An mRNA-Based Multiple Antigenic Gene Expression System Delivered by Engineered Salmonella for Severe Fever with Thrombocytopenia Syndrome and Assessment of Its Immunogenicity and Protection Using a Human DC-SIGN-Transduced Mouse Model
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Ethics Statement
2.2. Bacterial Strains, Plasmids, Primers
2.3. Cell Lines and Virus
2.4. Bioinformatic Analysis of Target Proteins
2.5. Construction of the Eukaryotic Plasmid Expressing the Recombinant SFTSV Antigen
2.6. Immunofluorescence Assay
2.7. Expression of Recombinant Antigens In Vitro
2.8. Animal Experiments
2.9. Quantitative Real-Time PCR (qRT-PCR)
Strain/Plasmid | Description | Reference |
---|---|---|
Plasmid | ||
pJHL204 | asd+, CMV promoter, RdRp complex, SV40 promoter, 26Spromoter, pBR322 ori | Lab stock |
pJHL204-NP-Gn/Gc | asd+, CMV promoter, RdRp complex, SV40 promoter, 26Spromoter, pBR322 ori, NP-Gn/Gc-epitope | This study |
pJHL204-NP-P2A-GnGc | asd+, CMV promoter, RdRp complex, SV40 promoter, 26Spromoter, pBR322 ori, NP-P2A-Gn/Gc | This study |
pJHL204-NSs | asd+, CMV promoter, RdRp complex, SV40 promoter, 26Spromoter, pBR322 ori, NS | This study |
pJHL203-NP-GnGc | asd+, CMV promoter, RdRp complex, ΔSV40, promoter, Δ26Spromoter, pBR322 ori, NP-Gn/Gc-epitope | This study |
pJHL205-NP-GnGc | asd+, CMV promoter, RdRp complex, SV40 promoter, Δ26Spromoter, pBR322 ori, NP-Gn/Gc-epitope | This study |
pET28(+) | IPTG-inducible, T7 expression vector, C-terminal 6× histidine tag, KanR | Lab stock |
S. Typhimurium | ||
JOL2500 | Δlon ΔcpxR ΔsifA Δasd mutant of S. Typhimurium | Lab stock |
JOL2420 | JOL2500 containing pJHL204, vector control | This study |
JOL2424 | JOL2500 containing pJHL204-NP-Gn/Gc-epitope | This study |
JOL2425 | JOL2500 containing pJHL204-NP-P2A-Gn/Gc | This study |
JOL2426 | JOL2500 containing pJHL204-NS | This study |
E. coli | ||
DH5α | F-endA1, glnV44, thi-1, recA1, relA1, gyrA96, deoR, nupG, Φ80d lacZ ΔM15 Δ(lacZYA-argF)U169, hsdR17(rK- mK+), λ– | Lab stock |
BL21 (DE3) | F–, ompT, hsdSB (rB−, mB–), dcm, gal, λ (DE3) | Lab stock |
E.coli 232 | F–, k– u80 D(lacZYA-argF) endA1 recA1 hadR17 deoR thi-1 glnV44 gyrA96 relA1 DasdA4 | Lab stock |
Primer | ||
INF-γ-FW | TCAAGTGGCATAGATGTGGAAGAA | [44] |
INF-γ-RV | TGGCTCTGCAGGATTTTCATG | |
TNF-α-FW | CATCTTCTCAAAATTCGAGTGACAA | [44] |
TNF-α-RV | TGGGAGTAGACAAGGTACAACCC | |
IL-4-FW | ACAGGAGAAGGGACGCCAT | [44] |
IL-4-RV | GAAGCCCTACAGACGAGCTCA | |
IL-6-FW | CAGAATTGCCATCGTACAACTCTTTTCTCA | [44] |
IL-6-RV | AAGTGCATCATCGTTGTTCATACA | |
IL-10-FW | GGTTGCCAAGCCTTATCGGA | [44] |
IL-10-RV | ACCTGCTCCACTGCCTTGCT | |
β-actin-FW | AGAGGGAAATCGTGCGTGAC | [44] |
β-actin-RV | CAATAGTGATGACCTGGCCGT | |
S-segment-FW | GGGTCCCTGAAGGAGTTGTAAA | [46] |
S-segment-RV | TGCCTTCACCAAGACTATCAATGT |
Group (n = 8) | Bacterial Strain | Route | Dosage (CFU/100 µL) | Booster | Serum Collection |
---|---|---|---|---|---|
