Engineering Lipid Nanoparticles to Enhance Intracellular Delivery of Transforming Growth Factor-Beta siRNA (siTGF-β1) via Inhalation for Improving Pulmonary Fibrosis Post-Bleomycin Challenge
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. siRNA-LNPs Formulation
2.2.1. Preparation of siRNA-LNPs Formulations
2.2.2. ILs Screening
2.2.3. Formulation Optimization
2.3. Characterization of siTGFβ1-LNPs
2.3.1. Preparation of siTGFβ1-LNPs
2.3.2. The Particle Morphology, Particle Size, and Zeta Potential of siTGFβ1-LNPs
2.3.3. Encapsulation Efficiency (EE%)
2.3.4. In Vitro Transfection Assay
2.3.5. Stability of TGFβ1-siRNA
2.3.6. LNPs Protect siRNA from Degradation
2.4. In Vitro Study
2.4.1. Cell Culture
2.4.2. Cell Viability
2.4.3. Cellular Uptake and Intracellular Localization
2.4.4. Lysosomal Escape
2.4.5. Wound Healing Assay
2.4.6. BLM-Induced Beas-2b Cell Damage Model Established and siTGFβ1-LNPs Intervention
2.4.7. Reactive Oxygen Species (ROS) Content Measurement
2.4.8. Hydroxyproline (HYP) Content Measurement
2.4.9. Quantitative Real-Time PCR in Cells
2.4.10. ELISA Analysis in Cells
2.5. In Vivo Study
2.5.1. Animal
2.5.2. In Vivo Tracking of siRNA-LNPs
2.5.3. Lung Coefficient
2.5.4. Histology Analysis
2.5.5. Hydroxyproline (HYP) Content
2.5.6. Quantitative Real-Time PCR in Lungs
2.5.7. ELISA Analysis in Lungs
2.6. Biosafety Study
2.7. Statistical Analysis
3. Results and Discussion
3.1. Screening of ILs for LNPs
3.2. Screen for Prescriptions with the Function of Being Delivered to the Lungs
3.3. Characterization of LNPs
3.4. Stability of LNPs
3.5. In Vitro
3.5.1. Cytotoxicity and Transfection Assay
3.5.2. Cellular Uptake Pathway Investigation
3.5.3. Research on Lysosomal Escape
3.5.4. Wound Healing
3.5.5. Reactive Oxygen Species (ROS) and Hydroxyproline (HYP)
3.5.6. Inflammation-Related Factor TGFβ1 and CTGF Expression
3.6. In Vivo
3.6.1. Pulmonary Retention of siCy3-LNPs After Nebulization
3.6.2. siTGFβ1-LNPs Mitigate BLM-Induced Pulmonary Fibrosis
3.7. Toxicity Evaluation of Heart, Kidney, Liver, and Spleen
3.8. The siTGFβ1-LNPs Mitigated BLM Toxicity by Suppressing EMT Through TGFβ/Smad2/3 Signaling
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Koudstaal, T.; Funke-Chambour, M.; Kreuter, M.; Molyneaux, P.L.; Wijsenbeek, M.S. Pulmonary fibrosis: From pathogenesis to clinical decision-making. Trends Mol. Med. 2023, 29, 1076–1087. [Google Scholar] [CrossRef]
- Prêle, C.M.; Miles, T.; Pearce, D.R.; O’Donoghue, R.J.; Grainge, C.; Barrett, L.; Birnie, K.; Lucas, A.D.; Baltic, S.; Ernst, M.; et al. Plasma cell but not CD20-mediated B-cell depletion protects from bleomycin-induced lung fibrosis. Eur. Respir. 2022, 60, 2101469. [Google Scholar] [CrossRef]
- Kropski, J.A.; Blackwell, T.S. Progress in Understanding and Treating Idiopathic Pulmonary Fibrosis. Annu. Rev. Med 2019, 70, 211–224. [Google Scholar] [CrossRef] [PubMed]
- George, P.M.; Wells, A.U.; Jenkins, R.G. Pulmonary fibrosis and COVID-19: The potential role for antifibrotic therapy. Lancet Respir. Med. 2020, 8, 807–815. [Google Scholar] [CrossRef]
- Sgalla, G.; Franciosa, C.; Simonetti, J.; Richeldi, L. Pamrevlumab for the treatment of idiopathic pulmonary fibrosis. Expert. Opin. Investig. Drugs 2020, 29, 771–777. [Google Scholar] [CrossRef]
