral density (BMD). (E), Bone surface to total volume ratio (BS/TV). (F), Bone volume fraction (BV/TV). (G), Tissue mineral content (TMC). (H), Bone surface (BS). (I), Histological analysis of bone regeneration. Representative hematoxylin and eosin (H&E) and Masson’s trichrome staining of calvarial defect sections at 4 weeks post-transplantation. The red arrowhead indicates the location of the sagittal suture. All data are expressed as mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001; ns, not significant (p > 0.05).
Figure 3. Transplanted ciOBs promote bone regeneration in a mouse model of critical-sized calvarial defect. (A), Schematic timeline for the generation of ciOBs for in vivo transplantation studies. (B–H), In vivo osteogenic capacity of ciOBs. (B), Representative three-dimensional reconstruction images from micro-computed tomography (micro-CT) of calvarial defects at 4 weeks post-transplantation. Defects were treated with Matrigel, or Matrigel with ciOBs generated under the indicated conditions (OM, FP, FP + Psr). (C–H), Quantitative morphometric analysis of newly formed bone within the defect region (n = 5 mice per group). Yellow area indicates newly formed bone within the calvarial defect site. (C), Bone mineral content (BMC). (D), Bone mineral density (BMD). (E), Bone surface to total volume ratio (BS/TV). (F), Bone volume fraction (BV/TV). (G), Tissue mineral content (TMC). (H), Bone surface (BS). (I), Histological analysis of bone regeneration. Representative hematoxylin and eosin (H&E) and Masson’s trichrome staining of calvarial defect sections at 4 weeks post-transplantation. The red arrowhead indicates the location of the sagittal suture. All data are expressed as mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001; ns, not significant (p > 0.05).
Pharmaceutics 18 00279 g003
Pharmaceutics 18 00279 g004
Figure 4. Transplanted ciOBs facilitate bone regeneration in a mouse model of critical-sized distal femoral cortical defect. (A–D), In vivo osteogenic capacity of ciOBs in femoral defects. (A), Representative three-dimensional reconstruction images from micro-computed tomography (micro-CT) of femoral condyle defects at 2 weeks post-transplantation. Defects were treated with Matrigel, or Matrigel with ciOBs generated under the indicated conditions (OM, FP, FP + Psr). (B–D), Quantitative morphometric analysis of newly formed bone within the defect region (n = 5 mice per group). Red arrows indicate the femoral cortical defects in mice. (B), Bone mineral density (BMD). (C), Bone volume fraction (BV/TV). (D), Bone surface to total volume ratio (BS/TV). (E), Histological analysis of bone regeneration. Representative hematoxylin and eosin (H&E) and Masson’s trichrome staining of femoral condyle defect sections at 2 weeks post-transplantation. All data are expressed as mean ± SEM. ** p < 0.01, *** p < 0.001; ns, not significant (p > 0.05).
Figure 4. Transplanted ciOBs facilitate bone regeneration in a mouse model of critical-sized distal femoral cortical defect. (A–D), In vivo osteogenic capacity of ciOBs in femoral defects. (A), Representative three-dimensional reconstruction images from micro-computed tomography (micro-CT) of femoral condyle defects at 2 weeks post-transplantation. Defects were treated with Matrigel, or Matrigel with ciOBs generated under the indicated conditions (OM, FP, FP + Psr). (B–D), Quantitative morphometric analysis of newly formed bone within the defect region (n = 5 mice per group). Red arrows indicate the femoral cortical defects in mice. (B), Bone mineral density (BMD). (C), Bone volume fraction (BV/TV). (D), Bone surface to total volume ratio (BS/TV). (E), Histological analysis of bone regeneration. Representative hematoxylin and eosin (H&E) and Masson’s trichrome staining of femoral condyle defect sections at 2 weeks post-transplantation. All data are expressed as mean ± SEM. ** p < 0.01, *** p < 0.001; ns, not significant (p > 0.05).
Pharmaceutics 18 00279 g004
Pharmaceutics 18 00279 g005