A | PBS | i.m | 1 × 100 | 1 × 100 | 0, 1, 2, 4, 6, 8 weeks post immunization |
B | JOL2420 | i.m | 1 × 107 | 1 × 107 | |
C | JOL2424 | i.m | 1 × 107 | 1 × 107 | |
D | JOL2425 | i.m | 1 × 107 | 1 × 107 | |
E | JOL2426 | i.m | 1 × 107 | 1 × 107 |
2.10. MTT Assay
2.11. Fluorescence-Activated Cell Sorting Analysis
2.12. Enzyme-Linked Immunosorbent Assay
2.13. Focus Reduction Neutralization Test
2.14. Quantification of Viral Copy Numbers by qRT-PCR
2.15. Histopathology
2.16. Statistical Analysis
3. Results
3.1. Validation and Construction of the Recombinant Eukaryotic Expression Vector Expressing the SFTSV Antigenic Genes
3.2. SFTSV Antigen Expression Confirmation
3.3. Cell-Mediated Immune Responses in Mice Immunized with SFTSV Vaccine Constructs
3.4. The Constructs Induced Robust Humoral Immune Response and Neutralizing Antibodies against SFTSV
3.5. Evaluation of Protective Efficacy of Constructs against SFTSV in an AAV-DC-SIGN-Transduced Mouse Model
4. Discussion and Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Blitvich, B.J.; Beaty, B.J.; Blair, C.D.; Brault, A.C.; Dobler, G.; Drebot, M.A.; Haddow, A.D.; Kramer, L.D.; LaBeaud, A.D.; Monath, T.P. Bunyavirus Taxonomy: Limitations and Misconceptions Associated with the Current ICTV Criteria Used for Species Demarcation. Am. J. Trop. Med. Hyg. 2018, 99, 11–16. [Google Scholar] [CrossRef]
- Matsuno, K.; Orba, Y.; Maede-White, K.; Scott, D.; Feldmann, F.; Liang, M.; Ebihara, H. Animal Models of Emerging Tick-Borne Phleboviruses: Determining Target Cells in a Lethal Model of SFTSV Infection. Front. Microbiol. 2017, 8, 104. [Google Scholar] [CrossRef]
- Lee, S.-Y.; Kang, J.-G.; Jeong, H.-S.; Kim, W.-M.; Son, K.-D.; Kim, J.S.; Oh, S.-S.; Cho, Y.-K.; Jheong, W.-H.; Chae, J.-S. Complete Genome Sequences of Two Severe Fever with Thrombocytopenia Syndrome Virus Strains Isolated from a Human and a Dog in the Republic of Korea. Genome Announc. 2019, 8, e01695-18. [Google Scholar] [CrossRef] [PubMed]
- Gai, Z.; Liang, M.; Zhang, Y.; Zhang, S.; Jin, C.; Wang, S.-W.; Sun, L.; Zhou, N.; Zhang, Q.; Sun, Y. Person-to-Person Transmission of Severe Fever With Thrombocytopenia Syndrome Bunyavirus Through Blood Contact. Clin. Infect. Dis. 2011, 54, 249–252. [Google Scholar] [CrossRef] [PubMed]
- Nakamura, S.; Iwanaga, N.; Hara, S.; Shimada, S.; Kashima, Y.; Hayasaka, D.; Abe, K.; Izumikawa, K.; Yanagihara, K.; Miyazaki, Y. Viral load and inflammatory cytokine dynamics associated with the prognosis of severe fever with thrombocytopenia syndrome virus infection: An autopsy case. J. Infect. Chemother. 2019, 25, 480–484. [Google Scholar] [CrossRef] [PubMed]
- Park, S.-W.; Lee, C.-S.; Kim, J.-H.; Bae, I.-G.; Moon, C.; Kwak, Y.G.; Kim, B.-N.; Lee, J.H.; Ryu, S.Y.; Jang, H.-C. Severe fever with thrombocytopenia syndrome: Comparison with scrub typhus and clinical diagnostic prediction. BMC Infect. Dis. 2019, 19, 174. [Google Scholar] [CrossRef]