- George, P.M.; Patterson, C.M.; Reed, A.K.; Thillai, M. Lung transplantation for idiopathic pulmonary fibrosis. Lancet Respir. Med. 2019, 7, 271–282. [Google Scholar] [CrossRef] [PubMed]
- Jolly, M.K.; Ward, C.; Eapen, M.S. Epithelial-mesenchymal transition, a spectrum of states: Role in lung development, homeostasis, and disease. Dev. Dyn. 2018, 247, 346–358. [Google Scholar] [CrossRef] [PubMed]
- Kramer, E.L.; Clancy, J.P. TGFβ as a therapeutic target in cystic fibrosis. Expert. Opin. Ther. Targets 2018, 22, 177–189. [Google Scholar] [CrossRef] [PubMed]
- Nawshad, A.; Lagamba, D.; Polad, A.; Hay, E.D. Transforming growth factor-beta signaling during epithelial-mesenchymal transformation: Implications for embryogenesis and tumor metastasis. Cells Tissues Organs 2005, 179, 11–23. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Yang, J.; Dai, C.; Wu, C.; Liu, Y. Role for integrin-linked kinase in mediating tubular epithelial to mesenchymal transition and renal interstitial fibrogenesis. J. Clin. Investig. 2003, 112, 503–516. [Google Scholar] [CrossRef]
- Biernacka, A.; Cavalera, M.; Wang, J.; Russo, I.; Shinde, A.; Kong, P.; Gonzalez-Quesada, C.; Rai, V.; Dobaczewski, M.; Lee, D.W.; et al. Smad3 signaling promotes fibrosis while preserving cardiac and aortic geometry in obese diabetic mice. Circ. Heart Fail. 2015, 8, 788–798. [Google Scholar] [CrossRef]
- Mokoena, D.; Dhilip Kumar, S.S.; Houreld, N.N.; Abrahamse, H. Role of photobiomodulation on the activation of the Smad pathway via TGF-β in wound healing. J. Photochem. Photobiol. B 2018, 189, 138–144. [Google Scholar] [CrossRef]
- Mei, Q.; Liu, Z.; Zuo, H.; Yang, Z.; Qu, J. Idiopathic Pulmonary fibrosis: An update on pathogenesis. Front. Pharmacol. 2021, 12, 797292. [Google Scholar] [CrossRef] [PubMed]
- Ihara, H.; Mitsuishi, Y.; Kato, M.; Takahashi, F.; Tajima, K.; Hayashi, T.; Hidayat, M.; Winardi, W.; Wirawan, A.; Hayakawa, D.; et al. Nintedanib inhibits epithelial-mesenchymal transition in A549 alveolar epithelial cells through regulation of the TGF-β/Smad pathway. Respir. Investig. 2020, 58, 275–284. [Google Scholar] [CrossRef]
- Conte, E.; Gili, E.; Fagone, E.; Fruciano, M.; Iemmolo, M.; Vancheri, C. Effect of pirfenidone on proliferation, TGF-β-induced myofibroblast differentiation and fibrogenic activity of primary human lung fibroblasts. Eur. J. Pharm. Sci. 2014, 58, 13–19. [Google Scholar] [CrossRef] [PubMed]
- Izzo, R.; Bevivino, G.; De Simone, V.; Sedda, S.; Monteleone, I.; Marafini, I.; Di Giovangiulio, M.; Rizzo, A.; Franzè, E.; Colantoni, A.; et al. Knockdown of smad7 with a specific antisense oligonucleotide attenuates colitis and colitis-driven colonic fibrosis in mice. Inflamm. Bowel Dis. 2018, 24, 1213–1224. [Google Scholar] [CrossRef]
- Van Rooij, E.; Sutherland, L.B.; Thatcher, J.E.; DiMaio, J.M.; Naseem, R.H.; Marshall, W.S.; Hill, J.A.; Olson, E.N. Dysregulation of microRNAs after myocardial infarction reveals a role of miR-29 in cardiac fibrosis. Proc. Natl. Acad. Sci. USA 2008, 105, 13027–13032. [Google Scholar] [CrossRef]
- Kandil, R.; Merkel, O.M. Pulmonary delivery of siRNA as a novel treatment for lung diseases. Ther. Deliv. 2019, 10, 203–206. [Google Scholar] [CrossRef] [PubMed]
- Hofemeier, P.; Sznitman, J. Revisiting pulmonary acinar particle transport: Convection, sedimentation, diffusion, and their interplay. J. Appl. Physiol. (1985) 2015, 118, 1375–1385. [Google Scholar] [CrossRef]