Figure 5. Transplanted ciOBs promote ectopic bone formation in a subcutaneous implantation model. (A), Representative H&E staining of subcutaneous implants harvested at 8 weeks post-implantation (n = 3 mice per group). (B), Representative Masson’s trichrome staining of subcutaneous implants harvested at 8 weeks post-implantation (n = 3 mice per group). Mice were implanted with β-tricalcium phosphate (β-TCP) scaffolds alone or scaffolds seeded with ciOBs generated under the indicated conditions (OM, FP, FP + Psr). Red arrowheads indicate newly formed blood vessels. Areas of mineralized, bone-like tissue are marked with stars (☆). (C–E), Quantitative histomorphometric analysis of the implants (n = 3 per group). (C), Bone fill, expressed as the percentage of scaffold pore area occupied by mineralized bone tissue (red staining in Masson’s trichrome). (D), Collagen fibers, expressed as the percentage of scaffold pore area positive for collagen (blue staining in Masson’s trichrome). (E), Empty lacunae, expressed as the percentage of scaffold pore area devoid of tissue. All data are expressed as mean ± SEM. ** p < 0.01, *** p < 0.001.
Figure 5. Transplanted ciOBs promote ectopic bone formation in a subcutaneous implantation model. (A), Representative H&E staining of subcutaneous implants harvested at 8 weeks post-implantation (n = 3 mice per group). (B), Representative Masson’s trichrome staining of subcutaneous implants harvested at 8 weeks post-implantation (n = 3 mice per group). Mice were implanted with β-tricalcium phosphate (β-TCP) scaffolds alone or scaffolds seeded with ciOBs generated under the indicated conditions (OM, FP, FP + Psr). Red arrowheads indicate newly formed blood vessels. Areas of mineralized, bone-like tissue are marked with stars (☆). (C–E), Quantitative histomorphometric analysis of the implants (n = 3 per group). (C), Bone fill, expressed as the percentage of scaffold pore area occupied by mineralized bone tissue (red staining in Masson’s trichrome). (D), Collagen fibers, expressed as the percentage of scaffold pore area positive for collagen (blue staining in Masson’s trichrome). (E), Empty lacunae, expressed as the percentage of scaffold pore area devoid of tissue. All data are expressed as mean ± SEM. ** p < 0.01, *** p < 0.001.
Pharmaceutics 18 00279 g005
Pharmaceutics 18 00279 g006
Figure 6. Psr activates the Adcy9/cAMP/PKA/CREB signaling pathway to promote direct reprogramming of MEFs into osteoblast-like cells. (A), Schematic diagram of the experimental timeline for inhibitor treatment and analysis. (B–J), MEFs were treated with: Control (normal growth medium), OM (osteogenic induction medium), FP (OM + 10 μM forskolin + 10 μM phenamil), Psr (OM + 25 μM psoralen), or FP + Psr (OM +10 μM forskolin + 10 μM phenamil + 25 μM psoralen) for the indicated durations. (B), mRNA expression levels of Adcy9, Pkaca, Pkacb and Creb in MEFs on day 6 under the indicated conditions (n = 3 per group). (C), cAMP levels in the culture supernatant collected on day 6 under the indicated conditions (n = 6 per group). (D–J), Western blot analysis of Adcy9, PRKACB, CREB, and p-CREB protein expression in MEFs on day 6 under the indicated conditions (n = 3 per group). (K–S), To inhibit the Adcy9/cAMP/PKA/CREB pathway, 10 μM SQ22536 (SQ) was added to the FP or FP + Psr treatments. (K), Representative images of ALP staining on day 6 (upper panels) and ARS staining on day 21 (lower panels) of reprogramming. (L), Quantitative analysis of ARS staining (calcium deposition) on day 21 (n = 3 per group). (M), cAMP levels in the culture supernatant collected on day 6 under the indicated conditions (n = 6 per group). (N), mRNA expression levels of osteogenic markers (Alp, Runx2, Bmp2, Osterix) and signaling components (Adcy9, Pkaca, Pkacb, Creb) in MEFs under the indicated conditions (n = 3 per group). (O–S), Western blot analysis of Adcy9, PRKACB, CREB, and p-CREB protein expression under the indicated treatments (n = 3 per group). For all Western blot analyses (D–J,O–S), ATP1A1 was used as a loading control for Adcy9; β-actin served as the loading control for PRKACB and CREB; total CREB was used as the loading control for p-CREB. All data are expressed as mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.00; ns, not significant (p > 0.05).