- Yoshikawa, T. Vaccine Development for Severe Fever with Thrombocytopenia Syndrome. Viruses 2021, 13, 627. [Google Scholar] [CrossRef]
- Kwak, J.-E.; Kim, Y.-I.; Park, S.-J.; Yu, M.-A.; Kwon, H.-I.; Eo, S.; Kim, T.-S.; Seok, J.; Choi, W.-S.; Jeong, J.H. Development of a SFTSV DNA vaccine that confers complete protection against lethal infection in ferrets. Nat. Commun. 2019, 10, 3836. [Google Scholar] [CrossRef]
- Elliott, R.M.; Brennan, B. Emerging phleboviruses. Curr. Opin. Virol. 2014, 5, 50–57. [Google Scholar] [CrossRef] [PubMed]
- Yu, X.J.; Liang, M.F.; Zhang, S.Y.; Liu, Y.; Li, J.D.; Sun, Y.L.; Zhang, L.; Zhang, Q.F.; Popov, V.L.; Li, C. Fever with Thrombocytopenia Associated with a Novel Bunyavirus in China. N. Engl. J. Med. 2011, 364, 1523–1532. [Google Scholar] [CrossRef]
- Besselaar, T.G.; Blackburn, N.K. The synergistic neutralization of Rift Valley fever virus by monoclonal antibodies to the envelope glycoproteins. Arch. Virol. 1992, 125, 239–250. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Qi, Y.; Liu, C.; Gao, W.; Chen, P.; Fu, L.; Peng, B.; Wang, H.; Jing, Z.; Zhong, G. Nonmuscle Myosin Heavy Chain IIA Is a Critical Factor Contributing to the Efficiency of Early Infection of Severe Fever with Thrombocytopenia Syndrome Virus. J. Virol. 2014, 88, 237–248. [Google Scholar] [CrossRef]
- Kang, J.-G.; Jeon, K.; Choi, H.; Kim, Y.; Kim, H.-I.; Ro, H.-J.; Seo, Y.B.; Shin, J.; Chung, J.; Jeon, Y.K. Vaccination with single plasmid DNA encoding IL-12 and antigens of severe fever with thrombocytopenia syndrome virus elicits complete protection in IFNAR knockout mice. PLoS Negl. Trop. Dis. 2020, 14, e0007813. [Google Scholar] [CrossRef] [PubMed]
- Shata, M.T.; Stevceva, L.; Agwale, S.; Lewis, G.K.; Hone, D.M. Recent advances with recombinant bacterial vaccine vectors. Mol. Med. Today 2000, 6, 66–71. [Google Scholar] [CrossRef]
- Ashraf, S.; Kong, W.; Wang, S.; Yang, J.; Curtiss III, R. Protective cellular responses elicited by vaccination with influenza nucleoprotein delivered by a live recombinant attenuated Salmonella vaccine. Vaccine 2011, 29, 3990–4002. [Google Scholar] [CrossRef]
- Germanier, R.; Fiirer, E. Isolation and Characterization of Gal E Mutant Ty 21a of Salmonella typhi: A Candidate Strain for a Live, Oral Typhoid Vaccine. J. Infect. Dis. 1975, 131, 553–558. [Google Scholar] [CrossRef] [PubMed]
- Takaya, A.; Suzuki, M.; Matsui, H.; Tomoyasu, T.; Sashinami, H.; Nakane, A.; Yamamoto, T. Lon, a stress-induced ATP-dependent protease, is critically important for systemic Salmonella enterica serovar Typhimurium infection of mice. Infect. Immun. 2003, 71, 690–696. [Google Scholar] [CrossRef]
- León-Montes, N.; Nava-Galeana, J.; Rodríguez-Valverde, D.; Soria-Bustos, J.; Rosales-Reyes, R.; Rivera-Gutiérrez, S.; Hirakawa, H.; Ares, M.A.; Bustamante, V.H.; De la Cruz, M.A. The Two-Component System CpxRA Represses Salmonella Pathogenicity Island 2 by Directly Acting on the ssrAB Regulatory Operon. Microbiol. Spectr. 2022, 10, e02710-22. [Google Scholar] [CrossRef]
- López, C.; Checa, S.K.; Soncini, F.C. CpxR/CpxA Controls scsABCD Transcription To Counteract Copper and Oxidative Stress in Salmonella enterica Serovar Typhimurium. J. Bacteriol. 2018, 200, e00126-18. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.W.; Moon, K.H.; Baik, H.S.; Kang, H.Y.; Kim, S.K.; Bahk, J.D.; Hur, J.; Lee, J.H. Changes of physiological and biochemical properties of Salmonella enterica serovar Typhimurium by deletion of cpxR and lon genes using allelic exchange method. J. Microbiol. Methods 2009, 79, 314–320. [Google Scholar] [CrossRef]
- Kirthika, P.; Senevirathne, A.; Jawalagatti, V.; Park, S.; Lee, J.H. Deletion of the lon gene augments expression of Salmonella Pathogenicity Island (SPI)-1 and metal ion uptake genes leading to the accumulation of bactericidal hydroxyl radicals and host pro-inflammatory cytokine-mediated rapid intracellular clearance. Gut Microbes 2020, 11, 1695–1712. [Google Scholar] [CrossRef]
- Kirthika, P.; Lloren, K.K.S.; Jawalagatti, V.; Lee, J.H. Structure, Substrate Specificity and Role of Lon Protease in Bacterial Pathogenesis and Survival. Int. J. Mol. Sci. 2023, 24, 3422. [Google Scholar] [CrossRef] [PubMed]
- Nakayama, K.; Kelly, S.M.; Curtiss, R. Construction of an ASD+ Expression-Cloning Vector: Stable Maintenance and High Level Expression of Cloned Genes in a Salmonella Vaccine Strain. Nat. Biotechnol. 1988, 6, 693–697. [Google Scholar] [CrossRef]
- Brumell, J.H.; Goosney, D.L.; Finlay, B.B. SifA, a type III secreted effector of Salmonella typhimurium, directs Salmonella-induced filament (Sif) formation along microtubules. Traffic 2002, 3, 407–415. [Google Scholar] [CrossRef]
- Boucrot, E.; Henry, T.; Borg, J.-P.; Gorvel, J.-P.; Méresse, S. The Intracellular Fate of Salmonella Depends on the Recruitment of Kinesin. Science 2005, 308, 1174–1178. [Google Scholar] [CrossRef] [PubMed]
- Ohlson, M.B.; Huang, Z.; Alto, N.M.; Blanc, M.-P.; Dixon, J.E.; Chai, J.; Miller, S.I. Structure and Function of Salmonella SifA Indicate that Its Interactions with SKIP, SseJ, and RhoA Family GTPases Induce Endosomal Tubulation. Cell Host Microbe 2008, 4, 434–446. [Google Scholar] [CrossRef]
- Senevirathne, A.; Park, J.-Y.; Hewawaduge, C.; Perumalraja, K.; Lee, J.H. Eukaryotic expression system complemented with expressivity of Semliki Forest Virus’s RdRp and invasiveness of engineered Salmonella demonstrate promising potential for bacteria mediated gene therapy. Biomaterials 2021, 279, 121226. [Google Scholar] [CrossRef] [PubMed]
- Siegel, R.W.; Adkins, S.; Kao, C.C. Sequence-specific recognition of a subgenomic RNA promoter by a viral RNA polymerase. Proc. Natl. Acad. Sci. USA 1997, 94, 11238–11243. [Google Scholar] [CrossRef]
- Kohno, A.; Emi, N.; Kasai, M.; Tanimoto, M.; Saito, H. Semliki Forest virus-based DNA expression vector: Transient protein production followed by cell death. Gene Ther. 1998, 5, 415–418. [Google Scholar] [CrossRef]
- Park, J.-Y.; Chandran, S.; Hewawaduge, C.; Lee, J.H. Development and evaluation of a mouse model susceptible to severe fever with thrombocytopenia syndrome virus by rAAV-based exogenous human DC-SIGN expression. Microb. Pathog. 2023, 178, 106079. [Google Scholar] [CrossRef]
- Yoshikawa, R.; Sakabe, S.; Urata, S.; Yasuda, J. Species-Specific Pathogenicity of Severe Fever with Thrombocytopenia Syndrome Virus Is Determined by Anti-STAT2 Activity of NSs. J. Virol. 2019, 93, e02226-18. [Google Scholar] [CrossRef]
- Yoshikawa, T.; Taniguchi, S.; Kato, H.; Iwata-Yoshikawa, N.; Tani, H.; Kurosu, T.; Fujii, H.; Omura, N.; Shibamura, M.; Watanabe, S. A highly attenuated vaccinia virus strain LC16m8-based vaccine for severe fever with thrombocytopenia syndrome. PLoS Pathog. 2021, 17, e1008859. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.-P.; Cong, M.-L.; Li, M.-H.; Kang, Y.-J.; Feng, Y.-M.; Plyusnin, A.; Xu, J.; Zhang, Y.-Z. Infection and pathogenesis of Huaiyangshan virus (a novel tick-borne bunyavirus) in laboratory rodents. J. Gen. Virol. 2012, 93, 1288–1293. [Google Scholar] [CrossRef] [PubMed]
- Hofmann, H.; Li, X.; Zhang, X.; Liu, W.; Kühl, A.; Kaup, F.; Soldan, S.S.; González-Scarano, F.; Weber, F.; He, Y. Severe fever with thrombocytopenia virus glycoproteins are targeted by neutralizing antibodies and can use DC-SIGN as a receptor for pH-dependent entry into human and animal cell lines. J. Virol. 2013, 87, 4384–4394. [Google Scholar] [CrossRef] [PubMed]
- Lozach, P.-Y.; Kühbacher, A.; Meier, R.; Mancini, R.; Bitto, D.; Bouloy, M.; Helenius, A. DC-SIGN as a Receptor for Phleboviruses. Cell Host Microbe 2011, 10, 75–88. [Google Scholar] [CrossRef]
- Kotterman, M.A.; Chalberg, T.W.; Schaffer, D.V.; Samulski, R.J.; Muzyczka, N.; Coon, C.S.; Rees, D.C.; Masters, R.; Sobotka, H.; Carr, J.J. Viral Vectors for Gene Therapy: Translational and Clinical Outlook. Annu. Rev. Biomed. Eng. 2015, 17, 63–89. [Google Scholar] [CrossRef]
- Reed, L.J.; Muench, H. A simple method of estimating fifty percent endpoints. Am. J. Epidemiol. 1938, 27, 493–497. [Google Scholar] [CrossRef]
- Lin, H.-T.; Tsai, H.-Y.; Liu, C.-P.; Yuan, T.T.-T. Comparability of bovine virus titers obtained by TCID50/mL and FAID50/mL. J. Virol. Methods 2010, 165, 121–124. [Google Scholar] [CrossRef] [PubMed]
- Obaidullah, A.J.; Alanazi, M.M.; Alsaif, N.A.; Albassam, H.; Almehizia, A.A.; Alqahtani, A.M.; Mahmud, S.; Sami, S.A.; Bin Emran, T. Immunoinformatics-guided design of a multi-epitope vaccine based on the structural proteins of severe acute respiratory syndrome coronavirus 2. RSC Adv. 2021, 11, 18103–18121. [Google Scholar] [CrossRef] [PubMed]
- Laskowski, R.A.; MacArthur, M.W.; Moss, D.S.; Thornton, J.M. PROCHECK: A program to check the stereochemical quality of protein structures. J. Appl. Crystallogr. 1993, 26, 283–291. [Google Scholar] [CrossRef]
- Laskowski, R.A.; Rullmann, J.A.C.; MacArthur, M.W.; Kaptein, R.; Thornton, J.M. AQUA and PROCHECK-NMR: Programs for checking the quality of protein structures solved by NMR. J. Biomol. NMR 1996, 8, 477–486. [Google Scholar] [CrossRef]
- Jinyong, Z.; Xiaoli, Z.; Weijun, Z.; Ying, G.; Gang, G.; Xuhu, M.; Quanming, Z. Fusion expression and immunogenicity of Bordetella pertussis PTS1-FHA protein: Implications for the vaccine development. Mol. Biol. Rep. 2010, 38, 1957–1963. [Google Scholar] [CrossRef] [PubMed]
- Kruisbeek, A.M. Isolation of Mouse Mononuclear Cells. Curr. Protoc. Immunol. 2000, 39, 3.1.1–3.1.5. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Overbergh, L.; Valckx, D.; Waer, M.; Mathieu, C. Quantification of murine cytokine mRNAs using real time quantitative reverse transcriptase PCR. Cytokine 1999, 11, 305–312. [Google Scholar] [CrossRef]
- Sun, Y.; Liang, M.; Qu, J.; Jin, C.; Zhang, Q.; Li, J.; Jiang, X.; Wang, Q.; Lu, J.; Gu, W. Early diagnosis of novel SFTS bunyavirus infection by quantitative real-time RT-PCR assay. J. Clin. Virol. 2012, 53, 48–53. [Google Scholar] [CrossRef] [PubMed]
- Nemzek, J.A.; Bolgos, G.L.; Williams, B.A.; Remick, D.G. Differences in normal values for murine white blood cell counts and other hematological parameters based on sampling site. Inflamm. Res. 2001, 50, 523–527. [Google Scholar] [CrossRef]
- Yu, K.-M.; Park, S.-J.; Yu, M.-A.; Kim, Y.-I.; Choi, Y.; Jung, J.U.; Brennan, B.; Choi, Y.K. Cross-genotype protection of live-attenuated vaccine candidate for severe fever with thrombocytopenia syndrome virus in a ferret model. Proc. Natl. Acad. Sci. USA 2019, 116, 26900–26908. [Google Scholar] [CrossRef]
- Zhao, Z.; Zheng, W.; Yan, L.; Sun, P.; Xu, T.; Zhu, Y.; Liu, L.; Tian, L.; He, H.; Wei, Y. Recombinant Human Adenovirus Type 5 Co-expressing RABV G and SFTSV Gn Induces Protective Immunity Against Rabies Virus and Severe Fever with Thrombocytopenia Syndrome Virus in Mice. Front. Microbiol. 2020, 11, 1473. [Google Scholar] [CrossRef]
- Komdeur, F.L.; Singh, A.; van de Wall, S.; Meulenberg, J.J.; Boerma, A.; Hoogeboom, B.N.; Paijens, S.T.; Oyarce, C.; de Bruyn, M.; Schuuring, E. First-in-Human Phase I Clinical Trial of an SFV-Based RNA Replicon Cancer Vaccine against HPV-Induced Cancers. Mol. Ther. 2021, 29, 611–625. [Google Scholar] [CrossRef]
- Crystal, R.G. Adenovirus: The First Effective In Vivo Gene Delivery Vector. Hum. Gene Ther. 2014, 25, 3–11. [Google Scholar] [CrossRef]
- Park, S.; Kirthika, P.; Jawalagatti, V.; Senevirathne, A.; Lee, J.H. Salmonella delivered Lawsonia intracellularis novel epitope-fusion vaccines enhance immunogenicity and confers protection against Lawsonia intracellularis in mice. Veter-Microbiol. 2021, 263, 109264. [Google Scholar] [CrossRef] [PubMed]
- Sharma, P.; Yan, F.; Doronina, V.A.; Escuin-Ordinas, H.; Ryan, M.D.; Brown, J.D. 2A peptides provide distinct solutions to driving stop-carry on translational recoding. Nucleic Acids Res. 2011, 40, 3143–3151. [Google Scholar] [CrossRef]
- Kim, J.H.; Lee, S.-R.; Li, L.-H.; Park, H.-J.; Park, J.-H.; Lee, K.Y.; Kim, M.-K.; Shin, B.A.; Choi, S.-Y. High Cleavage Efficiency of a 2A Peptide Derived from Porcine Teschovirus-1 in Human Cell Lines, Zebrafish and Mice. PLoS ONE 2011, 6, e18556. [Google Scholar] [CrossRef] [PubMed]
- Schroder, K.; Hertzog, P.J.; Ravasi, T.; Hume, D.A. Interferon-γ: An overview of signals, mechanisms and functions. J. Leukoc. Biol. 2004, 75, 163–189. [Google Scholar] [CrossRef]
- Liblau, R.S.; Singer, S.M.; McDevitt, H.O. Th1 and Th2 CD4+ T cells in the pathogenesis of organ-specific autoimmune diseases. Immunol. Today 1995, 16, 34–38. [Google Scholar] [CrossRef] [PubMed]
- Shepherd, F.R.; McLaren, J.E. T Cell Immunity to Bacterial Pathogens: Mechanisms of Immune Control and Bacterial Evasion. Int. J. Mol. Sci. 2020, 21, 6144. [Google Scholar] [CrossRef] [PubMed]
- Finco, O.; Frigimelica, E.; Buricchi, F.; Petracca, R.; Galli, G.; Faenzi, E.; Meoni, E.; Bonci, A.; Agnusdei, M.; Nardelli, F. Approach to discover T- and B-cell antigens of intracellular pathogens applied to the design of Chlamydia trachomatis vaccines. Proc. Natl. Acad. Sci. USA 2011, 108, 9969–9974. [Google Scholar] [CrossRef] [PubMed]
- Jung, D.; Rejinold, N.S.; Kwak, J.-E.; Park, S.-H.; Kim, Y.-C. Nano-patterning of a stainless steel microneedle surface to improve the dip-coating efficiency of a DNA vaccine and its immune response. Colloids Surf. B Biointerfaces 2017, 159, 54–61. [Google Scholar] [CrossRef]
- Lu, Q.-B.; Cui, N.; Hu, J.-G.; Chen, W.-W.; Xu, W.; Li, H.; Zhang, X.-A.; Ly, H.; Liu, W.; Cao, W.-C. Characterization of immunological responses in patients with severe fever with thrombocytopenia syndrome: A cohort study in China. Vaccine 2015, 33, 1250–1255. [Google Scholar] [CrossRef]
- Moskophidis, D.; Kioussis, D. Contribution of Virus-specific CD8+ Cytotoxic T Cells to Virus Clearance or Pathologic Manifestations of Influenza Virus Infection in a T Cell Receptor Transgenic Mouse Model. J. Exp. Med. 1998, 188, 223–232. [Google Scholar] [CrossRef] [PubMed]
- Thimme, R.; Wieland, S.; Steiger, C.; Ghrayeb, J.; Reimann, K.A.; Purcell, R.H.; Chisari, F.V. CD8+ T Cells Mediate Viral Clearance and Disease Pathogenesis during Acute Hepatitis B Virus Infection. J. Virol. 2003, 77, 68–76. [Google Scholar] [CrossRef]
- Wick, M.J. The role of dendritic cells during Salmonella infection. Curr. Opin. Immunol. 2002, 14, 437–443. [Google Scholar] [CrossRef] [PubMed]
- Gog, J.R.; Murcia, A.; Osterman, N.; Restif, O.; McKinley, T.J.; Sheppard, M.; Achouri, S.; Wei, B.; Mastroeni, P.; Wood, J.L.N. Dynamics of Salmonella infection of macrophages at the single cell level. J. R. Soc. Interface 2012, 9, 2696–2707. [Google Scholar] [CrossRef]
- Fraussen, J. IgM responses following SARS-CoV-2 vaccination: Insights into protective and pre-existing immunity. EBioMedicine 2022, 77, 103922. [Google Scholar] [CrossRef] [PubMed]
- Si, Z.; Madani, N.; Cox, J.M.; Chruma, J.J.; Klein, J.C.; Schön, A.; Phan, N.; Wang, L.; Biorn, A.C.; Cocklin, S. Small-molecule inhibitors of HIV-1 entry block receptor-induced conformational changes in the viral envelope glycoproteins. Proc. Natl. Acad. Sci. USA 2004, 101, 5036–5041. [Google Scholar] [CrossRef]
- Li, A.; Dai, X.; Chen, L.; Liu, L.; Li, C.; Liu, Y.; Wu, W.; Huang, X.; Li, J.; Wang, S. Immunogenicity and protective efficacy of an inactivated SFTS vaccine candidate in mice. Biosaf. Health 2022, 4, 45–52. [Google Scholar] [CrossRef]
- Hicks, P.; Westover, J.B.; Manzoni, T.B.; Roper, B.; Rock, G.L.; Boardman, K.M.; Blotter, D.J.; Gowen, B.; Bates, P. Safety, Immunogenicity and Efficacy of a Recombinant Vesicular Stomatitis Virus Vectored Vaccine Against Severe Fever with Thrombocytopenia Syndrome and Heartland Bandaviruses. bioRxiv 2021. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, J.-Y.; Hewawaduge, C.; Sivasankar, C.; Lloren, K.K.S.; Oh, B.; So, M.Y.; Lee, J.H. An mRNA-Based Multiple Antigenic Gene Expression System Delivered by Engineered Salmonella for Severe Fever with Thrombocytopenia Syndrome and Assessment of Its Immunogenicity and Protection Using a Human DC-SIGN-Transduced Mouse Model. Pharmaceutics 2023, 15, 1339. https://doi.org/10.3390/pharmaceutics15051339
Park J-Y, Hewawaduge C, Sivasankar C, Lloren KKS, Oh B, So MY, Lee JH. An mRNA-Based Multiple Antigenic Gene Expression System Delivered by Engineered Salmonella for Severe Fever with Thrombocytopenia Syndrome and Assessment of Its Immunogenicity and Protection Using a Human DC-SIGN-Transduced Mouse Model. Pharmaceutics. 2023; 15(5):1339. https://doi.org/10.3390/pharmaceutics15051339
Chicago/Turabian StylePark, Ji-Young, Chamith Hewawaduge, Chandran Sivasankar, Khristine Kaith S. Lloren, Byungkwan Oh, Mi Young So, and John Hwa Lee. 2023. "An mRNA-Based Multiple Antigenic Gene Expression System Delivered by Engineered Salmonella for Severe Fever with Thrombocytopenia Syndrome and Assessment of Its Immunogenicity and Protection Using a Human DC-SIGN-Transduced Mouse Model" Pharmaceutics 15, no. 5: 1339. https://doi.org/10.3390/pharmaceutics15051339
APA StylePark, J.-Y., Hewawaduge, C., Sivasankar, C., Lloren, K. K. S., Oh, B., So, M. Y., & Lee, J. H. (2023). An mRNA-Based Multiple Antigenic Gene Expression System Delivered by Engineered Salmonella for Severe Fever with Thrombocytopenia Syndrome and Assessment of Its Immunogenicity and Protection Using a Human DC-SIGN-Transduced Mouse Model. Pharmaceutics, 15(5), 1339. https://doi.org/10.3390/pharmaceutics15051339