- Bassetti, M.; Vena, A.; Russo, A.; Peghin, M. Inhaled liposomal antimicrobial delivery in lung infections. Drugs 2020, 80, 1309–1318. [Google Scholar] [CrossRef] [PubMed]
- Kulkarni, J.A.; Witzigmann, D. Lipid nanoparticle technology for clinical translation of siRNA therapeutics. Acc. Chem. Res. 2019, 52, 2435–2444. [Google Scholar] [CrossRef] [PubMed]
- Cullis, P.R.; Felgner, P.L. The 60-year evolution of lipid nanoparticles for nucleic acid delivery. Nat. Rev. Drug Discov. 2024, 23, 709–722. [Google Scholar] [CrossRef]
- Di, J.; Du, Z.; Wu, K.; Jin, S.; Wang, X.; Li, T.; Xu, Y. Biodistribution and non-linear Gene expression of mRNA LNPs affected by delivery route and particle size. Pharm. Res. 2022, 39, 105–114. [Google Scholar] [CrossRef] [PubMed]
- Akinc, A.; Querbes, W.; De, S.; Qin, J.; Frank-Kamenetsky, M.; Jayaprakash, K.N.; Jayaraman, M.; Rajeev, K.G.; Cantley, W.L.; Dorkin, J.R.; et al. Targeted delivery of RNAi therapeutics with endogenous and exogenous ligand-based mechanisms. Mol. Ther. 2010, 18, 1357–1364. [Google Scholar] [CrossRef] [PubMed]
- Cryan, S.A.; Sivadas, N.; Garcia-Contreras, L. In vivo animal models for drug delivery across the lung mucosal barrier. Adv. Drug Deliv. Rev. 2007, 59, 1133–1151. [Google Scholar] [CrossRef] [PubMed]
- Merkel, O.M.; Rubinstein, I.; Kissel, T. siRNA delivery to the lung: What’s new? Adv. Drug Deliv. Rev. 2014, 75, 112–128. [Google Scholar] [CrossRef]
- Zheng, M.; Librizzi, D.; Kılıç, A.; Liu, Y.; Renz, H.; Merkel, O.M.; Kissel, T. Enhancing in vivo circulation and siRNA delivery with biodegradable polyethylenimine-graft-polycaprolactone-block-poly(ethylene glycol) copolymers. Biomaterials 2012, 33, 6551–6558. [Google Scholar] [CrossRef]
- Zimmermann, C.M.; Baldassi, D.; Chan, K.; Adams, N.B.P.; Neumann, A.; Porras-Gonzalez, D.L.; Wei, X.; Kneidinger, N.; Stoleriu, M.G.; Burgstaller, G.; et al. Spray drying siRNA-lipid nanoparticles for dry powder pulmonary delivery. J. Control Release 2022, 351, 137–150. [Google Scholar] [CrossRef] [PubMed]
- Eygeris, Y.; Gupta, M.; Kim, J.; Sahay, G. Chemistry of lipid nanoparticles for RNA delivery. Acc. Chem. Res. 2022, 55, 2–12. [Google Scholar] [CrossRef] [PubMed]
- Hald Albertsen, C.; Kulkarni, J.A.; Witzigmann, D.; Lind, M.; Petersson, K.; Simonsen, J.B. The role of lipid components in lipid nanoparticles for vaccines and gene therapy. Adv. Drug Deliv. Rev. 2022, 188, 114416. [Google Scholar] [CrossRef] [PubMed]
- Gao, J.; Yuan, J.; Liu, Q.; Wang, Y.; Wang, H.; Chen, Y.; Ding, W.; Ji, G.; Lu, Z. Adipose-derived stem cells therapy effectively attenuates PM(2.5)-induced lung injury. Stem Cell Res. Ther. 2021, 12, 355. [Google Scholar] [CrossRef] [PubMed]
- Reinhart, A.G.; Osterwald, A.; Ringler, P.; Leiser, Y.; Lauer, M.E.; Martin, R.E. Investigations into mRNA lipid nanoparticles shelf-Life stability under nonfrozen conditions. Mol. Pharm. 2023, 20, 6492–6503. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.; Jozic, A. Engineering lipid nanoparticles for enhanced intracellular delivery of mRNA through inhalation. ACS Nano 2022, 16, 14792–14806. [Google Scholar] [CrossRef] [PubMed]
- Bai, X.; Zhao, G. Inhaled siRNA nanoparticles targeting IL11 inhibit lung fibrosis and improve pulmonary function post-bleomycin challenge. Sci. Adv. 2022, 8, eabn7162. [Google Scholar] [CrossRef] [PubMed]
Batch | Model | MC3 (%) *1 | DSPC (%) *1 | DMG-PEG2000 (%) *1 | N/P *2 | Cholesterol (%) *1 |
---|---|---|---|---|---|---|
1 | 0 | 50 | 10 | 3 | 3.25 | 37 |
2 | −00+ | 40 | 10 | 3 | 5 | 47 |
3 | +00− | 60 | 10 | 3 | 1.5 | 27 |
4 | −0+0 | 40 | 10 | 5 | 3.25 | 45 |
5 | +0−0 | 60 | 10 | 1 | 3.25 | 29 |
6 | 0−0− | 50 | 7 | 3 | 1.5 | 40 |
7 | 00+− | 50 | 10 | 5 | 1.5 | 35 |
8 | 0−+0 | 50 | 7 | 5 | 3.25 | 38 |
9 | 0+−0 | 50 | 13 | 1 | 3.25 | 36 |
10 | +00+ | 60 | 10 | 3 | 5 | 27 |
11 | +−00 | 60 | 7 | 3 | 3.25 | 30 |
12 | 0++0 | 50 | 13 | 5 | 3.25 | 32 |
13 | 00−− | 50 | 10 | 1 | 1.5 | 39 |
14 | 0+0+ | 50 | 13 | 3 | 5 | 34 |
15 | 00−+ | 50 | 10 | 1 | 5 | 39 |
16 | 0−−0 | 50 | 7 | 1 | 3.25 | 42 |
17 | 0 | 50 | 10 | 3 | 3.25 | 37 |
18 | 0+0− | 50 | 13 | 3 | 1.5 | 34 |
19 | 00++ | 50 | 10 | 5 | 5 | 35 |
20 | +0+0 | 60 | 10 | 5 | 3.25 | 25 |
21 | −+00 | 40 | 13 | 3 | 3.25 | 44 |
22 | 0−0+ | 50 | 7 | 3 | 5 | 40 |
23 | 00−0 | 50 | 10 | 1 | 3.25 | 39 |
Gene Name | Primer (5′-3′) |
---|---|
M-IL-6-F | TACCACTTCACAAGTCGGAGGC |
M-IL-6-R | CTGCAAGTGCATCATCGTTGTTC |
M-IL-17A-F | CAGACTACCTCAACCGTTCCAC |
M-IL-17A-R | TCCAGCTTTCCCTCCGCATTGA |
M-Fn-F | CCCTATCTCTGATACCGTTGTCC |
M-Fn-R | TGCCGCAACTACTGTGATTCGG |
mα-SMA-F | GTACCCAGGCATTGCTGACA |
mα-SMA-R | GAGGCGCTGATCCACAAAAC |
mCollagen I-F | GTCAGACCTGTGTGTTCCCTACTCA |
mCollagen I-R | TCTCTCCAAACCAGACGTGCTTC |
M-CTGF-F | TCCGGACACCTAAAATCGCC |
M-CTGF-R | TTCATGATCTCGCCATCGGG |
M-TGFβ1-F | TACCTGAACCCGTGTTGCTCTC |
M-TGFβ1-R | GTTGCTGAGGTATCGCCAGGAA |
M-GAPDH-F | CTTTGTCAAGCTCATTTCCTGG |
M-GAPDH-R | TCTTGCTCAGTGTCCTTGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Deng, X.; Yang, Y.; Gan, L.; Duan, X.; Wang, X.; Zhang, J.; Wang, A.; Zhang, A.; Yuan, Z.; Chen, D.; et al. Engineering Lipid Nanoparticles to Enhance Intracellular Delivery of Transforming Growth Factor-Beta siRNA (siTGF-β1) via Inhalation for Improving Pulmonary Fibrosis Post-Bleomycin Challenge. Pharmaceutics 2025, 17, 157. https://doi.org/10.3390/pharmaceutics17020157
Deng X, Yang Y, Gan L, Duan X, Wang X, Zhang J, Wang A, Zhang A, Yuan Z, Chen D, et al. Engineering Lipid Nanoparticles to Enhance Intracellular Delivery of Transforming Growth Factor-Beta siRNA (siTGF-β1) via Inhalation for Improving Pulmonary Fibrosis Post-Bleomycin Challenge. Pharmaceutics. 2025; 17(2):157. https://doi.org/10.3390/pharmaceutics17020157
Chicago/Turabian StyleDeng, Xu, Yingjie Yang, Liming Gan, Xinliu Duan, Xiwei Wang, Jingyan Zhang, Aiping Wang, Anan Zhang, Zhizhao Yuan, Daquan Chen, and et al. 2025. "Engineering Lipid Nanoparticles to Enhance Intracellular Delivery of Transforming Growth Factor-Beta siRNA (siTGF-β1) via Inhalation for Improving Pulmonary Fibrosis Post-Bleomycin Challenge" Pharmaceutics 17, no. 2: 157. https://doi.org/10.3390/pharmaceutics17020157
APA StyleDeng, X., Yang, Y., Gan, L., Duan, X., Wang, X., Zhang, J., Wang, A., Zhang, A., Yuan, Z., Chen, D., & Zheng, A. (2025). Engineering Lipid Nanoparticles to Enhance Intracellular Delivery of Transforming Growth Factor-Beta siRNA (siTGF-β1) via Inhalation for Improving Pulmonary Fibrosis Post-Bleomycin Challenge. Pharmaceutics, 17(2), 157. https://doi.org/10.3390/pharmaceutics17020157