Figure 6. Psr activates the Adcy9/cAMP/PKA/CREB signaling pathway to promote direct reprogramming of MEFs into osteoblast-like cells. (A), Schematic diagram of the experimental timeline for inhibitor treatment and analysis. (B–J), MEFs were treated with: Control (normal growth medium), OM (osteogenic induction medium), FP (OM + 10 μM forskolin + 10 μM phenamil), Psr (OM + 25 μM psoralen), or FP + Psr (OM +10 μM forskolin + 10 μM phenamil + 25 μM psoralen) for the indicated durations. (B), mRNA expression levels of Adcy9, Pkaca, Pkacb and Creb in MEFs on day 6 under the indicated conditions (n = 3 per group). (C), cAMP levels in the culture supernatant collected on day 6 under the indicated conditions (n = 6 per group). (D–J), Western blot analysis of Adcy9, PRKACB, CREB, and p-CREB protein expression in MEFs on day 6 under the indicated conditions (n = 3 per group). (K–S), To inhibit the Adcy9/cAMP/PKA/CREB pathway, 10 μM SQ22536 (SQ) was added to the FP or FP + Psr treatments. (K), Representative images of ALP staining on day 6 (upper panels) and ARS staining on day 21 (lower panels) of reprogramming. (L), Quantitative analysis of ARS staining (calcium deposition) on day 21 (n = 3 per group). (M), cAMP levels in the culture supernatant collected on day 6 under the indicated conditions (n = 6 per group). (N), mRNA expression levels of osteogenic markers (Alp, Runx2, Bmp2, Osterix) and signaling components (Adcy9, Pkaca, Pkacb, Creb) in MEFs under the indicated conditions (n = 3 per group). (O–S), Western blot analysis of Adcy9, PRKACB, CREB, and p-CREB protein expression under the indicated treatments (n = 3 per group). For all Western blot analyses (D–J,O–S), ATP1A1 was used as a loading control for Adcy9; β-actin served as the loading control for PRKACB and CREB; total CREB was used as the loading control for p-CREB. All data are expressed as mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.00; ns, not significant (p > 0.05).
Pharmaceutics 18 00279 g006
Table 1. Primer sequences used for RT-qPCR.
Table 1. Primer sequences used for RT-qPCR.
Gene Primer SequenceProduct Size (bp)
GapdhFGAATGGGAAGCTGGTCATCAA111
RCCAGTAGACTCCACGACATACT
AlpFGATTCCTGGCTCTGCCTTTAT87
RTCTGTGCAGTCTGTGTCTTG
Runx2FCCTGAACTCTGCACCAAGTCCT125
RTCATCTGGCTCAGATAGGAGGG
OsteocalcinFCTGCCCTAAAGCCAAACTCT104
RAGCTGCTGTGACATCCATAC
Bmp2FGTCCACATTAACCCAGAGGAAA120
RGACTGCAGGCCAGATAGTAAAG
OsterixFTCGTCTGACTGCCTGCCTAG94
RGTGAGATGCCTGCGTGGATG
OsteopontinFCTGCAGTTCTCCTGGCTGAA155
RTCTGGGTGCAGGCTGTAAAG
OsteoprotegerinFTCTTCAGGTTTGCTGTTCCTAC96
RCTACACTCTCGGCATTCACTTT
Adcy9FACCTTCTTCCTCCTGCTCCTCTTG115
RTCTGGATCTTGGTGCGGTGTAGG
PkacaFGCACTCCCTGGACCTCATCTAC87
RCCGAAGTCTGTCACCTGAATATAGC
PkacbFGGTTACAATAAGGCGGTGGACTG84
RGTCAGCAAAGAATGGAGGGTAGC
CrebFGCTGGCTAACAATGGTACGGATG106
RGGTCTGTGCATACTGTAGAATGGTAG
Dmp1FGTGATTTGGCTGGGTCACCA91
RTGGTCACTATTTGCCTGTCCC
SostFAGCCTTCAGGAATGATGCCAC134
RCTTTGGCGTCATAGGGATGGT
PpargFACGTTCTGACAGGACTGTGT131
RTGTGTCAACCATGGTAATTTCAGT
Fabp3FACCGGAAGGTCAAGTCACTG84
RTTAGTGTTGTCTCCTGCCCG
Sox9FTGCTATCTTCAAGGCGCTGC 98
RGACCCTGAGATTGCCCAGA
Col2a1FCGGTCCTACGGTGTCAGG137
RGCAGAGGACATTCCCAGTGT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, W.; Liu, H.; Wan, X.; Cheng, D.; Zhu, R.; Zhang, Z. Psoralen Promotes Direct Chemical Reprogramming of Mouse Embryonic Fibroblasts into Osteoblast-like Cells. Pharmaceutics 2026, 18, 279. https://doi.org/10.3390/pharmaceutics18020279

AMA Style

Li W, Liu H, Wan X, Cheng D, Zhu R, Zhang Z. Psoralen Promotes Direct Chemical Reprogramming of Mouse Embryonic Fibroblasts into Osteoblast-like Cells. Pharmaceutics. 2026; 18(2):279. https://doi.org/10.3390/pharmaceutics18020279

Chicago/Turabian Style

Li, Wenjie, Haixia Liu, Xinyu Wan, Ding Cheng, Ruyuan Zhu, and Zhiguo Zhang. 2026. "Psoralen Promotes Direct Chemical Reprogramming of Mouse Embryonic Fibroblasts into Osteoblast-like Cells" Pharmaceutics 18, no. 2: 279. https://doi.org/10.3390/pharmaceutics18020279

APA Style

Li, W., Liu, H., Wan, X., Cheng, D., Zhu, R., & Zhang, Z. (2026). Psoralen Promotes Direct Chemical Reprogramming of Mouse Embryonic Fibroblasts into Osteoblast-like Cells. Pharmaceutics, 18(2), 279. https://doi.org/10.3390/pharmaceutics18020279

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop